ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Case Report

Case Report: Whole exome sequencing helps in accurate molecular diagnosis in siblings with a rare co-occurrence of paternally inherited 22q12 duplication and autosomal recessive non-syndromic ichthyosis.

[version 1; peer review: 2 approved]
PUBLISHED 31 Jul 2015
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Lamellar ichthyosis (LI), considered an autosomal recessive monogenic genodermatosis, has an incidence of approximately 1 in 250,000. Usually associated with mutations in the transglutaminase gene (TGM1), mutations in six other genes have, less frequently, been shown to be causative. Two siblings, born in a collodion membrane, presented with fish like scales all over the body. Karyotyping revealed duplication of the chromosome arm on 22q12+ in the father and two siblings. Whole exome sequencing revealed a homozygous p.Gly218Ser variation in TGM1; a variation reported earlier in an isolated Finnish population in association with autosomal recessive non-syndromic ichthyosis. This concurrence of a potentially benign 22q12+ duplication and LI, both rare individually, is reported here likely for the first time.

Keywords

Whole Exome Sequencing, Lamellar ichthyosis, chr22q12, genodermatosis, TGM1

Introduction

Autosomal recessive congenital ichthyosis (ARCI), a heterogeneous disorder of cornification of skin, encompasses three clinical subtypes: lamellar ichthyosis (LI; OMIM 242300); congenital ichthyosiform erythroderma (CIE; OMIM 242100); and harlequin ichthyosis (HI; OMIM 242500)1. LI has an incidence of approximately 1 in 250,000. Over 115 mutations in TGM1 and less frequent ones in six other genes (NIPAL4z, ALOX12B, CGI-58, FLJ39501, ICHYN and ABCA12) have been associated with the LI/CIE phenotypic spectrum worldwide2,3. Overlapping phenotypes and the non-specificity of the conventional histopathology, makes clinical diagnosis challenging in many cases and inaccurate in some4. Whole exome sequencing has become a useful diagnostic aid for genetic disorders including multigene dermatoses such as epidermolysis bullosa5,6 and acrokeratosis verruciformis7.

Case report

Two, 8 and 6-year-old, siblings born out of a non-consanguineous marriage (Figure 1a) presented with hyperpigmented fish-like scales all over the body including face and flexures ectropion, loss of lateral half of eyebrows and alopecia along the scalp margins (Figure 1b–1e). Both siblings were heat intolerant, photosensitive and hypohidrotic. Born uneventfully vaginally they were encased in a collodion membrane which was shed within a week of birth. There was no family history of any dermatoses. Slit lamp examination revealed bilateral keratitis. Karyotyping of their parents and the siblings performed previously revealed duplication of the chromosome arm on 22q12+ in the father and two siblings. The patients were put on daily oral (5 mg) isotretinoin after analysing their lipid profile.

5811fd24-809d-42f3-b990-2e743ed04cae_figure1.gif

Figure 1.

a) Pedigree of the family; (b), (c) and (d), (e) correspond to the ventral and dorsal views of siblings II:1, and II:2 respectively and shows hyperpigmented fish-like scales all over the body including face and flexures, ectropion, loss of lateral half of eyebrows and hair along scalp margins. Panel (f) shows the chromatogram from capillary sequencing for the parents and siblings, while panel (g) shows the domain organization of the protein and the location of the p.Gly218Ser variation with respect to the protein domains.

Considering the diagnosis of LI, whole exome sequencing was attempted. Genomic DNA (gDNA) was isolated from 5 ml of blood8 of each of the affected children after obtaining written informed consent conforming to the institutional ethical committee approvals (Dr. D.Y. Patil Vidyapeeth, Pune. Approval number DYPV/EC/178/14 ). The whole exome capture and library preparation (Nextera expanded exome, Illumina Inc., USA) were carried out according to the manufacturer’s instructions and followed by high throughput sequence generation on Hiseq 2500 with default 101 paired end single index sequence by synthesis chemistry (Illumina Inc., USA). The raw sequence reads were trimmed at a Phred score of 30 leaving over 44.9 and 33.45 million reads respectively for the two siblings. The variations were called against the hg19 version of the human genome using standard GATK-Picard pipeline with Burrows-Wheeler Alignment according to GATK best practice9. The variants from the genomes of both siblings were further analysed using ANNOVAR10 for coding region and also screened using the NCBI-Clinvar database (http://www.ncbi.nlm.nih.gov/clinvar/). Analysis revealed a homozygous p.Gly218Ser variation in TGM1 previously reported to be associated with autosomal recessive non-syndromic ichthyosis in an isolated Finnish population11. The variant mapped to the transglutaminase domain in the protein (Figure 1g) and was also predicted to be pathogenic by both SIFT (Sorts Intolerant From Tolerant)15 and PolyPhen216 (Polymorphism Phenotyping v2). This variation was further validated in parents and both siblings by site-specific PCR using a forward primer CTTCTCCTGGGGTCAGGCA and reverse primer GAGAAGTCCCAGGCTCCATC (Sigma Aldrich). The PCR was done using taq polymerase (Invitrogen, USA, Cat. No. 10342053) according to the manufacturer supplied protocol with a Tm of 60.5°C. The PCR products were size selected and gel purified (2% agarose) using qiaquick gel extraction kit (QIAGEN, NL) and performed capillary sequencing (Applied Biosystems) performed using manufacturer instruction. Analysis revealed the variant was heterozygous in parents, while homozygous in both affected siblings (Figure 1f).

Follow up after two years of low dose isotretinoin, titrated intermittently, revealed complete subsidence of ectropion, eclabium and alopecia with residual fine scales.

Discussion

ARCI is a rare disorder with an estimated prevalence of 1 per 200,000 population in Europe and 1 per 200,000–300,000 population in the United States. Neonates with LI typically present with a collodion membrane which dries and peels away and is replaced by brown, plate-like scales over the entire body. Disease course ranges from very mild to severe, latter entailing ectropion, eclabium, scarring supraciliary and scalp alopecia, and palmoplantar hyperkeratosis11.

DNA based molecular diagnosis is crucial in ichthyosis as it provides a firm basis for genetic counseling of affected individuals and families, and also permits prenatal diagnosis. In a cohort of 520 independent families with ARCI, mutations were identified by direct sequencing of the 6 ARCI genes identified to date in 78% of patients: 32% harbored mutations in TGM1, 16% in NIPAL4, 12% in ALOX12B, 8% in CYP4F22, 5% in ABCA12, and 5% in ALOXE3. Whole exome sequencing may fill in the diagnostic lacuna of at least 22% of the patients who failed in this study to exhibit mutations in any of the known ARCI genes, indicating the existence of additional loci, such as 2 loci on chromosome 12p11.2-q1312. The 22q12+ duplication is known to cause cat eye syndrome, which has a range of potential morbidities with the occurrence of characteristic triad of iris coloboma, aural tags and/or pits and anal atresia14, though none of these features were present in the father or the children.

To the best of our knowledge, this is the first reported concurrence of a potentially benign 22q12+ duplication and LI, both of which are extremely rare individually. The mother of the siblings is now pregnant and the present finding will be used to help screen the foetus prenatally.

Consent

Written informed consent for publication of their clinical details and clinical images was obtained from the parent of the patients.

Data availability

The raw exome sequencing data are available at the NCBI Sequence Read Archive (http://www.ncbi.nlm.nih.gov/sra), accession numbers SRX1096915 (II:1) and SRX1096920 (II:2).

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 31 Jul 2015
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Gupta A, Sharma Y, Deo K et al. Case Report: Whole exome sequencing helps in accurate molecular diagnosis in siblings with a rare co-occurrence of paternally inherited 22q12 duplication and autosomal recessive non-syndromic ichthyosis. [version 1; peer review: 2 approved]. F1000Research 2015, 4:446 (https://doi.org/10.12688/f1000research.6779.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 31 Jul 2015
Views
29
Cite
Reviewer Report 24 Aug 2015
Regina Fölster-Holst, Department of Dermatology, Allergology and Venerology, University of Kiel, Kiel, Germany 
Approved
VIEWS 29
Gupta et al. focused on two siblings with ARCI with confirmed TGM1 mutation. In addition they found 22q12 duplication in these siblings and in their father. The title and abstract are both appropriate for the article, and the abstract is a ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Fölster-Holst R. Reviewer Report For: Case Report: Whole exome sequencing helps in accurate molecular diagnosis in siblings with a rare co-occurrence of paternally inherited 22q12 duplication and autosomal recessive non-syndromic ichthyosis. [version 1; peer review: 2 approved]. F1000Research 2015, 4:446 (https://doi.org/10.5256/f1000research.7283.r10062)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
38
Cite
Reviewer Report 10 Aug 2015
Mohamed Badawy Hassan Tawfik Abdel-Naser, Faculty of Medicine, Ain Shams University, Cairo, Egypt 
Approved
VIEWS 38
  • The authors reported 2 siblings with lamellar ichthyosis (LI) and the family pedigree shows the autosomal pattern of inheritance. In addition, duplicate 22q12+ has been shown in the father and the 2 affected siblings. It seems, however, that this chromosomal abnormality is
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Abdel-Naser MBHT. Reviewer Report For: Case Report: Whole exome sequencing helps in accurate molecular diagnosis in siblings with a rare co-occurrence of paternally inherited 22q12 duplication and autosomal recessive non-syndromic ichthyosis. [version 1; peer review: 2 approved]. F1000Research 2015, 4:446 (https://doi.org/10.5256/f1000research.7283.r9750)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 31 Jul 2015
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.