ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Differentially correlated genes in co-expression networks control phenotype transitions

[version 1; peer review: 1 approved, 2 approved with reservations]
PUBLISHED 22 Nov 2016
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Background: Co-expression networks are a tool widely used for analysis of “Big Data” in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer).
Methods: Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.   
Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as “bottlenecks” rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we showed that they play regulatory roles in cancer cell growth.
Conclusion: Identifying differentially co-expressed genes in co-expression networks is an important tool in detecting regulatory genes involved in alterations of phenotype.

Keywords

co-expression networks, differential co-expression analysis, biological state transition

Introduction

Recent technological advances have moved the focus of biologists from how to measure biological parameters to how to analyze and interpret tens of thousands of measurements, frequently called omics data. The first solutions for such a problem were limited to hierarchical clustering13 and simple comparisons between classes of data through the identification of differentially expressed genes (DEGs)4,5. Nowadays, reconstruction and interrogation of biological networks have become a widely used approach to get insights from different types of omics data6,7.

After establishing co-expression networks for different states of one biological system, differential co-expression analysis investigates their structural changes when a system goes through a state transition. This analysis, first proposed more than a decade ago8,9, identifies the pairs of genes that have their interaction changed during such transition. Several later publications have suggested different algorithms and statistics to determine differential gene co-expression1027. Fewer studies, however, attempted to evaluate the biological significance of these changes18,21. Also, to the best of our knowledge, there have been no studies that would investigate how this approach performs depending on the type and complexity of the biological system analyzed.

Commonly, a state transition of a biological system is related to perturbation of a set of genes, which propagates through network interactions and affects other genes. Thus, there is a possibility that differentially co-expressed (DC) genes (directly or indirectly) contribute to the propagation of perturbations. In order to investigate the role of DC genes in a state transition of a biological system, we considered two biological processes28,29 previously analyzed by our group. The first one (B cell deficiency in mice) is a homogenous, one-causal-factor process, while the second one (cervical cancer) represents a heterogeneous multi-causal system.

In this work, a co-expression network is an undirected graph, where the set of nodes consists of a set of DEGs, and a pair of nodes is connected if there is a significant correlation between them. Differential co-expression analysis is done by identifying the pairs of genes that suffer significant changes in correlation between two states. Throughout this paper such pairs are called differentially correlated pairs (DCPs) and the genes forming these pairs are considered DC genes.

Results

B cell deficiency

We started by analyzing the B cell knockout (BcKO) data28, which represents a relatively simple experimental model with only one causal factor (B lymphocytes) and homogenous subject groups since this experiment was performed in highly inbred strains of mice.

In order to select the nodes to reconstruct the co-expression networks (BcKO and Control) we compared gene expression in jejunum between BcKO and control mice and found 509 DEGs (Dataset 1). Next, the edges for each network were determined using significantly correlated pairs of DEGs (Figure 1). To identify DCPs we used the method introduced in21 which compares correlations in the BcKO group and in the Control group. Eighty DCPs were found (Dataset 2), of which 56 represent correlation gains (edges which were not present in Control network but showed up in BcKO) and 24 represent losses.

UniqueIDGene.symbolNamep.valuebalbcRatiobalbcp.valueB10AlitRatioB10AlitFisher_pvfdrregulationIg geneDC gene GAINDC gene LOSSDC gene
6312278Derl3Der1-like domain family, member 3 (Derl3), mRNA.3.69E-120.150.0000000120.1700DOWN0000
6322228Igl-V1Similar to Ig lambda-1 chain C region3.35E-130.0111.78E-110.01400DOWN1101
6325650Igk-V1Immunoglobulin kappa chain variable 21 (V21)1.29E-130.00751.34E-090.007800DOWN1101
6325686LOC56304Recombinant antineuraminidase single chain Ig VH and VL domains6.72E-140.00729.95E-110.006900DOWN0101
6327106Ighv6-6Immunoglobulin heavy variable V6-69.48E-120.0521.53E-120.008500DOWN1000
6328597LOC676193PREDICTED: similar to anti-A/U antibody (LOC676193), mRNA.3.11E-130.0112.37E-110.02100DOWN1101
6328662Igk-V38Immunoglobulin kappa chain variable 38(V38)1.66E-120.0121.37E-120.007400DOWN1101
6328842LOC676175PREDICTED: similar to kappa-tnp V-J (LOC676175), mRNA.2.24E-130.0080.0000002360.01300DOWN1000
6329615LOC100046546PREDICTED: similar to IgM (kappa)light-chain (LOC100046546), misc RNA.2.63E-140.00853.25E-140.00600DOWN1000
6329616Igh-VJ558Immunoglobulin heavy chain (J558 family)3.05E-120.010.0000000110.008400DOWN1101
6329833Igk-V1Immunoglobulin kappa chain variable 21 (V21)5.67E-140.0126.5E-090.02400DOWN1101
6329876ENSMUSG00000076532Predicted gene, ENSMUSG000000765322.9E-130.0371.05E-100.06600DOWN0101
6330150Gm1499Gene model 1499, (NCBI)2.6E-140.00626.41E-120.004900DOWN1101
6330196EG211331Predicted gene, EG2113312.28E-170.00546.68E-080.007700DOWN0000
6330206LOC636988PREDICTED: similar to Igh-6 protein (LOC636988), mRNA.4.11E-150.00434.28E-100.006600DOWN1000
6330210LOC432699Predicted gene, EG6336742.46E-130.00341.42E-090.007600DOWN0000
6330223Igk-V1Immunoglobulin kappa chain variable 21 (V21)9.43E-150.00874.39E-130.01100DOWN1101
6330232Igkv4-90Immunoglobulin light chain variable region1.34E-140.00784.26E-100.03200DOWN1000
6330249ENSMUSG00000076577Predicted gene, ENSMUSG000000765771.16E-140.0097.48E-090.00800DOWN0000
6330757LOC677445PREDICTED: similar to Igh-6 protein (LOC677445), mRNA.2.66E-160.00414.73E-150.007200DOWN1101
6330789LOC100046894PREDICTED: similar to Igk-C protein (LOC100046894), mRNA.7.14E-150.00596.35E-140.005200DOWN1101
6330819Igh-VJ558Immunoglobulin heavy chain (J558 family)5.98E-140.00441.67E-090.007500DOWN1101
6331691LOC100047628PREDICTED: similar to Chain L, Structural Basis Of Antigen Mimicry In A Clinically Relevant Melanoma Antigen System, transcript variant 1 (LOC100047628), mRNA.2.88E-140.00621.15E-160.005100DOWN0101
6332411HV44_MOUSEIg heavy chain V region PJ14 precursor. [Source:Uniprot/SWISSPROT;Acc:P01820]3.74E-140.00731.93E-080.01200DOWN1111
6332452Igh-VJ558Immunoglobulin heavy chain (J558 family)1.13E-150.0240.0000003680.0100DOWN1101
6332502Gm1420Gene model 1420, (NCBI)7.33E-130.00843.34E-130.006100DOWN0101
6332528LOC675659PREDICTED: similar to Igh-6 protein (LOC675659), mRNA.3.81E-140.00283.77E-080.006700DOWN1000
6332547Q8K1F3PREDICTED: similar to immunoglobulin light chain variable region (LOC385291)5E-140.00851.09E-130.01100DOWN0000
6332834Igh-VJ558Immunoglobulin heavy chain (J558 family)2.74E-150.0162.72E-080.02400DOWN1101
6332929Igl-V1Similar to Ig lambda-1 chain C region3.12E-140.00686.45E-130.00400DOWN1101
6332933Igl-V1Ig lambda-1 chain V region precursor. [Source:Uniprot/SWISSPROT;Acc:P01723]2.16E-170.00845.43E-120.01300DOWN1101
6333077LOC100043977PREDICTED: similar to Igh protein (LOC100043977), mRNA.4.99E-140.0250.0000002910.02900DOWN1000
6333516Igh-VJ558Immunoglobulin heavy chain (J558 family)1.63E-150.00422.7E-090.008900DOWN1101
6333520LOC636126PREDICTED: similar to Igh-1a protein (LOC636126), mRNA.2.16E-160.0230.0000007850.01300DOWN1101
6333578Igk-V1Immunoglobulin kappa chain variable 21 (V21)7.9E-140.0094.87E-130.00700DOWN1101
6333580Igkv1-117Immunoglobulin kappa chain variable 1-1177.09E-140.00885.52E-140.005300DOWN1000
6333582Igk-V1Immunoglobulin kappa chain variable 21 (V21)1.27E-140.00661.29E-150.003900DOWN1101
6333584Igk-V23Immunoglobulin kappa chain variable 23 (V23)8.87E-130.0062.35E-120.005300DOWN1101
6334143Igh-VJ558Immunoglobulin heavy chain (J558 family)7.24E-160.0259.58E-090.009700DOWN1101
6334530IghImmunoglobulin heavy chain complex3.12E-160.00770.0000006810.01400DOWN1101
6334558Igh-1aPREDICTED: similar to immunoglobulin heavy chain variable region precursor (LOC195180)1.54E-130.00670.0000007120.01800DOWN1000
6334909KV2G_MOUSEIg kappa chain V-II region 26-10. [Source:Uniprot/SWISSPROT;Acc:P01631]1.56E-130.00981.12E-100.008500DOWN1101
6334911Igk-CIg kappa chain C region. [Source:Uniprot/SWISSPROT;Acc:P01837]2.96E-140.0111.97E-150.01600DOWN1101
6334913Igk-CIg kappa chain C region. [Source:Uniprot/SWISSPROT;Acc:P01837]3.29E-140.00692.29E-140.004300DOWN1101
6334915Igk-CIg kappa chain C region. [Source:Uniprot/SWISSPROT;Acc:P01837]1.18E-140.00681.74E-150.003200DOWN1101
6334941Igk-CIg kappa chain C region. [Source:Uniprot/SWISSPROT;Acc:P01837]1.38E-140.00736.52E-120.007400DOWN1101
6334943Igk-V1Immunoglobulin kappa chain variable 21 (V21)1.01E-130.00727E-160.005300DOWN1101
6335026KV5A_MOUSEIg kappa chain V-V region MPC11 precursor. [Source:Uniprot/SWISSPROT;Acc:P01633]4.72E-150.00671.08E-110.007900DOWN1000
6336624Igjimmunoglobulin joining chain (Igj), mRNA.3.27E-130.00574.89E-150.003100DOWN1101
6337253IgjImmunoglobulin joining chain5.32E-160.00752.31E-130.01700DOWN1101
6318002St6gal1beta galactoside alpha 2,6 sialyltransferase 1 (St6gal1), mRNA.3.33E-110.260.0000001210.221.11022E-163.13039E-14DOWN0000
6317226Serpina3nserine (or cysteine) peptidase inhibitor, clade A, member 3N (Serpina3n), mRNA.8.43E-155.220.001531.695.55112E-161.5351E-13UP0000
6334711Adamts3a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3 (Adamts3), mRNA.4.35E-150.0720.03180.595.21805E-151.41576E-12DOWN0000
6311207Usp18ubiquitin specific peptidase 18 (Usp18), mRNA.2.4E-105.540.0000006334.585.66214E-151.50781E-12UP0101
6311831Irgmimmunity-related GTPase family, M (Irgm), mRNA.1.04E-113.390.00002362.39.10383E-152.38024E-12UP0000
6335773Ccl5chemokine (C-C motif) ligand 5 (Ccl5), mRNA.3.34E-133.450.0009292.061.14353E-142.93642E-12UP0000
6313169Zbp1Z-DNA binding protein 1 (Zbp1), mRNA.1.02E-118.80.00003453.181.28786E-143.24902E-12UP0000
6320751Ccl5chemokine (C-C motif) ligand 5 (Ccl5), mRNA.4.89E-123.250.00007812.151.39888E-143.46826E-12UP0000
6328369Lax1lymphocyte transmembrane adaptor 1 (Lax1), mRNA.6.51E-100.360.0000008460.311.9873E-144.84362E-12DOWN0000
6335727Gzmbgranzyme B (Gzmb), mRNA.9.67E-123.970.00006732.62.34257E-145.61436E-12UP0000
6332413HV44_MOUSEPREDICTED: similar to Ig heavy-chain V region precursor (LOC238412)4.24E-100.0290.000001760.0662.67564E-146.30749E-12DOWN1111
6335739Igtpinterferon gamma induced GTPase (Igtp), mRNA.1.17E-107.50.000008113.553.37508E-147.828E-12UP0011
6318666Zbp1Z-DNA binding protein 1 (Zbp1), mRNA.2.04E-118.070.00005692.434.10783E-149.37627E-12UP0000
6316805Gzmbgranzyme B (Gzmb), mRNA.1.85E-114.240.00008282.725.37348E-141.20735E-11UP0000
6319585Zc3hav1zinc finger CCCH type, antiviral 1 (Zc3hav1), mRNA.2.25E-123.410.0007791.476.12843E-141.3558E-11UP0000
6318692Zbp1Z-DNA binding protein 14E-116.870.00005392.237.49401E-141.63278E-11UP0000
6310548Ifi47interferon gamma inducible protein 47 (Ifi47), mRNA.3.24E-113.520.00008032.368.99281E-141.9301E-11UP0000
6334218Irgb10PREDICTED: interferon-gamma-inducible p47 GTPase (Irgb10), mRNA.1.28E-126.290.003252.641.41887E-133.00048E-11UP0000
6308171Igtpinterferon gamma induced GTPase (Igtp), mRNA.1.41E-107.980.00003643.581.73972E-133.62568E-11UP0011
6312024Ifi44interferon-induced protein 44 (Ifi44), mRNA.3.09E-0910.480.000001776.261.85074E-133.80195E-11UP0101
6316180Oasl12'-5' oligoadenylate synthetase-like 1 (Oasl1), mRNA.3.24E-082.310.0000002032.762.21378E-134.48369E-11UP0000
6335553Isg15ISG15 ubiquitin-like modifier (Isg15), mRNA.4.56E-083.520.0000001824.022.77334E-135.53897E-11UP0000
6318183Psmb9proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2) (Psmb9), mRNA.2.51E-103.40.00005112.414.23106E-138.33461E-11UP0101
6328543Actn2actinin alpha 2 (Actn2), mRNA.4.87E-113.510.000421.886.65135E-131.29252E-10UP0000
6312773Slfn4schlafen 4 (Slfn4), mRNA.8.68E-092.630.000004612.581.27443E-122.41135E-10UP0101
6335994Actn2actinin alpha 2 (Actn2), mRNA.3.63E-103.530.0001091.761.26066E-122.41135E-10UP0000
6308427Cubncubilin (intrinsic factor-cobalamin receptor) (Cubn), mRNA.2.01E-080.440.000002090.381.33593E-122.4949E-10DOWN0000
6312173Iigp2interferon inducible GTPase 2 (Iigp2), mRNA.2.78E-103.540.0002032.381.77802E-123.27794E-10UP0000
6322378Serpina3cserine (or cysteine) peptidase inhibitor, clade A, member 3C (Serpina3c), mRNA.7.37E-123.410.008331.741.92901E-123.51129E-10UP0000
6316219Oas1a2'-5' oligoadenylate synthetase 1A (Oas1a), mRNA.0.0000007653.170.0000001133.382.68663E-124.82922E-10UP0000
6324543OTTMUSG00000016644predicted gene, OTTMUSG00000016644 (OTTMUSG00000016644), transcript variant 2, mRNA.9.1E-096.370.00001115.333.12361E-125.54538E-10UP0101
6326717Serpina3fserine (or cysteine) peptidase inhibitor, clade A, member 3F (Serpina3f), mRNA.1.81E-104.660.0006342.223.53395E-126.19734E-10UP0000
6329536Igh-VS107Immunoglobulin heavy chain (S107 family)2.37E-080.0380.000005570.0714.04687E-127.01133E-10DOWN0000
6333767Oas1a2'-5' oligoadenylate synthetase 1A (Oas1a), mRNA.0.0000001613.430.000001023.384.99845E-128.55686E-10UP0000
6321895Rnf213Ring finger protein 2130.0000001292.260.000001332.645.21461E-128.82189E-10UP0000
6335007Syn2synapsin II (Syn2), transcript variant IIa, mRNA.0.00002830.737.03E-090.146.01741E-121.00617E-09DOWN0000
6320688Ly6c1lymphocyte antigen 6 complex, locus C1 (Ly6c1), mRNA.3.32E-100.330.0007340.617.32114E-121.21009E-09DOWN0000
6330247Q9ERZ9Anti human TNF-alpha light chain variable region (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q9ERZ9]0.00001050.230.0000000280.128.77742E-121.43431E-09DOWN0000
6316450Ccl8chemokine (C-C motif) ligand 8 (Ccl8), mRNA.1.09E-082.910.00002922.739.47709E-121.53124E-09UP0000
6328669Cd8b1CD8 antigen, beta chain 1 (Cd8b1), mRNA.0.0000002322.710.000001633.871.11948E-111.76903E-09UP0000
6308040Slpisecretory leukocyte peptidase inhibitor (Slpi), mRNA.1.39E-080.490.00003150.391.28977E-112.01596E-09DOWN0000
6319742Trim30tripartite motif-containing 30 (Trim30), mRNA.8.05E-083.520.000005742.431.35862E-112.10075E-09UP0000
6328974Mpa2lmacrophage activation 2 like (Mpa2l), mRNA.1.2E-094.640.0004842.51.69444E-112.59214E-09UP0000
6315001Eaf2ELL associated factor 2 (Eaf2), transcript variant 3, mRNA.0.0000160.63.76E-080.31.75301E-112.6535E-09DOWN0000
6308622Cd3gCD3 antigen, gamma polypeptide (Cd3g), mRNA.3.99E-102.470.001591.481.84525E-112.76403E-09UP0000
6335490Il18bpinterleukin 18 binding protein (Il18bp), mRNA.3.46E-092.740.0002842.32.81511E-114.13075E-09UP0000
63366619330175E14RikRIKEN cDNA 9330175E14 gene4.67E-102.480.002091.882.79684E-114.13075E-09UP0000
6316764Mlklmixed lineage kinase domain-like (Mlkl), mRNA.9.48E-082.170.00001172.183.16415E-114.596E-09UP0000
6308556C2complement component 2 (within H-2S) (C2), mRNA.1.7E-092.50.001021.594.86917E-116.98283E-09UP0000
6316751Cyp2j6cytochrome P450, family 2, subfamily j, polypeptide 6 (Cyp2j6), mRNA.7.16E-110.440.02440.744.90449E-116.98283E-09DOWN0011
6311449Trp53inp1transformation related protein 53 inducible nuclear protein 1 (Trp53inp1), mRNA.8.44E-090.450.0002320.445.47461E-117.71813E-09DOWN0101
6316021Lcklymphocyte protein tyrosine kinase (Lck), mRNA.4.79E-102.450.004871.486.48125E-118.96157E-09UP0000
6329045Herc5PREDICTED: hect domain and RLD 5 (Herc5), mRNA.2.83E-083.950.00008653.086.78958E-119.29849E-09UP0000
6308292Cd79bCD79B antigen (Cd79b), mRNA.0.0000002480.340.000009980.376.86199E-119.309E-09DOWN0000
6333883Tcrb-JT-cell receptor beta, joining region2.27E-082.040.0001591.689.87054E-111.32653E-08UP0011
6329276Cd8aCD8 antigen, alpha chain (Cd8a), mRNA.1.5E-093.620.002641.71.07929E-101.43705E-08UP0000
6310084Gzmagranzyme A (Gzma), mRNA.5.13E-102.760.009581.711.32883E-101.73715E-08UP0011
6313208Ubdubiquitin D (Ubd), mRNA.1.04E-0935.450.004832.881.35712E-101.75814E-08UP0000
6329742TcrgPREDICTED: T cell receptor gamma chain (Tcrg), mRNA.7.47E-103.30.007711.611.54813E-101.98769E-08UP0000
6332506BC057170cDNA sequence BC057170 (BC057170), mRNA.7.02E-101.940.008321.481.56916E-101.99686E-08UP0000
6329774Ccl25Chemokine (C-C motif) ligand 250.0000009330.610.00000670.471.67519E-102.07665E-08DOWN0000
6309886Tcrg-CPREDICTED: T-cell receptor gamma, constant region, transcript variant 2 (Tcrg-C), mRNA.1.96E-102.640.03811.311.98791E-102.44326E-08UP0000
6341915Tcrg-V1T-cell receptor gamma, variable 11.12E-092.520.008181.452.42013E-102.94928E-08UP0000
6309846Psmb8proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) (Psmb8), mRNA.0.000000112.480.0001221.53.4938E-104.22192E-08UP0000
6326935TcraT-cell receptor alpha chain2.07E-082.20.00066923.60095E-104.31514E-08UP0011
6313762Duoxa2dual oxidase maturation factor 2 (Duoxa2), mRNA.0.0000001544.260.0001083.664.29433E-105.06168E-08UP0000
6333881Tcrb-JT-cell receptor beta, joining region8.38E-092.480.001981.574.2845E-105.06168E-08UP0011
6312598Nrn1neuritin 1 (Nrn1), mRNA.3.75E-090.370.004540.574.39183E-105.13451E-08DOWN0000
6317191ItkIL2-inducible T-cell kinase (Itk), mRNA.3.81E-092.270.00541.55.26838E-106.01265E-08UP0000
6322015Xaf1XIAP associated factor 1 (Xaf1), mRNA.0.00000222.070.000009612.155.40807E-106.12347E-08UP0000
6333879Tcrb-JT-cell receptor beta, joining region4.72E-081.730.0004581.995.52492E-106.2069E-08UP0011
6307928Socs1suppressor of cytokine signaling 1 (Socs1), mRNA.8.78E-092.510.00282.146.25145E-106.87944E-08UP0000
6325817Cd3eCD3 antigen, epsilon polypeptide (Cd3e), mRNA.2.37E-092.480.01041.66.26708E-106.87944E-08UP0000
6333382Iigp1Interferon-inducible GTPase-like1.41E-092.610.02021.837.20075E-107.84445E-08UP0000
6334902Cyp2j13cytochrome P450, family 2, subfamily j, polypeptide 13; cytochrome P450, 2j13. [Source:RefSeq;Acc:NM_145548]1.57E-090.350.01880.687.45164E-108.05673E-08DOWN0000
6314431BC089597cDNA sequence BC089597 (BC089597), mRNA.3.93E-090.260.007710.557.64169E-108.20056E-08DOWN0000
6326981Tcrg-V1T-cell receptor gamma, variable 12.76E-092.580.01121.577.78979E-108.29756E-08UP0000
6307884Itgaeintegrin, alpha E, epithelial-associated (Itgae), transcript variant 1, mRNA.1.46E-092.530.02361.428.64547E-109.14131E-08UP0000
6336771LOC100041885PREDICTED: similar to C130026I21Rik protein (LOC100041885), mRNA.4.15E-081.850.0008691.559.03237E-109.48069E-08UP0000
6321135Pnpla7patatin-like phospholipase domain containing 7 (Pnpla7), mRNA.0.000000161.960.0002442.19.7469E-101.00835E-07UP0000
6323959Gpr18G protein-coupled receptor 18 (Gpr18), mRNA.2.04E-092.490.01911.499.72868E-101.00835E-07UP0000
6310036Serpina3gserine (or cysteine) peptidase inhibitor, clade A, member 3G (Serpina3g), mRNA.1.1E-093.760.03611.369.90741E-101.01763E-07UP0000
6319547Herc5PREDICTED: hect domain and RLD 5 (Herc5), mRNA.6.9E-093.890.006652.451.13817E-091.16077E-07UP0000
6319765Insl3insulin-like 3 (Insl3), mRNA.7.97E-092.120.006181.471.21826E-091.22508E-07UP0000
63249671810015C04RikRIKEN cDNA 1810015C04 gene (1810015C04Rik), transcript variant 2, mRNA.0.0000002590.480.000190.61.21721E-091.22508E-07DOWN0000
6329037Iigp1interferon inducible GTPase 1 (Iigp1), mRNA.4.52E-082.360.001151.841.28287E-091.28109E-07UP0000
6318384Hrasls3HRAS like suppressor 3 (Hrasls3), mRNA.1.77E-082.630.003311.521.43893E-091.42702E-07UP0000
6313718Dhx58DEXH (Asp-Glu-X-His) box polypeptide 58 (Dhx58), mRNA.0.000000862.780.00007593.091.59611E-091.57206E-07UP0000
6309610Stat1signal transducer and activator of transcription 1 (Stat1), mRNA.2.84E-092.40.02381.491.65043E-091.61406E-07UP0111
6335254Casp3caspase 3 (Casp3), mRNA.2.14E-082.680.003181.781.6612E-091.61406E-07UP0011
6335009Rab6ip2Rab6-interacting protein 2. [Source:RefSeq;Acc:NM_178085]3.49E-080.330.002060.461.75104E-091.68993E-07DOWN0000
6318748BC006779cDNA sequence BC006779 (BC006779), mRNA.0.0000001141.840.0006571.971.82114E-091.7343E-07UP0101
6335310Cst7cystatin F (leukocystatin) (Cst7), mRNA.6.26E-081.890.001191.71.81172E-091.7343E-07UP0011
6307849Ly6dlymphocyte antigen 6 complex, locus D (Ly6d), mRNA.0.00005540.510.000001450.241.94759E-091.84252E-07DOWN0000
6320560Parp14poly (ADP-ribose) polymerase family, member 14 (Parp14), mRNA.0.000002331.70.00003631.882.04625E-091.92321E-07UP0000
6309364Oas22'-5' oligoadenylate synthetase 2 (Oas2), mRNA.0.00001293.020.000006643.42.07122E-091.93404E-07UP0011
6314118Rtp4receptor transporter protein 4 (Rtp4), mRNA.0.00007311.690.000001252.62.2036E-092.04438E-07UP0000
6319744Trim30tripartite motif-containing 30 (Trim30), mRNA.0.0000001823.260.0005112.942.2412E-092.06593E-07UP0000
6337152D14Ertd668eDNA segment, Chr 14, ERATO Doi 668, expressed (D14Ertd668e), mRNA.0.000006012.190.00001562.752.25861E-092.06872E-07UP0011
6329047Herc5PREDICTED: hect domain and RLD 5 (Herc5), mRNA.0.0000001013.740.0009563.212.32322E-092.11443E-07UP0000
6309353Ifit1interferon-induced protein with tetratricopeptide repeats 1 (Ifit1), mRNA.0.00000162.670.00006443.372.47254E-092.23331E-07UP0000
6316207Lgals9Lectin, galactose binding, soluble 90.0000008491.770.0001221.732.48491E-092.23331E-07UP0000
6308081Cxcl9chemokine (C-X-C motif) ligand 9 (Cxcl9), mRNA.5.52E-092.690.02561.53.34628E-092.97034E-07UP0011
6312355Ddx60DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 (Ddx60), mRNA.0.000009782.350.00001472.283.40191E-093.0012E-07UP0011
6321447Skap1src family associated phosphoprotein 1 (Skap1), mRNA.0.000000141.680.001061.663.50686E-093.07491E-07UP0000
6312979Sordsorbitol dehydrogenase (Sord), mRNA.0.0000003840.540.000440.613.97079E-093.4606E-07DOWN0000
6321137Pnpla7patatin-like phospholipase domain containing 7 (Pnpla7), mRNA.6.09E-082.720.002842.584.06066E-093.49654E-07UP0000
6331683H2-K1histocompatibility 2, K1, K region (H2-K1), transcript variant 1, mRNA.4.42E-081.880.004271.524.41462E-093.7787E-07UP0011
6314245Igh-6Immunoglobulin heavy chain complex0.000009940.520.00001990.24.61753E-093.929E-07DOWN1000
6314795Slfn2schlafen 2 (Slfn2), mRNA.0.000001321.650.0001632.285.00454E-094.19564E-07UP0000
6318136Cd6CD6 antigen (Cd6), transcript variant 1, mRNA.3.24E-083.110.006662.025.01843E-094.19564E-07UP0000
6311037Akr1c14aldo-keto reductase family 1, member C14 (Akr1c14), mRNA.7.35E-080.340.003190.545.43343E-094.51634E-07DOWN0000
6308530Irf7interferon regulatory factor 7 (Irf7), mRNA.0.0000002822.240.0008582.065.59941E-094.62756E-07UP0101
6308083Cd5CD5 antigen (Cd5), mRNA.1.61E-082.830.01531.745.69622E-094.68067E-07UP0000
6335399Stat1signal transducer and activator of transcription 1 (Stat1), mRNA.0.0000001011.850.002481.645.788E-094.72906E-07UP0111
6336588Oas1e2'-5' oligoadenylate synthetase 1E (Oas1e), mRNA.0.000003932.90.00007113.066.42625E-095.22088E-07UP0000
6308256Dtx1deltex 1 homolog (Drosophila) (Dtx1), mRNA.3.04E-0820.011.56.96585E-095.62747E-07UP0011
6314588Nudt5nudix (nucleoside diphosphate linked moiety X)-type motif 5 (Nudt5), mRNA.7.27E-093.30.04341.717.21804E-095.73456E-07UP0000
6317525Oit1oncoprotein induced transcript 1 (Oit1), mRNA.4.98E-081.990.006331.567.21183E-095.73456E-07UP0000
6335690Zfp467zinc finger protein 467 (Zfp467), transcript variant 3, mRNA.7.12E-080.590.00530.688.56525E-096.76749E-07DOWN0101
6320561BC031353cDNA sequence BC031353 (BC031353), transcript variant 2, mRNA.0.00000180.650.0002120.688.65722E-096.80278E-07DOWN0000
6335074Xlr4X-linked lymphocyte-regulated 4. [Source:RefSeq;Acc:NM_021365]1.33E-081.740.03031.339.12051E-097.12788E-07UP0000
6333384LOC100044196PREDICTED: hypothetical protein LOC100044196 (LOC100044196), mRNA.1.73E-082.350.02381.779.3097E-097.2364E-07UP0000
6325666Oas32'-5' oligoadenylate synthetase 3 (Oas3), mRNA.0.0000009612.960.0004622.421.00052E-087.73523E-07UP0000
6334707Tmprss11ctransmembrane protease, serine 11c (Tmprss11c), mRNA.0.001250.780.0000003960.241.11011E-088.53657E-07DOWN0000
6313300Ifitm3interferon induced transmembrane protein 3 (Ifitm3), mRNA.0.00000571.630.00009251.561.17911E-088.9712E-07UP0000
6310817Iydiodotyrosine deiodinase (Iyd), mRNA.0.0000000650.480.008220.681.19416E-089.03794E-07DOWN0000
6326498EG631797PREDICTED: predicted gene, EG631797 (EG631797), mRNA.4.75E-080.480.01140.631.20953E-089.10631E-07DOWN0000
6319640Oasl22'-5' oligoadenylate synthetase-like 2 (Oasl2), mRNA.0.000001163.550.0005263.061.35561E-081.0153E-06UP0101
6333909Tcrb-JT-cell receptor beta, joining region0.0000001112.750.005781.541.4222E-081.05965E-06UP0011
6312188Krba1KRAB-A domain containing 1 (Krba1), mRNA.0.0000001110.550.006070.621.49025E-081.10463E-06DOWN0000
6336044Derl3Der1-like domain family, member 3 (Derl3), mRNA.0.0001150.630.000006370.271.61414E-081.19032E-06DOWN0000
6317071Rsad2radical S-adenosyl methionine domain containing 2 (Rsad2), mRNA.0.00001472.520.00005464.461.7612E-081.29215E-06UP0000
6337866Hsd3b2Hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 20.000004940.550.00020.372.14745E-081.55961E-06DOWN0000
6323254Samd9lPREDICTED: sterile alpha motif domain containing 9-like, transcript variant 3 (Samd9l), mRNA.0.000002061.570.0005151.62.29835E-081.65972E-06UP0000
6310478Sypl2synaptophysin-like 2 (Sypl2), mRNA.0.000007130.530.0002140.553.25011E-082.3252E-06DOWN0101
63110242810022L02RikRIKEN cDNA 2810022L02 gene (2810022L02Rik), mRNA.0.0000002982.370.005731.83.61797E-082.56288E-06UP0101
63093231810054D07RikRIKEN cDNA 1810054D07 gene (1810054D07Rik), mRNA.0.000000711.530.002521.923.78264E-082.65338E-06UP0000
6323762Naip5NLR family, apoptosis inhibitory protein 5 (Naip5), mRNA.0.000003830.650.0005540.674.44967E-083.10613E-06DOWN0000
6308488Irf8interferon regulatory factor 8 (Irf8), mRNA.0.0000001491.780.01591.564.94212E-083.43322E-06UP0101
6313936Parp14poly (ADP-ribose) polymerase family, member 14 (Parp14), mRNA.0.000008831.630.0002721.895.00696E-083.46155E-06UP0000
63149541810065E05RikRIKEN cDNA 1810065E05 gene (1810065E05Rik), mRNA.0.0000001081.570.02471.365.53316E-083.80703E-06UP0000
6330577EG432555predicted gene, EG432555 (EG432555), mRNA.0.0000001312.220.02231.866.03285E-084.13106E-06UP0000
6309304NmiN-myc (and STAT) interactor (Nmi), mRNA.0.000002861.570.001091.46.41756E-084.37368E-06UP0000
63120574930431B09RikPREDICTED: RIKEN cDNA 4930431B09 gene (4930431B09Rik), misc RNA.8.84E-080.530.03770.716.83849E-084.61678E-06DOWN0000
6328261Ddx60DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 (Ddx60), mRNA.0.000001172.240.002932.187.02461E-084.69832E-06UP0011
6310361Stat2signal transducer and activator of transcription 2 (Stat2), mRNA.0.000009812.070.0003561.727.1498E-084.73798E-06UP0000
6329303Muc4mucin 4 (Muc4), mRNA.0.000001451.660.00241.67.12573E-084.73798E-06UP0101
6328930Ptrh1peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) (Ptrh1), mRNA.0.000008721.590.0004091.87.29405E-084.78943E-06UP0000
This is a portion of the data; to view all the data, please download the file.
Dataset 1.Differentially expressed genes from BcKO study.
Contains p-values, ratios of expression means, combined Fisher’s p-value, fdr, direction of regulation, whether it is Ig gene and whether it is DC gene.
Gene symbol 1Gene symbol 2Change directionSign of local partial correlation in BcKOSign of local partial correlation in controlRegulation 1Regulation 2number of Ig genes
HV44_MOUSEH2-T10Gained edge< 00DOWNUP1
Rad54lIgh-VJ558Gained edge< 00UPDOWN1
PaoxIgh-VJ558Gained edge< 00UPDOWN1
Parp12Igh-VJ558Gained edge< 00UPDOWN1
MocosIgjGained edge< 00UPDOWN1
Trim34IgjGained edge< 00UPDOWN1
Eif1aIgk-CGained edge< 00UPDOWN1
Psmb9Igk-CGained edge< 00UPDOWN1
Mybl2Igk-CGained edge< 00UPDOWN1
Rnf31Igk-V1Gained edge< 00UPDOWN1
G3bp2Igk-V1Gained edge< 00UPDOWN1
Irf7Igk-V1Gained edge< 00UPDOWN1
RhofIgl-V1Gained edge< 00UPDOWN1
Batf2KV2G_MOUSEGained edge< 00UPDOWN1
Batf2LOC100046894Gained edge< 00UPDOWN1
Il15raLOC636126Gained edge< 00UPDOWN1
Trim15LOC676193Gained edge< 00UPDOWN1
BC006779LOC676193Gained edge< 00UPDOWN1
Muc4LOC676193Gained edge< 00UPDOWN1
Ube2l6LOC676193Gained edge< 00UPDOWN1
IgjPpm1kGained edge< 00DOWNUP1
Igl-V1Ppm1kGained edge< 00DOWNUP1
Chrna6Serpina1eGained edge< 00UPDOWN0
LOC56304Trim34Gained edge< 00DOWNUP0
Trp53inp1Zadh1Gained edge< 00DOWNUP0
Irf89130017N09RikGained edge> 00UPUP0
OTTMUSG00000016644BC020489Gained edge> 00UPUP0
Usp18BC020489Gained edge> 00UPUP0
Pex14Eif1aGained edge> 00UPUP0
Cdadc1GhrGained edge> 00DOWNDOWN0
Slc6a20aGhrGained edge> 00DOWNDOWN0
Igk-V38Gm1499Gained edge> 00DOWNDOWN1
Nkg7Hspa12aGained edge> 00UPUP0
Igk-V38IghGained edge> 00DOWNDOWN2
LOC100046894Igh-VJ558Gained edge> 00DOWNDOWN2
LOC100047628Igh-VJ558Gained edge> 00DOWNDOWN1
Igh-VJ558Igk-CGained edge> 00DOWNDOWN2
LOC100046894Igk-CGained edge> 00DOWNDOWN2
Sypl2Igk-CGained edge> 00DOWNDOWN1
Gm1420Igk-CGained edge> 00DOWNDOWN1
Gm1499Igk-V1Gained edge> 00DOWNDOWN1
Igh-VJ558Igk-V1Gained edge> 00DOWNDOWN2
LOC100046894Igk-V1Gained edge> 00DOWNDOWN2
KV2G_MOUSEIgk-V1Gained edge> 00DOWNDOWN2
Es22Igk-V23Gained edge> 00DOWNDOWN1
ENSMUSG00000076532Igl-V1Gained edge> 00DOWNDOWN1
LOC677445LOC100046894Gained edge> 00DOWNDOWN2
LOC56304LOC100046894Gained edge> 00DOWNDOWN1
Stat1Nkg7Gained edge> 00UPUP0
Slfn4Oasl2Gained edge> 00UPUP0
Ifi44Oasl2Gained edge> 00UPUP0
2810022L02RikSerpinb9Gained edge> 00UPUP0
Irf7Slfn4Gained edge> 00UPUP0
Igk-CZfp467Gained edge> 00DOWNDOWN1
BatfCyp2j12Lost edge0< 0UPDOWN0
Slc6a20aZfp295Lost edge0< 0DOWNUP0
Rps6ka5Aldh1a1Lost edge0< 0DOWNDOWN0
Ube2l6Casp3Lost edge0< 0UPUP0
Slc6a20aCdkn1cLost edge0< 0DOWNDOWN0
Oas2Cst7Lost edge0< 0UPUP0
Adh1Cyp2j6Lost edge0< 0DOWNDOWN0
Cst7D14Ertd668eLost edge0< 0UPUP0
TcraD14Ertd668eLost edge0< 0UPUP0
Cdadc1EG433023Lost edge0< 0DOWNDOWN0
Slc6a20aEG433023Lost edge0< 0DOWNDOWN0
Cxcl9H2-K1Lost edge0< 0UPUP0
IgtpH2-K1Lost edge0< 0UPUP0
Tcf7l2H2-T22Lost edge0< 0UPUP0
1110032O16RikHV44_MOUSELost edge0< 0DOWNDOWN1
Phyhd1HV44_MOUSELost edge0< 0DOWNDOWN1
Ube2l6PmvkLost edge0< 0UPUP0
Ppm1jRps6ka5Lost edge0< 0DOWNDOWN0
Stat1Sprr2bLost edge0< 0UPUP0
Ddx60TcraLost edge0< 0UPUP0
GzmaTcrb-JLost edge0< 0UPUP0
Dtx1Trafd1Lost edge0< 0UPUP0
Slc6a20aWdr45Lost edge0< 0DOWNDOWN0
PmvkZnfx1Lost edge0< 0UPUP0
Dataset 2.Differentially correlated pairs from BcKO study.
Contains information such as “change direction” (whether each pair gained or lost correlation/edge), “sign of local partial correlation” in BcKO data and control data, “regulation” (whether each gene of each pair is up- or down-regulated in BcKO), “number of Ig genes” in each pair.

Now we investigate whether network structural changes, herein represented by DCPs, are related to actual causes of global change in gene expression. In the previous study28, it was shown that intestinal gene expression alterations in BcKO mice are mostly dependent on the ability of B lymphocytes to produce antibodies. Therefore, we analyzed the presence of immunoglobulin coding genes (Ig genes, see Dataset 3) among differentially expressed genes (26 Ig genes among 509 DEGs) in DCPs. We observed that 72% (39 out of 54) of correlation gain DCPs are formed by at least one Ig gene, (Figure 2A). Moreover, we found strong enrichment for Ig genes among DC genes in correlation gain (24% (15 out of 63) of DC genes are Ig genes vs 2.7% (11 out of 415) of other DEGs are Ig genes), while no enrichment was observed for correlation lost as a result of B cell deficiency (Figure 2B). Thus, these results support the idea that differentially expressed genes that acquire correlations during transition from one biological state to another have a high chance to play causal roles in such transition.

e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure1.gif

Figure 1. Co-expression networks for BcKO data.

The nodes are composed by DEGs and the edges represent significant correlations between nodes. The causal genes (immunoglobulin genes) and the DCP edges are concentrated in the high connectivity region with several causal genes forming DCPs.

e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure2.gif

Figure 2.

A) 78 Differentially Correlated Pairs (DCPs) were found, of which 54 represent correlation gains (edges which were not present in Control network but showed up in BcKO) and 24 represent correlation losses. The table stratifies the set of pairs representing correlation gains and losses according to the amount of Ig genes (0, 1 or 2) present in a pair. Note that 39 out of 54 of correlation gain DCPs are formed by at least one Ig gene while only 2 out of 22 correlation losses have at least one Ig gene. B) The 78 DCPs are formed by a total of 94 Differentially Co-expressed genes (DC genes). 58 DC genes participate only in correlation gain DCPs, 31 only in correlation loss DCPs and 5 of them participate in both correlation gain and loss DCPs. The results show enrichment for Ig genes among DC genes in correlation gain: 24% (15 out of 63 (=58+5)) of DC genes are Ig genes vs 2.7% (11 out of 415) of other DEGs are Ig genes (p value < 0.001). Meanwhile no enrichment was observed for correlation loss as a result of B cell deficiency: 3% (1 out of 36 (=31+5)) of DC genes are Ig genes vs 2.7% (11 out of 415) of other DEGs are Ig genes.

Gene symbolUnique idDescriptionCloneGB accUG clusterMap LocationRegulationDC gene
Gm14996330150immunoglobulin kappa chain variable 4-72M400005733Mm.3053526 C10.171
HV44_MOUSE6332411Ig heavy chain V region PJ14 precursor. [Source:Uniprot/SWISSPROT;Acc:P01820]M4000080980000.171
Igh6334530Immunoglobulin heavy chain complexM400009955111507Mm.39047312 F2|12 58.0 cM0.171
Igh-1a6334556Ig gamma-3 chain C region, membrane-bound form. [Source:Uniprot/SWISSPROT;Acc:P03987]M4000099560000.170
Igh-66309934Immunoglobulin heavy chain complexM20000330416019Mm.34217712 F1-2|12 58.0 cM0.170
Ighv6-66327106Immunoglobulin heavy variable V6-6M400002980238427Mm.43132212 F20.170
Igh-VJ5586324882PREDICTED: immunoglobulin heavy chain (J558 family) (Igh-VJ558), mRNA.M400000443160610120.171
Igj6336624immunoglobulin joining chain (Igj), mRNA.M40001217816069Mm.119250.171
Igk-C6334911Ig kappa chain C region. [Source:Uniprot/SWISSPROT;Acc:P01837]M4000104280000.171
Igk-V16323886Immunoglobulin kappa chain variable 21 (V21)M30002061816081Mm.3331246 30.0 cM0.171
Igkv1-1176333580Immunoglobulin kappa chain variable 1-117M40000942516098Mm.3041436 C1|6 30.0 cM0.00530
Igk-V236333584Immunoglobulin kappa chain variable 23 (V23)M400009427111735Mm.4238216 C1|6 30.0 cM0.171
Igk-V386328662Immunoglobulin kappa chain variable 38(V38)M40000422516120Mm.2887536 C1|6 30.0 cM0.171
Igkv4-906330232Immunoglobulin light chain variable regionM400006035434034Mm.4245106 C10.0170
Igl-V16322228Similar to Ig lambda-1 chain C regionM30001311216142Mm.32634916 A3|16 13.0 cM0.0171
KV2G_MOUSE6334909Ig kappa chain V-II region 26-10. [Source:Uniprot/SWISSPROT;Acc:P01631]M4000104270000.0171
KV5A_MOUSE6335026Ig kappa chain V-V region MPC11 precursor. [Source:Uniprot/SWISSPROT;Acc:P01633]M4000106400000.0170
LOC1000439776333077PREDICTED: similar to Igh protein (LOC100043977), mRNA.M4000085471000439770120.0170
LOC1000465466329615PREDICTED: similar to IgM (kappa)light-chain (LOC100046546), misc RNA.M400005124100046546060.0170
LOC1000468946330789PREDICTED: similar to Igk-C protein (LOC100046894), mRNA.M400006358100046894060.0171
LOC6361266333520PREDICTED: similar to Igh-1a protein (LOC636126), mRNA.M400008850636126000.0171
LOC6369886330206PREDICTED: similar to Igh-6 protein (LOC636988), mRNA.M400005749636988000.0170
LOC6756596332528PREDICTED: similar to Igh-6 protein (LOC675659), mRNA.M400008311675659000.0170
LOC6761756328842PREDICTED: similar to kappa-tnp V-J (LOC676175), mRNA.M400004552676175060.0170
LOC6761936328597PREDICTED: similar to anti-A/U antibody (LOC676193), mRNA.M400004394676193060.0171
LOC6774456330757PREDICTED: similar to Igh-6 protein (LOC677445), mRNA.M400006354677445000.0171
This is a portion of the data; to view all the data, please download the file.
Dataset 3.Causal genes from BcKO study.
Contains the Ig genes considered causal along with annotation and whether they are considered DC genes or not.

Cervical cancer

Analysis of gene expression data. In order to study differentially co-expressed genes in a more complex biological model we turned to cancer. It is well known that cancers of the same clinically/morphological type can be very different on molecular levels. One of the most studied causes for such diversity is the different sets of chromosomal aberrations and mutations harbored by tumors otherwise defined as the same cancer. In previous study29, we have found 36 cervical cancer driver genes located in multiple chromosomal aberrations (Dataset 4). Thus we decided to use cervical cancer data from 29 for investigation of the role of DCPs in complex biological processes due to its heterogeneity and previously acquired knowledge of essential causal genes.

Gene symbolIDGB_ACCSPOT_IDGene TitleDescriptionRefSeq Transcript IDDC gene
NAT13217745_s_atNM_025146NM_025146NM_025146N(alpha)-acetyltransferase 50, NatE catalytic subunit802180
(NAA50)0
MCM2202107_s_atNM_004526NM_004526NM_004526minichromosome maintenance complex component 241710
TOPBP1202633_atNM_007027NM_007027NM_007027topoisomerase (DNA) II binding protein 1110730
CEP701554488_atBC016050BC016050BC016050centrosomal protein 70kDa803211
GMPS214431_atNM_003875NM_003875NM_003875guanine monphosphate synthetase88330
RFC4204023_atNM_002916NM_002916NM_002916replication factor C (activator 1) 4, 37kDa59840
LAMP3205569_atNM_014398NM_014398NM_014398lysosomal-associated membrane protein 3270740
CKS1B201897_s_atNM_001826NM_001826NM_001826CDC28 protein kinase regulatory subunit 1B11630
DUSP12218576_s_atNM_007240NM_007240NM_007240dual specificity phosphatase 12112660
NEK2204641_atNM_002497NM_002497NM_002497NIMA (never in mitosis gene a)-related kinase 247510
PSMB4202243_s_atNM_002796NM_002796NM_002796proteasome (prosome, macropain) subunit, beta type, 456920
ADAR201786_s_atNM_001111NM_001111NM_001111adenosine deaminase, RNA-specific1030
DTL218585_s_atNM_016448NM_016448NM_016448denticleless homolog (Drosophila)515140
AIM2206513_atNM_004833NM_004833NM_004833absent in melanoma 294470
EXO1204603_atNM_003686NM_003686NM_003686exonuclease 191560
RFX5202963_atAW027312AW027312AW027312regulatory factor X, 5 (influences HLA class II expression)59930
CDCA8221520_s_atBC001651BC001651BC001651cell division cycle associated 8551430
CDC20202870_s_atNM_001255NM_001255NM_001255cell division cycle 20 homolog (S. cerevisiae)9910
S100PBP218370_s_atNM_022753NM_022753NM_022753S100P binding protein647660
IFI44L204439_atNM_006820NM_006820NM_006820interferon-induced protein 44-like109640
RPA2201756_atNM_002946NM_002946NM_002946replication protein A2, 32kDa61180
ITGB3BP205176_s_atNM_014288NM_014288NM_014288integrin beta 3 binding protein (beta3-endonexin)234210
IFI44214059_atBE049439BE049439BE049439Interferon-induced protein 44105610
DEPDC1220295_x_atNM_017779NM_017779NM_017779DEP domain containing 1556350
HMGN2208668_x_atBC003689BC003689BC003689high-mobility group nucleosomal binding domain 231510
ISG15205483_s_atNM_005101NM_005101NM_005101ISG15 ubiquitin-like modifier96360
NUP155206550_s_atNM_004298NM_004298NM_004298nucleoporin 155kDa96310
TPX2210052_s_atAF098158AF098158AF098158TPX2, microtubule-associated, homolog (Xenopus laevis)229740
TYROBP204122_atNM_003332NM_003332NM_003332TYRO protein tyrosine kinase binding protein73050
RAD54B219494_atNM_012415NM_012415NM_012415RAD54 homolog B (S. cerevisiae)257880
LAPTM4B1554679_a_atAF317417AF317417AF317417lysosomal protein transmembrane 4 beta553530
KPNA2201088_atNM_002266NM_002266NM_002266karyopherin alpha 2 (RAG cohort 1, importin alpha 1)38380
MMP9203936_s_atNM_004994NM_004994NM_004994matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)43180
BIRC5202094_atAA648913AA648913AA648913baculoviral IAP repeat-containing 53320
RAD21200607_s_atBG289967BG289967BG289967RAD21 homolog (S. pombe)58850
MTFR1203207_s_atBF214329BF214329BF214329mitochondrial fission regulator 196500
Dataset 4.Causal genes from cervical cancer study.
Contains the chromosomal aberration genes considered causal along with annotation and whether they are considered DC genes or not.

We used the DEGs between tumor and normal tissue as the nodes of the co-expression networks. Since the number of samples (five datasets, 148 tumor samples and 67 normal samples) was larger than in BcKO study (two datasets, 22 paired samples), we used the partial correlation coefficient as a measure of co-expression (Figure 3). The potential advantage of using partial correlation is that it aims to infer edges that are a result of direct regulatory relations6. Partial correlations were calculated through the Local Partial Correlation (LCP) method30 (Material and Methods).

e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure3.gif

Figure 3. Co-expression networks for cervical cancer data.

The nodes are composed by DEGs and the edges represent significant local partial correlation between nodes. A few causal genes (key drivers) and DCP edges are located in the high connectivity region, but scattered throughout the network. Only one key driver is amongst the genes in DCPs.

In this study seven DCPs composed of 14 DC genes were found. Interestingly, all DCPs were differential correlations gained in tumors (Table 1). Only one of the 36 key drivers (CEP70) was identified among the 14 DC genes. Accordingly, no enrichment of key driver genes among DC genes was detected in this analysis.

Table 1. DCPs – cancer (* key drivers).

Gene
symbol 1
Gene
symbol 2
Change
direction
Sign of local partial
correlation in tumor
Regulation 1Regulation 2
ANP32ECACYBPGained edge> 0UPUP
CENPNDHFRGained edge> 0UPUP
C10orf68FGFR2Gained edge> 0DNDN
AK2HNRNPRGained edge> 0UPUP
CEP70*SEPHS1Gained edge> 0UPUP
NIPAL2TRPM3Gained edge> 0DNDN
They stem
ARHGEF12
ZSCAN18Gained edge> 0DNDN

Even though we observed that DCPs are not necessarily formed by key drivers, it is known from literature that most of the DC genes found play regulatory roles in other types of cancer3148. Thus we hypothesized that DCPs are located downstream of key drivers and can be responsible for changes of regulatory chain events coming from the key drivers and spreading throughout the network. In order to verify this hypothesis, we investigated how close DC genes are to key drivers and whether their “signal flow”49 in the tumor co-expression network is stronger than that of the other genes. In order to verify this hypothesis we investigated two network measures: Minimum Shortest Path and Bi-partite Betweenness Centrality.

First we compared the shortest paths from key driver genes to DC genes and to all other DEGs in the network. We found that DC genes are located statistically closer than the rest of genes in the network to key drivers (Figure 4A, Wilcoxon test < 0.014 and Permutation test < 0.021). Then we used Bi-partite Betweenness Centrality6 as a measure of the signal flow from key drivers to peripheral genes (genes with only one edge)6. We evaluated this measure for DC genes and remaining DEGs and observed that DC genes had much higher values than other genes in the network. Figure 4B illustrates a comparison of boxplots of bi-partite betweenness centrality between these two groups concerning DCPs and the rest (non DCPs, non-key drivers, non-peripheral). We can observe that the bi-partite betweenness centralities of DCPs are concentrated in higher values than the rest. Mann-Whitney test gave us a p-value of 7.868 X 10-5, which gives us evidence that the distribution of Bi-Partite Betweenness Centrality in DCP genes is higher. For more details see Figure S2. Thus, altogether these results suggest that DC genes might be “bottlenecks”, that is, required to transmit a signal from key drivers to other genes in the network, therefore, supplement the hypothesis of a regulatory role of DC genes (Figure S1).

e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure4.gif

Figure 4. Topological properties of Differentially Correlated Genes (DCGs).

A) Barplot of the shortest path to the causal genes and originated in either the genes in DCPs (in orange) or the non DCP genes (in blue). The distribution in orange is concentrated in lower values. B) Boxplot comparing the values of Bipartite Betweenness Centrality of the genes in DCPs (in orange) and the non-DCP genes (in blue). The boxplot on the left is concentrated in higher values.

Knockdown experiments. In addition, data from other cancers provide indirect support for the idea of regulatory role of DC genes in cervical cancer3148. However, since a role of these DC genes in carcinogenesis was not as straightforward as for immunoglobulin genes in B cell deficiency, we decided to perform experimental tests. Among the DC genes found for cervical cancer, there were seven up-regulated and seven down-regulated in cancer. Therefore, for validation experiments we chose one down-regulated (FGFR2) and one up-regulated (CACYBP) gene that have not been previously studied in cervical cancer for regulatory properties, but have a potential connection with cell death or proliferation based on their Gene Ontology annotations. In order to test if FGFR2 and CACYBP play critical regulatory roles in cancer pathogenesis, we evaluated the effect on in vitro knockdown of these genes on cell proliferation in a cervical carcinoma cell line.

First, we tested two cervical cancer cell lines (Hela and ME180) and found that only ME180 had detectable expression levels of both genes. In order to perform these tests, we evaluated siRNAs and observed that they were able to knock down expression of both genes by at least 70% (Figure 5A). CACYBP is up-regulated in tumor tissue, as compared to normal tissue (Figure 5B). Consequently, if CACYBP has regulatory potential, as predicted by our analysis, it should function as an oncogene promoting cell proliferation. Therefore, the knockdown of this gene should result in a decrease of cell growth/survival. Since FGFR2 was found down-regulated in cervical carcinomas (Figure 5B) its potential regulatory role would be as a tumor suppressor. Therefore, the knockdown of this gene is expected to increase cell growth. The subsequent analysis of cell proliferation confirmed our predictions for both genes: knockdown of CACYBP led to a decrease of cell growth, while knockdown of FGFR2 induced higher cell proliferation (Figure 5C). Thus, these results provide additional support to our in silico prediction that DC genes may play a regulatory role in cell proliferation related to tumor growth.

e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure5.gif

Figure 5. Experimental evaluation of DCGs in cervical cancer.

A) Efficacy of FGFR2 and CACYBP siRNA knockdown. qRT-PCR with primers for GAPDH as the internal control was used to determine expression and efficacy of FGFR2 and CACYBP specific siRNA knockdown in endothelial cells (ME180). ME180 cells were harvested 72 h after transfection with vehicle (Lipofectamine) and either scrambled control or targeting siRNA. B) Gene expression of FGFR2 and CACYBP (mean +/- standard deviation) for tumor and normal samples from five datasets used in the analysis. Since FGFR2 was found down-regulated in tumor tissue, its potential regulatory role would be as a tumor suppressor. However, CACYBP is up-regulated, thus CACYBP should function as an oncogene promoting cell proliferation. C) Evaluation of cell proliferation inhibition using xCelligence System. Proliferation data (cell index) was obtained at 72 h after transfection with Lipofectamine and either scrambled control or targeting siRNA. Inhibition index was calculated (two step normalization of cell index): inhibition index > 0 – cells transfected with targeting siRNA showed decrease in proliferation; < 0 – showed increase in proliferation; = 0 – no difference from control was found. One sided T test for mean (< 0 for FGFR2 and > 0 for CACYBP) was applied and returned statistically significant p-values for both of them (0.0258 for FGFR2 and 0.01978 for CACYBP).

Dataset 5.Cytoscape Edges and Nodes tables from network in Figure 1.
The datasets are sufficient to reproduce Figure 2.
Dataset 6.Cytoscape Edges and Nodes tables from network in Figure 3.
The datasets are sufficient to reproduce Figure 4.
Dataset 7.Raw data for Figure 5A,C.
Raw data for Figure 5A:qRT PCR siRNA test.Instrument Type: steponeplusPassive Reference: ROXAnalysis Type: SingleplexEndogenous Control: GAPDHRQ Min/Max Confidence Level: 95.0Reference Sample: ARaw data for Figure 5C:Three xCellingence experiments.

Discussion

In the current study, the differential co-expression analysis21 was applied to two relatively well-investigated biological systems28,29 in order to evaluate the potential importance of genes found using differential correlation analyses. Overall, the obtained results support the idea that DC genes play a regulatory role. While in B cell deficiency DCPs were found highly enriched with immunoglobulin genes (i.e. causal genes for alterations in the gut) we did not observe enrichment for key driver genes in cervical cancers. Rather, DCPs of cervical cancer seem to be located downstream of causal genes. Indeed, those DCPs have been found closer to key regulators than other genes in the network, actually representing “bottlenecks” for communication between driver genes previously published in 29 and the rest of the network (Figure 4). Furthermore, some differentially co-expressed genes in cervical cancer have been previously implicated in processes such as metastasis, oncogenic autophagy and apoptosis. For example, CACYBP has been shown to promote colorectal cancer metastasis31, TRPM3 was observed to play a role in oncogenic autophagy in clear cell renal cell carcinoma32,33, and AK2 was reported to activate apoptotic pathway34. Several genes are investigated for prognostic value for cancers such as myeloma35, lymphoma36, breast3741 and gastrointestinal42,43 cancers. At least two genes were previously proposed as targets for anti-cancer agents: DHFR44 and FGFR245. Moreover, CACYBP and ZSCAN18 were also reported as putative tumor suppressor genes in renal cell carcinoma30,46,47. In addition, we have tested two DC genes and confirmed their regulatory role (FGFR2 as a tumor suppressor and CACYBP as a potential oncogene in cervical cancer) by manipulating their expression in vitro. Altogether, published observations and our experimental validation for these two genes support the idea that DC genes revealed in the current study play a regulatory role and can be candidate targets for cervical cancer treatment.

Interestingly, while in the model of B cell deficiency, the DC genes are highly enriched with causal regulatory genes, there was only one key driver in cervical cancer (CEP70), despite the DC genes in this system still seeming to play a regulatory role overall. Such a difference is potentially related to the fact that the mouse system studied in 28 is highly homogeneous (inbred mice) with only one cause of alterations (i.e. absence of B lymphocytes). Cervical cancer, however, is a heterogeneous system with different chromosomal aberrations and consequently turned-on expression of different driver genes in different patients. Therefore, we can speculate that differential correlations point to regulatory genes that are shared by majority of samples. This hypothesis warrants further investigation, especially considering that DCPs could represent common therapeutic targets for tumors that originated as a result of different genomic or epi-genomic events.

In conclusion, this study provided additional evidence for the previously suggested idea827 that genes presenting alterations in correlation patterns between different phenotypes (i.e. states of biological system) play a critical regulatory role in transitions from one state to another. Furthermore, although our results do not allow for full generalization, they indicate that gain and not loss of correlations connects critical genes involved in transitions to new phenotypes. However, further studies are required to understand how changes in correlation patterns can point to genes with critical capacity to guide a biological system into certain state/phenotype.

Material and methods

Preparation of microarray data

BcKO. All microarray data were analyzed using BRB Array-Tools developed by the Biometric Research Branch of the National Cancer Institute under the direction of R. Simon (http://linus.nci.nih.gov/BRB-ArrayTools.html). Array data were filtered to limit analysis to probes with greater than 50% of samples showing spot intensities of >10 and spot sizes >10 pixels, and a median normalization was applied.

Cervical cancer. Same as in cervical cancer29. The data were analyzed using BRB Array-Tools using the original normalization used in three studies5052 and median normalization over entire the array for the fourth study53. For all studies, we only considered genes found in at least 70% of arrays.

Filtering and meta-analysis of microarray data

In every analysis (DEGs, DCPs and networks), filter of direction (same sign of correspondent parameter – difference of mean, difference of correlation, correlation and partial correlation) was required in a fixed number of datasets (2 out of 2 in BcKO and 3 out of 5 in cervical cancer). Then meta-analysis was done through Fisher combined probability test54. Next, the pairs with false discovery rate (fdr)55 lower than a threshold are chosen. At last, only the pairs that pass PUC56 are considered correlated and therefore represent edges in the network.

Analysis of microarray data

BcKO. DEGs between groups of samples were identified by random variance paired t-test p-value lower than 5% with adjustment for multiple hypotheses by setting the fdr below 10% in BRB Array-Tools. Co-expression networks (BcKO and Control) were inferred through Pearson correlation with p-value < 20% and fdr adjustment below 2.5%. DCPs were calculated for pairs that were initially correlated (p-value < 20%) in at least one state. Then differences of Pearson correlation were tested following21 with a p-value below 10% and fdr < 2%. At last only the DCPs that showed up in one of the networks were selected.

Cervical cancer. DEGs were retrieved from a cervical cancer paper29. Correlation networks and DCPs followed the same procedure and in BcKO but with different p-values (correlation p-value < 10% with fdr < 10-8 and difference of correlation p-value < 10% with fdr < 0.25%). Partial correlation was computed using local partial correlation method30. The initial significance was p-value lower than 40% and then fdr < 5%.

For more details about the thresholds used, see Table S3 and Table S4.

Local partial correlation network

Two aspects of cervical cancer data motivated us to use local partial correlation for this system. First of all, we have more samples throughout five datasets (see Supplementary Table S1 and Supplementary Table S2) which allows us to have more confidence in our results and second we already know that tumors in general present heterogeneous causal factors. The partial correlation approach gives us the alternative to only consider edges that represent direct regulatory relations.

In this paper we used the new approach developed in 30 called local partial correlation. This approach was elaborated specially for cases when there are more variables than samples, which happens regularly in genetics and is a serious problem in classical statistics. First we calculate the correlation network. Then for each significantly correlated pair the inverse method is applied exclusively to the correlation sub-matrix formed only by the closest neighbors of the pair along with the genes forming the pair, Figure 6. If the number of closest neighbors is still higher than the number of samples n, then we decreasingly rank the correlations of the neighbors to either genes in the pair and select the first n/2 neighbors. For each sub- matrix, we only keep the partial correlation value regarding the pair that formed that sub- matrix and then calculate its p-value also based on the sub- matrix. R script for calculation is available in Supplementary Material.

e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure6.gif

Figure 6. Local partial correlation scheme: we calculate the LPC for pair X2, X5, (red nodes/edge).

The neighborhood of this pair is the set of nodes X3, X6, X8, X9 (black nodes/edges). X1, X4, X7 (blue nodes) are significantly correlated with the black nodes (blue edges), but not with the red nodes. Thus the inverse method is applied exclusively to the correlation sub-matrix formed only by the genes X2, X5, X3, X6, X8, X9. In correlation matrices the gray entries are statistically non-significant empirical correlations.

Partial correlations were estimated only for the significant (Pearson) correlations in co-expression network. Thus the same definition of DCPs (by Pearson correlation) can still represent structural changes as long as it remains present in one of the two networks.

Figure 3 illustrates the local partial correlation network for cervical cancer using only tumor data. It has 578 connected nodes and 824 edges.

Minimum shortest path

The shortest path is a method that calculates distances between 2 nodes in a network. It consists of the minimum number of edges connecting 2 nodes. In this case we want to know the minimum number of edges connecting one node, either DCP gene or not, to a group of nodes: the key drivers Figure 7. For each gene we calculate the shortest path to all key drivers and get the minimum value. Then we compare the minimum shortest path to key drivers coming from DCP genes and the remaining genes. Figure 4A shows that the minimum shortest path to key drivers tend to be smaller when originated in DCP genes.

e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure7.gif

Figure 7. In this example we show how to calculate the distance (length of shortest path) between the gene G2 and group of genes D1, D2, D3, D4 (nodes in red).

Bi-partite betweenness centrality

Betweenness Centrality measures the node’s centrality in a network by counting the number of shortest paths from all vertices to all other vertices that pass through that node. A gene with high betweenness centrality has a great influence on the transfer of signal through the network Figure 8.

e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure8.gif

Figure 8. Here we explain how to calculate bi-partite betweenness centrality (bc) between groups A and B.

Note that the node D has bigger bc because all shortest paths connecting nodes in group A to nodes in group B pass through the node D.

However we are interested in the signal passing from key drivers throughout the network. For this reason we decided to apply the measure previously developed by our lab6 called Bi-partite Betweenness Centrality. It measures the amount of shortest path going from all genes in one group of vertices to all genes in a different group of vertices. In our case, the groups of genes are the key drivers and the peripheral genes (genes connected to only one edge).

Experimental design

FGFR2 and CACYBP knockdown experiment

ME180 cells were transfected with FGFR2-, CACYBP-specific siRNA or control siRNA using Lipofectamine RNAiMAX Transfection Reagent. Cell growth rate during 72h after siRNA transfection was measured using xCelligence system as described below.

Evaluation of siRNA efficacy in knocking down the gene targets. ME180 cell line was obtained from Dr. Pulivarthi H. Rao. It was cultured in RPMI medium with 10% FBS and 1% Penicillin-Streptomycin added. The cells were seeded at density 4000 cells per well in 96 F-bottom plates (seeding procedure was done according to ATCC protocol for ME180 cell line) and with cell culture media 200 ul per well. 24 hours after seeding, cells were transfected with one of the three siRNA, see Table 2.

Table 2. Suppliers.

TargetSupplierSupplier ID
FGFR2ThermoFishers5173
CACYBPThermoFishers25819
Non-targeting
siRNA
DharmaconD-001810-01-05

Before transfection, 100 uL of media was taken from each well. Transfection procedure was done according to Lipofectamine RNAiMAX Reagent protocol (Protocol Pub. No. MAN0007825 Rev. 1.0). 3pM of siRNA per well and Lipofectamine 0.6 uL per well were delivered in 20uL. 80 uL of fresh cell culture media was added to each well.

Cells were collected 72 h after transfection using Lysis buffer from RNeasy Mini Kit (QIAGEN). RNA extraction was done using RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol (no Dnase treatment step was done). Concentrations of RNA measured with Qubit RNA BR Assay Kit. cDNA was done using Bio-Rad iScript cDNA Kit according to the manufacturer’s protocol.

Quantitative Real-Time PCR was done for the samples using QuantiFast SYBR Green PCR Kit and GAPDH as a control gene. Primers for the targets you can see in the Table 3.

Table 3. Primers and Targets.

TargetForward/
Reverse
Primer sequence (5' -> 3')
FGFR2ForwardAACAGTTTCGGCTGAGTCCAG
FGFR2ReverseGCCCAGTGTCAGCTTATCTCTT
CACYBPForwardCTCTGTGGAAGGCAGTTCAAA
CACYBPReverseTCAGGTAATCCCACCTTGTGTT
GAPDHForwardGGAGCGAGATCCCTCCAAAAT
GAPDHReverseGGCTGTTGTCATACTTCTCATGG

qRT PCR set up: sample was heated to 95°C, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec.

Evaluation of cell growth after knock down of gene targets. CACYBP is up-regulated in tumor tissue, as compared to normal tissue (Figure 5B). Consequently, if CACYBP has regulatory potential, as predicted by our analysis, it should function as an oncogene promoting cell proliferation. Therefore, the knockdown of this gene should result in a decrease of cell growth/survival. Since FGFR2 was found down-regulated in cervical carcinomas (Figure 5B) its potential regulatory role would be as a tumor suppressor. Therefore, the knockdown of this gene is expected to increase cell growth.

Cell growth was evaluated using xCelligence system (The RTCA DP Instrument) using manufacturer’s protocol. ME180 was cultured in RPMI media with 10% FBS and 1% Penicillin-Streptomycin added. The cells were seeded at density 4000 cells per well (E-Plate 16) in 200 uL of cell culture media.

24 hours after seeding, the experiment was paused for transfecton. Before transfection, 100 uL of media was taken from each well. Transfection procedure was done according to Lipofectamine RNAiMAX Reagent protocol (Protocol Pub. No. MAN0007825 Rev. 1.0). 3pM of siRNA per well and Lipofectamine 0.6 uL per well were delivered in 20uL; 80 uL of fresh cell culture media was added to each well. Plate was placed back in the slot and cell growth was evaluated for another 72 h.

Cell index normalization. To evaluate cell growth rate cell index was transformed into Inhibition index in two steps:

  • 1. Cell indexes for all wells were exported to the excel file. For each treatment (including non-targeting siRNA transfected wells) we extracted cell index average for all wells at 20 h after seeding (Cell Index Before Treatment) and at 96 h after seeding (Cell Index After Treatment). To normalize cell index to initial cell number differences for each of the treatments we used the following formula:

    After/BeforeTreatmentNormalizedCellIndex(A/BIndex)=CellindexAfterTreatmentCellindexBeforeTreatment

  • 2. In next step we normalized each treatment with targeting siRNA to treatment with non-targeting siRNA. For this purpose in each experiment A/B Index from treatment (siRNA targeting either FGFR2 or CACYBP) was normalized to A/B Index from control treatment using the following formula:

    InhibitionIndex=ControlA/BIndex–TreatmentA/BIndexControlA/BIndex

Final evaluation of growth was done according to the value of Inhibition Index:

>0 – there is a decrease in growth;

0 – no difference between treated with targeting and treated with non-targeting siRNA;

<0 – there is a growth after treating with targeting siRNA.

Data availability

BcKO: Gene expression files containing array data from 28 are available under the GSE23934 superseries in the Gene Expression Omnibus (GEO) data repository. We worked with two groups of samples: B10.A littermates and BALB/C (Table S1).

Cervical cancer: We have used the same datasets as in previous study29 available at GEO: GSE741050, GSE679151, GSE780352, GSE975053, GSE2634229 (Table S21).

F1000Research: Dataset 1. Differentially expressed genes from BcKO study, 10.5256/f1000research.9708.d14210057

F1000Research: Dataset 2. Differentially correlated pairs from BcKO study, 10.5256/f1000research.9708.d14209958

F1000Research: Dataset 3. Causal genes from BcKO study, 10.5256/f1000research.9708.d14209759

F1000Research: Dataset 4. Causal genes from cervical cancer study, 10.5256/f1000research.9708.d14209860

F1000Research: Dataset 5. Cytoscape Edges and Nodes tables from network in Figure 1, 10.5256/f1000research.9708.d14210161

F1000Research: Dataset 6. Cytoscape Edges and Nodes tables from network in Figure 3, 10.5256/f1000research.9708.d14210262

F1000Research: Dataset 7. Raw data for Figure 5A,C, 10.5256/f1000research.9708.d14210363

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 22 Nov 2016
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Thomas LD, Vyshenska D, Shulzhenko N et al. Differentially correlated genes in co-expression networks control phenotype transitions [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2016, 5:2740 (https://doi.org/10.12688/f1000research.9708.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 22 Nov 2016
Views
16
Cite
Reviewer Report 16 Jan 2017
Fabrício Martins Lopes, Federal University of Technology – Paraná, Cornélio Procópio, Brazil 
Approved with Reservations
VIEWS 16
The manuscript “Differentially correlated genes in co-expression networks control phenotype transitions” investigates the differentially co-expressed genes in two biological processes, a homogeneous one-causal-factor process (B cell deficiency) and a heterogeneous multi-causal system (cervical cancer). The authors have adopted the Pearson ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Martins Lopes F. Reviewer Report For: Differentially correlated genes in co-expression networks control phenotype transitions [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2016, 5:2740 (https://doi.org/10.5256/f1000research.10464.r17875)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
19
Cite
Reviewer Report 23 Dec 2016
Andrei Zinovyev, Institut Curie, Paris, France 
Approved with Reservations
VIEWS 19
The manuscript "Differentially correlated genes in co-expression networks control phenotype transitions" by Lina Thomas et al, is devoted to describing a case study of two transcriptomic datasets with the focus on characterizing pairs of differentially correlated genes, with a limited ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Zinovyev A. Reviewer Report For: Differentially correlated genes in co-expression networks control phenotype transitions [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2016, 5:2740 (https://doi.org/10.5256/f1000research.10464.r17872)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
19
Cite
Reviewer Report 20 Dec 2016
Thiago M. Venancio, Center for Bioscience and Biotechnology, State University of Norte Fluminense Darcy Ribeiro, Campos dos Goytacazes, RJ, 28035-200, Brazil 
Approved
VIEWS 19
In the present work Thomas et al. employed method to find differentially co-expressed genes in co-expression networks of a B lymphocyte deficiency (largely mono-causal) and a complex cervical cancer (multi-causal) dataset. They used different graph-theoretical approaches to find relevant genes in ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Venancio TM. Reviewer Report For: Differentially correlated genes in co-expression networks control phenotype transitions [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2016, 5:2740 (https://doi.org/10.5256/f1000research.10464.r17874)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 22 Nov 2016
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.