ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Case Report

Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response

[version 1; peer review: 2 approved with reservations]
PUBLISHED 18 Mar 2015
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role  in  intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test,  follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.

Keywords

LHCGR, insertions, exon-1, poor ovarian response

Introduction

Luteinizing hormone (LH) is a key regulator of the female menstrual cycle1 and is produced by the anterior pituitary gland of gonadotroph cells. During ovulation, the LH surge is not only essential for the release of an egg from the follicle, but also regulates the formation of the corpus luteum. The corpus luteum in turn produces progesterone, which helps in the maintenance of pregnancy2,3. Therefore, LH along with its receptor complex has a cardinal role during reproductive processes4,5. The heterodimeric glycoproteins LH and chorionic gonadotrophin (CG) are mediated by luteinizing hormone/choriogonadotrophin receptor (LHCGR), which is a member of the G-Coupled receptor protein family. This receptor is expressed by the LHCGR gene located on chromosome 2p21 that consists of 11 or 12 exons and codes for around 600 amino acids. The LH receptor is located on Leydig cells in males, and theca, granulosa cells of the ovaries20. The receptor activation and inactivation are brought about by the conformation of amino acids in their localized regions6.

Women, whose LH receptor is down regulated with GnRH agonists or antagonists, may have decreased concentrations of luteinizing hormone and follicle stimulating hormone. This results in poor outcome due to low endogenous LH levels. Results from our earlier study demonstrated more number of oocytes and clinical pregnancies after use of recombinant LH(rLH) combined with recombinant follicle stimulating hormone (rFSH) in assisted reproductive therapy (ART)7. Although supplementation of LH is beneficial in a selected category of patients, a number of studies have also demonstrated that LHCGR mutations at specific amino acid regions result in mild or complete loss of receptor function8.

LHCGR gene mutations were first studied in men with Leydig cell hypoplasia, later they were extended to female reproductive disorders11. Studies have shown that inactivating base pair insertions in exon-1 of LHCGR gene are associated with low oocyte yield and also negatively associated with intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome in infertile population911. A recent investigation by Bentov et al., 2012 reported a 6bp insertion in exon-1 of LHCGR gene which was associated with recurrent IUI and IVF failures. Although many factors like age, low anti-mullerian hormone (AMH) etc. are indications for decreased oocyte yield, poor ovarian response and low ovarian reserves, recent publications have focused on FSHR and LHCGR mutations/polymorphisms. A study was initiated to delineate the possible role of LHCGR dysfunction in patients with poor ovarian response, low and moderate ovarian reserves11.

Materials and methods

Patient selection

A total of 114 patients was screened for LH receptor gene polymorphisms/mutations with the following inclusion criteria: number of antral follicle count <8, normal testosterone levels, low antimullerian hormone (AMH) and poor response to previous infertility treatment. Out of 114 patients, 3 patients showed a 6bp homozygous insertion and 23 patients showed heterozygous 6bp insertion as described previously11,12. However, a 54bp insertion in exon-1 of LHCGR gene was detected in a patient with a clinical history of poor response to human menopausal gonadotrophin (hMG) stimulation and recurrent cyst formation.

The study was approved by the institutional ethics committee and informed consent was obtained from the participants.

Case history and treatment

A 28-year old Indian woman with a marital life of 5 years suffering with infertility referred to the Krishna IVF clinic for evaluation and treatment. Physical examination revealed normal breast development, normal external and internal female genitalia with irregular menstrual cycles. The patient has a sibling with two children.

At day 2, basal ultrasound examination showed an anteverted uterus volume:48ml, a right side ovary volume of 14.43 ml with a growing follicle and a left side ovary volume of 6.32 ml. Antral follicle count was 6 combining both ovaries. The patient underwent diagnostic laparoscopy and hysteroscopy and the ovaries had a normal volume with thick capsules as shown (Figure 1). On patient’s request, gonadotrophin/IUI was planned three weeks after laparoscopy. Ultrasound examination detected a large functional cyst which was managed using oral contraceptive pill. In the first cycle, the patient was super ovulated with a dose of hMG of 150 units/day. No response was observed after 4 days and 6 days of stimulation. As the AMH (0.2 ng/dl) and the ovarian reserves were low and there was no other option available, in the next cycle patient was super ovulated with a hMG dose of 225 units/day for 10 days. On the 9th day of stimulation, one follicle with 18 to 20 mm diameter, 2 follicles with 1 to 9 mm and endometrial thickness of 10 mm were observed. A trigger dose of hCG 5000 IU was administered. Luteal support was provided with susten 200 mg vaginally. The patient had started bleeding p/v from 6 days after trigger dose of hCG. A day 2 scan in the subsequent cycle showed an ovarian cyst formation again.

8bd67a85-3c97-44b9-bfde-3700ee12f160_figure1.gif

Figure 1. Laparoscopic image showing ovary with thick capsule.

Because of the discrepancy between AFC, AMH and the ovarian volume, and the poor response to IUI stimulated cycles and the recurrent cyst formation, hCG stimulation test and LHCGR gene sequencing were performed.

hCG stimulation test

The hCG stimulation test was performed in a natural cycle. Baseline data of the patient hormonal profile were recorded. These showed serum FSH 10 mIU/ml, serum LH 8 mIU/ml, serum dehydroepiandrosterone (DHEA-S) 3.71 mcg/ml, serum testosterone 20 ng/dl, serum prolactin 14.1 ng/ml, indicating normal values, and serum AMH showed a value of <0.2 ng/ml. hCG increases the serum concentrations of androstendione and testosterone by acting through LHCGR. A dose of 10,000 units of hCG was administered subcutaneously. A blunted response to hCG was observed after 4 hours of administration as there was no significant change in the serum testosterone concentration (22 ng/dl) compared to baseline values. Based on the patient’s poor response to ovarian stimulation and hCG stimulation test, the patient was further referred to the molecular genetics department to investigate the possible LHCGR mutations/polymorphisms.

Genome analysis

Genomic DNA from peripheral blood of patient’s was isolated using a modified salting out method as described previously13. All the coding exons of the gene were amplified by polymerase chain reaction using primers designed using primer express software from Applied Biosystems, the amplified product was observed on 2% agarose gel electrophoresis and purified with Exo-Sap enzyme from Thermo Scientific21. The purified product was sequenced using big dye cycle sequencing kit on 3500 genetic analyzer and analyzed using Seq Scape (Life Technologies, USA).

The sequencing results revealed a 54bp insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCA)2 in exon-1 as shown (Figure 2). This insertion sequence gave rise to glutamine, lysine and leucine rich regions. Insertion in exon-1 of LHCGR gene, according to previous authors11,12,14, will have a profound effect on the LHCGR function as reflected by the patient history and hCG test.

8bd67a85-3c97-44b9-bfde-3700ee12f160_figure2.gif

Figure 2.

A) A dark yellow portion showing the reference sequence of LHCGR exon 1 from NCBI database and the insertion sequence shown in pink. B) Wild type protein sequence and the inserted aminoacids shown in red.

Results and discussion

LH regulates a number of reproductive functions in males as well as in females. LH and CG hormones act through the LH/CG receptor which facilitates the activation of different cell groups in the ovaries. LH triggers follicular maturation, ovulation and formation of corpus luteum and increases progesterone secretion in luteal phase2,3,14. Different chronological, hormonal, functional biomarkers are used to assess the ovarian response during controlled ovarian stimulation (COS)15. Along with these biomarkers, the possible roles of LHCGR mutations associated with different female reproductive disorders like oligo amenorrhea, recurrent pregnancy loss, ovarian resistance, infertility and IVF outcome have been studied by previous authors10,11,16,17. A 6bp (CTGCAG, amino acids: LQ) exon-1 insertion was first described in LHCGR after nucleotide position 54 in Leydig cell hypoplasia9,18. Later, a homozygous 33bp and a 27bp insertions (CTGCTGAAGCTGCTGCTGCTGCTGCAG, amino acids: ) were described by two authors after nucleotide position 54 presenting Leydig cell hypoplasia in males explaining a possible role in signal transduction12,19.

Here we present a homozygous mutation with a 54bp insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR of an infertile woman. Inactivating mutations of the hLHR are known to affect signaling pathways, decrease LH and its receptor binding. Improper folding of this receptor protein structure in the endoplasmic reticulum may result in decreased LHR expression which leads to reduced cell response14. One of the above stated mechanisms might have played a role in the poor ovarian response in the present case. The serum hCG stimulation test also showed a blunted response indicating reduced receptor function. The data from the present case are highly significant as the involvement of a possible genetic cause was delineated at an early stage of the infertility treatment. LHCGR mutations may lead to a reproductive catastrophe. Supplementation of LH in patients with LHCGR polymorphisms might offer a benefit for those who opt for IVF treatment. However the concept of LH supplementation may not yield a good response in such a type of homozygous LHCGR mutations. A blunted response might be observed at a very high doses with mature and immature oocytes. In such situations, in vitro maturation of oocytes, where in the dependence of hCG is less to cause the follicle maturation, can be an option for such patients. This study concludes that examination of LHCGR mutations/polymorphisms would be a useful investigation for classifying response, prognosis and management in infertile patients with low ovarian reserves.

Consent

Informed written consent to publish clinical data was obtained from the patient.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 18 Mar 2015
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Cheemakurthi RK, Achyuta Rama Raju G, Sivanaryana T et al. Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response [version 1; peer review: 2 approved with reservations]. F1000Research 2015, 4:72 (https://doi.org/10.12688/f1000research.6137.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 18 Mar 2015
Views
14
Cite
Reviewer Report 21 Jul 2015
Zi-Jiang Chen, Center for Reproductive Medicine, Shandong Provincial Hospital, Shandong University, Jinan, China 
Approved with Reservations
VIEWS 14
Correction from F1000Research – 22nd July 2015:
 
This report was mistakenly published with the summary status of ‘Approved’ and has now been corrected to the referee’s intended status of ‘Approved with Reservations’. No changes have been made to the text of
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Chen ZJ. Reviewer Report For: Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response [version 1; peer review: 2 approved with reservations]. F1000Research 2015, 4:72 (https://doi.org/10.5256/f1000research.6576.r9293)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
26
Cite
Reviewer Report 01 May 2015
Han Zhao, Shandong Provincial Key Laboratory of Reproductive Medicine, National Research Center for Assisted Reproductive Technology and Reproductive Genetics, Shandong University, Shandong, Jinan, China 
Approved with Reservations
VIEWS 26
The article has identified a 54bp homozygous insertion in exon-1 of LHCGR gene which was related to poor ovarian response and concluded that screening of LHCGR mutations/polymorphisms would be useful for prognosis and management of patients with low ovarian reserves. ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Zhao H. Reviewer Report For: Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response [version 1; peer review: 2 approved with reservations]. F1000Research 2015, 4:72 (https://doi.org/10.5256/f1000research.6576.r8534)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 18 Mar 2015
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.