Reactivity of vertebrate-directed phospho-eEF2 antibody against the Caenorhabditis elegans orthologue phospho-EEF-2

Introduction

Protein synthesis determines the cellular proteome and its regulation is pivotal to maintaining cellular homeostasis. This process is divided into three mains stages: initiation, elongation and termination¹. The most studied step in eukaryotes is translation initiation and its regulation is critical to cell survival under stress conditions. Elongation regulation is also important in modulating translation. During this process, eukaryotic elongation factor 2 (eEF2) catalyzes the translocation of peptidyl-tRNA from the A site to the P site on the ribosome. The phosphorylation of eEF2 at threonine 56 by eEF2 kinase (eEF2K) inhibits its binding to ribosome and thus its activity^2–5 in stress- or starvation-related conditions^6–8. eEF2 kinase is an atypical α-kinase, normally dependent on Ca²⁺ ions and calmodulin, and apparently has only one substrate, the elongation factor eEF2⁹. eEF2 phosphorylation by eEF2K results in a reduction in translation rate. C. elegans processes eEF2 and eEF2K orthologues, named as EEF-2 (94.8 kDa) and EFK-1 (87.8 kDa), respectively. As in other eukaryotes, the Thr56 residue and adjacent sequences in EEF-2 are conserved. The only described data about efk-1 shows that it is important to nutrient deprivation resistance¹⁰. My lab studies the role of efk-1 in various aspects of C. elegans survival and the simplest way to measure its activity is to determine the EEF-2 phosphorylation status. Here we show that phospho-eEF2 antibody from Cell Signaling Technology Inc., specific to vertebrates, has excellent reactivity against C. elegans phospho-EEF-2 and this property is preserved after freeze/thaw cycles.

Material and methods

C. elegans strains

The standard C. elegans strain N2 Bristol (Caenorhabditis Genetic Center – CGC- wild isolate) and knockout strain efk-1 (CGC#RB2588), were maintained at 15°C and propagated on E. coli strain OP50 (CGC) using established procedures^11,12. Gene knockout was verified by Polymerase Chain Reaction (PCR) using GoTaq® DNA polymerase (Promega) and specific primers to efk-1 (Fw- ATGACGATCGACACAACAAA/Rv- AGATCACCAACTCCTTGAATATCG) and act-1 (Fw-ACCATGTACCCAGGAATTGC/Rv- TGGAAGGTGGAGAGGGAAG) (Figure 1).

Figure 1. efk-1 knockout confirmation by PCR.

An efk-1 fragment (~790 bp) was amplified by PCR using specific primer pair to verify the knockout background (efk-1 KO) using N2 worms as positive control and act-1 amplification as load control.

Results

Using the described protocol, I could specifically detect the phosphorylated form of EEF-2, eEF-2 orthologue in C elegans since in efk-1 knockout worms, used as a negative control of efk-1 activity, there is no equivalent signal in western blots (Figure 2 and Figure 3). Detection of α-tubulin was used as a western blot load control. Some differences can be observed in α-tubulin detection when comparing lanes (Figure 2 and Figure 3), despite the use of approximately the same number of nematodes. This can be explained by the fact that some worms remain attached to the pipette tip after washes, and this effect can be circumvented adding 0.01% Triton X-100 (Sigma Aldrich) to C. elegans wash buffer (M9 buffer). In addition, both antibodies (directed to target and load control) can be used and detected simultaneously, reducing analysis time (Figure 3).

Figure 2. Phospho-eEF2 antibody specific to vertebrate eEF2 recognizes C. elegans phospho-EEF-2.

Western blot showing that phospho-eEF2 antibody recognizes C. elegans (N2 Bristol) phospho-EEF-2, since protein detection signal is absent in efk-1 knockout worms. A) phospho-EEF-2 detection at the first time antibody dilution in TBS-T-BSA. B) phospho-EEF-2 detection after five freeze/thaw cycles of the antibody in TBS-T-BSA. SE- short exposure (5 sec); LE-long exposure (1 min).

Figure 3. Phospho-eEF2 antibody and α-tubulin antibodies can be used simultaneously to C. elegans target detection.

Western blot showing that phospho-eEF2 and α-tubulin antibodies can be incubated and developed simultaneously. efk-1 knockout worms were used as negative control to phospho-EEF-2 detection showed in wild-type worms (N2). A) Western blot short exposure (1 min). B) Western blot short exposure (3 min). Indicated molecular weight based on Precision Plus Protein™ Dual Color Standard (Bio-Rad).

EEF-2 phosphorylation is not observed in efk-1 knockout C. elegans, indicating that EFK-1 is the sole EEF-2 kinase in my tested conditions. Surprisingly, primary antibodies diluted in TBS-T-BSA (either phospho-eEF2 and α-tubulin, together or individual dilutions), stored at -20°C, can be reutilized at least five times (by thawing at room temperature) without losing specificity/reactivity (Figure 2B).

Conclusion

In this work, I show that vertebrate-directed phospho-eEF2 antibody specifically recognizes C. elegans orthologue phospho-EEF-2. This finding is very useful to those who work with translation elongation regulation using C. elegans as a model and I recommend this antibody to detect EFK-1 activity in C. elegans.