Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone

Cells and cell culture conditions

Normal human neonatal epidermal melanocytes were purchased from Tebu-bio (Portland, OR) (catalog # 104-05n 5E5 Cells) and normal human neonatal epidermal keratinocytes were obtained from PromoCell (Heidelberg, Germany) (catalog # C-12007). Melanocytes and keratinocytes were routinely cultured as reported previously³. Melanocytes were maintained in MGM-M2 medium plus all supplements (Cascade Biologics, Portland, OR; M-254-500 plus S-002-5) while keratinocytes were cultured in KBM-2 medium with all supplements (PromoCell; C-20111). 500,000–700,000 cells were seeded into 6 cm diameter culture dishes. On the following day cells were deprived for 48 hrs from bovine pituitary extract followed by pre-incubation with 10^-6 M α-MSH (α-melanocyte-stimulating hormone) (Calbiochem, Schwalbach, Germany) for 6 hrs at 37°C.

Irradiation

UVB treatment was performed with an irradiation bank consisting of six fluorescent bulbs (TL12, Philips) which emit most of their energy within the UVB range with an emission peak of 313 nm. Cells were irradiated through phosphate-buffered saline at 5, 10 and 15 mJ/cm² followed by incubation with experimental medium (5 ml) with and without α-MSH (10^-6 M) for 24 hrs.

DNA extraction and purification

DNA was extracted using the Epicentre kit from Biozym (Hess. Oldendorf, Germany; MCD85201). DNA was finally dissolved in 10 mM Tris buffer with 0.1 mM EDTA.

Restriction and repurification

Five micrograms of each purified DNA sample were incubated with 10 units of AflIII (New England BioLabs, Ipswich, MA) for 1 hour at 37°C according to the manufacturer’s directions. The reaction mixture was repurified on spin columns according to the manufacturer’s directions (DNA Clean and Concentrator columns, Zymo Research Corporation, Orange, CA) and diluted appropriately in 10 mM Tris pH 8.5.

PCR

The Roche LightCycler-2 (Roche Applied Science, Indianapolis, IN) was used throughout these studies. Total mitochondrial genomes were quantified using primers HSSN1307 and HSAS 1433⁴ (5’GTACCCACGTAAAGACGTTAGG3’ and 5’TACTGCTAAATCCACC-TTCG3’ respectively) and probe 5’FAM-CCCATGAGGCAAGAAATT-BHQ1-3’³. Each capillary contained 250 pg DNA, 300 nM each primer, 200 nM probe, 0.01 μL uracil-DNAglycosylase, heat-labile (Roche) (UNG) and 1X LightCycler TaqMan Master Mix in a total volume of 5 μL. The Master Mix contains dUTP in place of dTTP in order for the amplified product to contain U in place of T. Pre-incubation of the PCR mixture with UNG allows for the degradation of any carryover contaminants from earlier reactions. The cycling protocol called for 10 min at 35°C for UNG digestion, followed by 10 min at 95°C to inactivate UNG and activate the Taq polymerase; up to 40 cycles of 95°C 10 sec for denaturation, 60°C 20 sec for annealing, 72°C 10 sec for polymerization and acquisition. Each run also contained two capillaries of 1 × 10⁵ copies of the plasmid pKW into which the Total amplicon had been inserted⁴.

Primers for the deletion were HSSN8416 and HSAS8542 (5’-CCTTACACTATTCCT-CATCACC-3’ and 5’-TGTGGTCTTTGGAGTAGAAACC-3’ respectively)³. The probe was 5’-6FAM-TGGCAGCCTAGCATTAGCAGTT-BHQ1-3’)⁴. Each capillary contained 10 ng sample DNA, primers, probe, UNG and Master Mix as in the Total reactions. Glycosylation and denaturation were as for the Total PCR. Amplification was initiated with 5 cycles of Touchdown PCR: cycle 1: 95°C for 10 sec, 65°C for 5 sec, dropping 1 degree per cycle down to 60°C followed by no more than 55 cycles of 95°C for 10 sec, 60°C for 15 sec. Results with touchdown PCR were more reproducible and took fewer cycles to reach the crossing point⁵. The touchdown amplicon was sequenced in the Molecular Resource Facility at the NJ Medical School.

The results shown are averages of three separate experiments. The proprietary software accompanying the Roche LightCycler was used to determine the crossing point of each sample. The crossing points of the samples were compared to crossing points of known copy numbers of standards in order to calculate sample copy numbers. In each experiment, total copies were determined in triplicate and deleted copies were determined in quintuplicate. Please see Dataset 1.

Sequence of the touchdown amplicon

Gel analysis determined that the touchdown amplicon was smaller than that of the common deletion (CD): less than 100 bp versus 127 bp. The CD is 4977 bp and spans bp 8470 to bp 13447. The touchdown deletion (TD) spans 5021 bp from bp 8433 to bp 13454. The CD is contained within the TD. Just as the CD is based on repeat sequences, in this case, of 13 bp, ACCTCCCTCACCA, the TD is based on the 5 bp repeat TCACC. Note that the 5 bp repeat is actually contained in the 13 bp repeat and the 3’ ends of both deletions coincide. The 5’ ends of the two deletions are 37 bp apart.

Figure 1 shows the effect of UVB irradiation on total mitochondrial genome copy numbers in melanocytes and keratinocytes that have been treated with α-MSH, compared to untreated (no α-MSH) controls. In the absence of any α-MSH, keratinocytes have 4.4 times more mtDNA copies than melanocytes. Copy numbers of mtDNA from non-α-MSH treated cells of both cell types are unaffected by UVB exposure in this dose range. α-MSH causes a small increase in copy number in both cell types in the absence of irradiation and a parallel decline with dose.

Figure 1. Total mtDNA copies as a function of UVB dose.

Black symbols: melanocytes, red symbols: keratinocytes. Circles: no α-MSH; squares: + α-MSH.

Figure 2 shows the effect of UVB irradiation on deleted copy numbers in melanocytes and keratinocytes that have been exposed to α-MSH compared to non-α-MSH treated controls. In the absence of any α-MSH treatment, deleted copies are about half as frequent in melanocytes than in keratinocytes. In the absence of α-MSH treatment, deleted copies decline slightly with increasing radiation dose in both types of cell. This is more likely due to slower replication of the deleted genomes than to their direct loss.

Figure 2. Deleted copies in melanocytes and keratinocytes as a function of UVB dose.

Black symbols: melanocytes, red symbols: keratinocytes. Circles: no α-MSH; squares: + α-MSH.

In melanocytes pre-treated with α-MSH, there is a marked increase in the frequency of deleted genomes with increasing UVB dose. This is likely to be due to the production of reactive oxygen species from UVB interaction with the melanin pigment or with melanin precursors. α-MSH actually causes a decrease in deleted copies in unexposed keratinocytes suggesting that, after exposure deleted copies replicate more slowly or that some protective agent has been induced. This effect is lessened as the UVB dose increases.