ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Ability of device to collect bacteria from cough aerosols generated by adults with cystic fibrosis

[version 1; peer review: 2 approved]
PUBLISHED 05 Aug 2016
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Background: Identifying lung pathogens and acute spikes in lung counts remain a challenge in the treatment of patients with cystic fibrosis (CF). Bacteria from the deep lung may be sampled from aerosols produced during coughing.
Methods: A new device was used to collect and measure bacteria levels from cough aerosols of patients with CF. Sputum and oral specimens were also collected and measured for comparison. Pseudomonas aeruginosa, Staphylococcus aureus, Klebsiella pneumoniae, and Streptococcus mitis were detected in specimens using Real-Time Polymerase Chain Reaction (RT-PCR) molecular assays.
Results: Twenty adult patients with CF and 10 healthy controls participated. CF related bacteria (CFRB) were detected in 13/20 (65%) cough specimens versus 15/15 (100%) sputum specimens. Commensal S. mitis was present in 0/17 (0%, p=0.0002) cough specimens and 13/14 (93%) sputum samples. In normal controls, no bacteria were collected in cough specimens but 4/10 (40%) oral specimens were positive for CFRB.
Conclusions: Non-invasive cough aerosol collection may detect lower respiratory pathogens in CF patients, with similar specificity and sensitivity to rates detected by BAL, without contamination by oral CFRB or commensal bacteria.

Keywords

Cystic fibrosis, aerosols, specimen collection, respiratory infections, etiology

Introduction

The etiology of lower respiratory tract infections in the lungs is difficult to determine, in part because a good quality specimen from the site of the infection is not readily available14. Access to such a specimen would be an important advance in the monitoring and treatment of cystic fibrosis (CF), as well as other lower respiratory tract infections, such as pneumonia, tuberculosis, asthma, lung cancer, etc. Presently, oropharyngeal (OP), sputum, and bronchoalveolar lavage (BAL) specimens are typically used to monitor CF patients. OP specimens may be appropriate for detecting viruses, but are not ideal for most bacterial pathogens. Sputum is commonly collected to monitor CF but often contains contaminants and cystic fibrosis related bacteria (CFRB) from the upper respiratory tract. The difficulty some patients have in producing an acceptable sputum specimen further decreases the value of these samples, often causing the physician to treat the patient empirically14. BAL provides a specimen from the lungs but is an invasive procedure that cannot be routinely used. BAL specimens may also collect contaminants from the upper respiratory tract57.

An alternative source for a lung specimen is from aerosols generated during coughs812. Studies show that one cough can generate as many as 66,000 expelled particles10,13. Patients that have lower respiratory tract infections can infect others through respiratory dispersion of pathogens in aerosols generated by coughing or sneezing. Coughing produces a higher concentration of pathogens from the lower lungs than normal exhalation or sneezing813. A new cough specimen collection device (PneumoniaCheck™, Figure 1) collects aerosols from the lungs onto a micropore filter while minimizing contamination from the upper respiratory tract. Microbiology or molecular assays can then be used to detect pathogens collected on the device’s filter.

799a2f5b-b8b9-476e-b460-583cae829a0d_figure1.gif

Figure 1. PneumoniaCheck™ specimen storage and transport container.

The device uses a reservoir to separate oral contents from deep lung aerosols using fluid mechanics for separation (Figure 2). The initial volume of air that comes from exhalation or coughing is contaminated air from the upper respiratory tract, also known as anatomic dead space. When a patient coughs into the device, this air from the upper airways first flows into the reservoir (Figure 2a). The exhaled air flows to the reservoir first as it has the least resistance compared to the filter at the end of the device. This reservoir has a volume of 250 ml, approximately 100 ml greater than the volume of anatomic dead space in the average adult15, which ensures that all of the upper airway aerosols are completely separated out. The expanded reservoir is inelastic, creating a back-pressure, so subsequent exhaled breath is forced through the microbial filter (Figure 2b). Therefore, only lung aerosol contents are collected onto the filter and are free from upper airway contamination.

799a2f5b-b8b9-476e-b460-583cae829a0d_figure2.gif

Figure 2. PneumoniaCheck™ fluid mechanics airway separation.

(a) Contaminated upper airway particles from the mouth initially fill up air reservoir. (b) Then, uncontaminated lower airway particles from the lungs are captured onto filter.

A previous study demonstrated that the device’s filter is >99% effective in collecting airborne bacteria (approximately 3.1 μm in diameter) and viruses (approximately 2.8 μm in diameter)16. Sampling from normal individual controls showed zero collection of oral contents on the filter, even with up to 15 ml of liquid in the mouth (simulating sputum). The PneumoniaCheck™ device has been shown to significantly separate the lower airway gas from the upper airway gas based on oxygen and alcohol levels (p<0.0001)16.

CF is a genetic disease that affects the lungs of approximately 28,000 children and adults in the United States each year17. People with CF often have chronic lung infections and require regular monitoring to ensure that bacterial colonization does not develop into infection26,27. We used specimens from sputum and coughs to compare their abilities to capture, identify, and quantify relative levels of lung bacteria in adult CF patients. The goal of this study is to determine if the cough device can capture lung pathogens from adult patients with chronic lung infection while simultaneously excluding oral bacteria.

Materials and methods

Subjects

Patients with CF (n=20) aged >18 years old were recruited from the Emory Cystic Fibrosis Center Adult Clinic in Atlanta, Georgia. The Emory Institutional Review Board (H08353) approved the study and participants provided their written, informed consent. The sample size was sufficiently powered to demonstrate statistical significance for lower lung sampling without oral contamination. Tests of paired proportions were conducted using an exact form of the McNemar test to compare the presence of CFRB between two samples (i.e. cough and sputum). The Wilcoxon signed rank test was used to compare cycle threshold (CT) values between the different methods of sampling. The CT value of 60 was used as the upper limit of detection for all PCR assays to determine relative quantity of bacteria in each specimen.

Clinical measurements

Throat swabs and cough device specimens were collected from 10 healthy, non-smoking subjects for normal controls. Separately, a sputum specimen and cough device specimen were each collected from 20 adult patients with CF. Cough device specimen collection preceded sputum specimen collection in order to help induce sputum. Specimen collections were supervised and emergency equipment was readily available. Streptococcus mitis is a commensal bacterium that is found in the mouth but not in the lungs14. Streptococcus pneumoniae and Staphylococcus aureus are also commonly found in the oral cavity3. Pseudomonas aeruginosa, Staphylococcus aureus and Klebsiella pneumoniae are cystic fibrosis related bacteria (CFRB)1820. Oral and cough specimens were analyzed for these bacteria to determine levels of oral contamination.

Determining sufficient aerosol collection

Fennelly’s Cough Aerosol Sampling System (CASS)29,30 and Knibbs’ Distance Rig13 have demonstrated that cough particles can carry substantial concentrations of bacteria from lower respiratory infections. A previous article on the cough collection device describes the ability of the device to selectively sample from the lower lungs while excluding oral contaminants16. The cough device used in this study provides a less cumbersome option to Fennelly’s and Knibbs’ methods for lung specimen collection. Each patient coughed 10 times into the device to ensure sufficient aerosol collection.

Microbiology

Microbiology culturing has several limitations that decrease the efficiency and effectiveness of rapid diagnosis24. Throat, sputum, and cough specimens were all analyzed using molecular PCR methods. All specimens were processed in a BSL 2 safety cabinet. The cough device filter was removed, placed into a 2 ml sterile freezer vial, and stored at -80°C. Respiratory secretions captured on the filter were removed by hydrating the filter with 1mL of lysis buffer (MagNA Pure LC lysis buffer; Roche Applied Science, Indianapolis, IN), vortexing, incubating for 5 min at room temperature, and collected using a pipette. Fluid remaining in the filter was collected by placing the filter in a sterile Costar SpinX microfuge tube with a 0.45 micron filter (Corning Inc., Corning, NY), centrifuging for 1 min at 10,000 rpm, and retrieved using a pipette. The residual fluid was then combined with original collected fluid and then 400 μL was extracted on the MagNA Pure Compact Instrument (Roche Applied Science) per the manufacturer’s instructions. The extracted nucleic acid was eluted into 100 μL of elution buffer and stored at -80°C for qPCR testing.

The sputum specimen was mixed with 1 mL of phosphate buffered saline (PBS), homogenized with pipetting and vortexing, mixed with a 12.5 mM equal volume of freshly prepared dithiothreitol (DTT, No Weigh™ format, Fisher Scientific), and incubated at room temperature for 30 min with periodic vortexing. The resultant solution was divided into 400 μL aliquots and stored at -80°C. A 400 μL aliquot of the processed sample was then extracted on the MagNA Pure Compact Instrument and stored as described above.

The extracted nucleic acid was tested for P. aeruginosa, S. aureus, K. pneumoniae, and S. mitis targets by individual real-time PCR assays. The primer and probe sequences for these assays have been previously described25. The S. mitis primers are: Forward TTTTGTCATCTAGCCTTGC; Reverse GCAGTCATATCATCACCTTC and Probe ACTTGGGCAATCCCGACAGATTCTAAC, with a 5' FAM reporter and a 3' BHQ quencher. The PCR reactions were done with 5 μl of extracted nucleic acid from the specimens plus 12.5 μl of PerfeCTa Multiplex qPCR SuperMix (catalog no. 95063-200; Quanta BioSciences), 0.5 μM final concentrations of each primer, 0.1 μM final concentration of the probe, and nuclease-free water (catalog no. P1193; Promega) to a final reaction volume of 25 μL. Real-time PCR reactions were performed using an ABI 7500 standard machine (Life Technologies, Carlsbad, CA) with enzyme activation at 95°C for 5 min, followed by 45 cycles of 95°C for 15 seconds and 60°C for 1 min. All specimens from CF patients were run in duplicate for each target. The CT values for individual PCR assays were used as an indication of the relative quantity of bacteria in the specimen.

Results

All subjects completed specimen collection safely. Ten healthy subjects were used for controls. Sputum and cough specimens were successfully collected from 20 adult patients with CF, with the exception of five patients who could not produce a sputum specimen.

Normal controls demonstrated a high incidence of false positives from oral sampling, shown in Table 1. Bacteria were isolated from throat swabs in 4/10 (40%) normal, healthy control subjects. S. pneumoniae was positive in 2/10 (20%) oral specimens and S. aureus was positive in 3/10 (30%) oral specimens, with one subject positive for both bacteria. In contrast, 0/10 (0%, p=0.0313) cough specimens were positive for bacteria in normal controls. The calculated true negative rate or specificity for sputum specimens was 60% and 100% for cough specimens.

Table 1. Detection of bacteria in throat and cough specimens from normal, healthy controls.

ThroatCough
1S. aureusNegative
2NegativeNegative
3NegativeNegative
4S. aureusNegative
5S. aureus, S. pneumoniaeNegative
6NegativeNegative
7NegativeNegative
8S. pneumoniaeNegative
9NegativeNegative
10NegativeNegative

Specificity in the CF patients was similar. For the CF patients, S. mitis was isolated from 13/14 (93%) sputum specimens but in none of the cough specimens (0%, p=0.0002). The cough specimens collected no S. mitis. CFRB was collected in both specimen types. P. aeruginosa was isolated from 13/15 (87%) sputum specimens and 9/20 (45%) cough specimens (p=0.0213). S. aureus was isolated from 9/15 (60%) sputum specimens and 3/20 (15%) cough specimens. K. pneumoniae was isolated from 2/15 (13%) sputum specimens and 3/20 (15%) cough specimens.

In aggregate, sputum specimens were positive for CFRB in 15/15 (100%) samples. Cough specimens were positive for CFRB in 13/20 (65%) samples. The sputum specimens had a 93% rate of oral commensals. Sputum specimens were positive for three or more pathogens in 2/15 (13%) samples, and positive for two or more pathogens in 7/15 (47%) samples. In contrast, cough specimens had no commensals and were positive in 65% of the CF patients. The cough specimens were positive for two or more pathogens in 2/20 (10%, p<0.05) specimens and no cough specimens were positive for three or more pathogens. The results of these real-time PCR identifications are listed in Table 2.

Table 2. Detection of bacteria in sputum and cough specimens from adult CF patients.

SputumCough
n=15*%CT
range
n=20%CT
range
P. aeruginosa13/1587%18–332/2045%33–42
S. aureus9/1560%24–383/2015%36–40
K. pneumoniae2/1513%37–383/2015%39–43
CFRB total15/15100%18–3813/2065%33–43
2+ pathogens7/1547%18–382/2010%36–43
3+ pathogens2/1513%18–380/200%N/A
S. mitis13/14†93%24–410/17§0%N/A

* Five patients were unable to produce viable sputum specimens

† Six sputum specimens were not tested for S. mitis

§ Three cough specimens were not tested for S. mitis

CT values are inversely proportional to the quantity of bacteria in a sample, i.e. small values indicate higher quantities of colony forming units (CFU). For the CFRB samples, P. aeruginosa CT values ranged from 18–33 in sputum specimens and 33–42 in cough specimens. S. aureus CT values ranged from 24–38 in sputum specimens and 36–40 in cough specimens. For both P. aeruginosa and S. aureus the cough and sputum specimens significantly differed in CT values (p=0.0017 and 0.0092, respectively). K. pneumoniae CT values ranged from 37–38 in sputum specimens and 39–43 in cough specimens. Thus, the CT values for cough specimens were consistently higher than those of sputum. Note that the cough filter samples from normal controls exhibited no pathogens up to CT values of 60.

Discussion

It is widely recognized that a simple, safe, non-invasive, low maintenance, inexpensive, widely accessible sampler is needed for the collection of lower respiratory pathogens3437.

Collection of lower lung contents by coughing is much easier than BAL specimen collection. The method is convenient for patients who are already inclined to cough and they reported that the use of the device helped clear their lungs. Cough specimens may provide a non-invasive yet specific sample for in-home surveillance to watch for spikes in lung pathogens in patients with CF. Use of the device to collect cough aerosols has the potential to provide a clean alternative to oral samples for detecting lower lung pathogens.

As is well known, commonly used samples of sputum or OP swabs show strong contamination in the upper airway3,4. Nearly all of the sputum specimens were positive for the oral commensal S. mitis. In contrast, none of the cough specimens were positive for S. mitis. This difference in the commensal S. mitis between sputum and cough specimens reiterates the unreliability and low specificity of sputum3,4. Further, not all patients can produce an adequate sputum sample. Examining the 12 subjects with paired sputum and S. mitis results, 8/12 (67%) sputum and cough specimens had concordant positives, although six of these eight were positive for additional bacteria in sputum. These six sputum specimens with multiple bacteria likely indicate false positives from oral contamination rather than co-infection.

The number of concordant sputum and cough specimens (2/12, 17%) was small. Conversely, the pathogen detected in the cough specimen was different from that observed in the sputum specimen. 2/12 (17%) sputum specimens did not identify bacteria that were identified in cough specimens, possibly reflecting masked readings associated with commensal distraction. The differences demonstrate that the cough device is not just collecting sputum.

P. aeruginosa is the most common bacterium found in lungs of adult CF patients19, and was also the most prevalent bacterium collected in our cohort. 13/20 (65%) cough specimens were positive for CFRB. This incidence and distribution of pathogens in CF is similar to the 59% positive for CFRB in BAL sampling22,23. Prior series of BAL specimens in similar populations have yielded positive CFRB of 59–85%, similar to the 65% positivity from the cough device illustrating comparable sensitivity22,23.

Collection of exhaled aerosols has been studied by several previous groups. An alternate device for aerosol collection is the RTube™; however, it varies greatly in design and function28. The RTube™ system is designed to collect from all exhaled breath that condenses28 while PneumoniaCheck™ is designed to collect particulate sized lung aerosols and separate out the mouth contents16. The majority of exhaled gas passes out of the end of the RTube™ as only water condensate is intended to be collected. Exhaled breath condensate can be a useful specimen for identifying pH levels, but is generally not viewed as a reliable specimen for identifying lower respiratory infections3437.

Wainwright et al., reported detecting P. aeruginosa in cough aerosols by culture12. They reported 25/28 (89%) positive in a mixed population of children and adults with CF using a cough aerosol sampling system (CASS) for 5 minutes with each subject12. Similarly, Knibbs et al. reported that 14/18 (78%) patients aerosolized P. aeruginosa that remained viable and presumably transmissive up to 45 minutes after coughs sampled on an Anderson impactor13. Knibbs et al. used conventional microbiology cultures to quantify colony forming units. Both of these studies used a specially constructed aerosol sampler that is expensive, cumbersome, and difficult to use in a clinical setting. For these studies, patients cough into a standard mouthpiece and aerosols are sucked into impactors using vacuum air pumps. The CASS system was not designed for routine use in clinical settings and the mouthpiece was not designed to exclude oral contents. These designs differ from PneumoniaCheck™, which has a mouthpiece designed to specifically exclude oral contaminants16. The high incidence of P. aeruginosa, using the snorkel type mouthpiece and tubing, may reflect some collection of oral contents using CASS.

RT-PCR may be used to quantify the amount of pathogens in a sample. As more material is collected on the filter, the CT counts will drop similar to the inverse of CFUs32. It should be noted that an aerosolized lung specimen should have higher CT values compared to the liquid specimens of sputum due to a lack of contamination and the small physical volume of aerosols. CT values in the sputum specimens ranged from 19–38, whereas the range in cough specimens was 33–43 (p<0.001, Table 3). Nonetheless, CT values in all positive cough specimens are significantly lower than the baseline of >60 for normal controls. While the CT values are higher for the cough specimens, the background noise level of the virgin filter is >60, allowing limits of detection by PCR that may be more sensitive to lung CFRB.

Table 3. CT values of sputum and cough specimens grouped by pathogen.

SubjectP. aeruginosaS. aureusK. pneumoniaeS. mitis
#SputumCoughSputumCoughSputumCoughSputumCough
12233----41-
2N/A42N/A-N/A-N/A-
332-----32-
4214136---24-
5N/A-N/A-N/A-N/A-
618----4132-
7N/A-N/A-N/A-N/A-
8N/A35N/A-N/A-N/A-
9N/A-N/A36N/A4331-
1019-384037-N/AN/A
11194227-38-N/AN/A
1220-----30-
13333930---33-
14334024---33-
15--37---32-
1625-----31-
17--33--3927-
1825-----29-
1925392939--29-
20224234----N/A

One can utilize the CT values to compare relative amounts of pathogens being coughed by an individual patient compared with a population32,33. Jones-López et al. found that both CF and TB patients can produce aerosols with viable pathogens, but the amount of pathogens produced by individuals varies greatly31. Patients with high amounts of M. tuberculosis in cough aerosols were more likely to have transmitted to others30. Those that produce large amounts of pathogens in coughs may be more efficient transmitters, e.g. “superspreaders”13,30. The quantity of pathogens in a cough may be a critical metric in transmission of infectious disease, controlling epidemics, and monitoring colonization. In the Jones-López et al. study, the amount of aerosolized M. tuberculosis fell dramatically after three weeks of treatment. Therefore, a cough specimen could also be used to monitor levels of resistant bacteria, if present.

Published guidelines for CF patients suggest acquiring quarterly respiratory specimens to monitor lung infections26,27. Cough specimens may be a more specific and sensitive method for monitoring colonization and determining infectivity. Additional studies could explore this application further by comparing CT values with symptoms. If a CF patient is monitored on a regular basis using cough specimens, a sudden decrease in CT value may indicate a change in pathogen burden32,33. The CT value of pathogen burden in cough aerosols may be useful as a measurement to determine if the lung burden is growing.

This study has several limitations. Our study included only adult patients; thus, we cannot comment on the aerosol production during coughing by pediatric patients. This study reports on 20 patients. Most studies in the literature have a similar number of subjects, since lower respiratory identification has always been an enormous challenge12,13. Future studies may evaluate the benefits of requiring more coughs or coughing for a specified amount of time, such as 5 minutes, to establish CT thresholds for this new method of specimen collection. The RT-PCR molecular assays used in this study are not available at all hospitals, although a few commercial laboratories can provide clinical respiratory identification services.

Conclusion

In summary, we have shown that a new device can collect lung pathogens from adult patients with CF from cough aerosols with identification using molecular assays. The device excludes oral contaminants showing higher specificity than sputum samples. Identifying causative pathogens in the lower respiratory tract is likely to play a significant role in patient management24. The data in this study suggest an alternative to sputum collection for the identification of lower respiratory pathogens.

Consent

Written informed consent was obtained by all participants through Institutional Review Board Protocol #000-2492 approved by Georgia Institute of Technology, Emory University, and US Centers for Disease Control and Prevention.

Data availability

All raw data are provided in the tables above.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 05 Aug 2016
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Ku DN, Ku SK, Helfman B et al. Ability of device to collect bacteria from cough aerosols generated by adults with cystic fibrosis [version 1; peer review: 2 approved]. F1000Research 2016, 5:1920 (https://doi.org/10.12688/f1000research.9251.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 05 Aug 2016
Views
15
Cite
Reviewer Report 03 Oct 2016
David E Griffith, Division of Infectious Diseases & Global Medicine, Department of Medicine, Comprehensive Heart and Lung Disease, The University of Texas Health Center at Tyler, Tyler, TX, USA 
Approved
VIEWS 15
Comment #1: I am not familiar with the term Cycle Threshold, “CT”. The term is introduced in the first paragraph of the Methods and then mentioned again in the last paragraph of the Methods. It would have been helpful to ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Griffith DE. Reviewer Report For: Ability of device to collect bacteria from cough aerosols generated by adults with cystic fibrosis [version 1; peer review: 2 approved]. F1000Research 2016, 5:1920 (https://doi.org/10.5256/f1000research.9959.r16745)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
18
Cite
Reviewer Report 21 Sep 2016
Mats Kalin, Department of Infectious Diseases, Karolinska Institutet, Stockholm, Sweden 
Approved
VIEWS 18
Ku et al, describe the experiences with a newly designed device for collecting cough specimens from patients with CF. The device is constructed with the intention that dead space air, presumably containing a high concentration of oral contaminants, should be collected ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Kalin M. Reviewer Report For: Ability of device to collect bacteria from cough aerosols generated by adults with cystic fibrosis [version 1; peer review: 2 approved]. F1000Research 2016, 5:1920 (https://doi.org/10.5256/f1000research.9959.r16100)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 05 Aug 2016
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.