ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Note

Assessing the species composition of tropical eels (Anguillidae) in Aceh Waters, Indonesia, with DNA barcoding gene cox1.

[version 1; peer review: 1 approved, 2 approved with reservations]
PUBLISHED 13 Mar 2017
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

The objective of the present study was to evaluate the species diversity of eels native to Aceh waters based on genetic data. Sampling was conducted in western coast waters of Aceh Province, Indonesia, from July to August 2016. Genomic DNA was extracted from the samples, a genomic region from the 5’ region of the cox1 gene was amplified and sequenced, and this was then used to analyse genetic variation. The genetic sequences were blasted into the NCBI database. Based on this analysis there were three valid species of eels that occurred in Aceh waters, namely Anguilla marmorata, A. bicolor bicolor, and A. bengalensis bengalensis.

Keywords

Sidat, Ileah, Anguilla bicolor, Anguilla marmorata, DNA barcoding,

Introduction

There are 114 species of freshwater and brackish water fish distributed around 17 sampling locations across Aceh waters1. Several of these have the potential for aquaculture, e.g. the Anguilla spp. of tropical eels, locally known as sidat or illeah in Acehnese language23. Based on morphological characteristics, only two species of eels have been recorded in Aceh waters, Anguilla bicolor and Anguilla marmorata1, but it is believed that the true number of species is greater because some parts of the inland waters in Aceh province have not been explored yet. According to Miller and Tsukamoto4, there are 19 species of eels that have been identified worldwide, 7 of which are found in Indonesian waters5. It is therefore very likely that new species will be found in Aceh waters.

For fisheries management it is crucial to identify these species in order to plan a better conservation strategy, since each one has unique behavioral patterns, and should be independently managed. Eels are very similar morphologically, so it is very difficult to distinguish one species from the other based on morphological characteristics only. Analysing genetic data through DNA barcoding can solve this problem6, so that the true number of eel species living in the waters of Aceh can be evaluated. The objective of the present study was to verify the taxonomic status of eels in Aceh waters by amplifying the cox1 gene and analysing the genetic data.

Methods

The study was conducted on the western coast of Aceh Province, Indonesia, from July to November 2016. The samples were processed and analyzed in the School of Biological Sciences, Universiti Sains Malaysia. Sampling was done at night from 18.00 to 06.00 hours. Adult eels were caught using line fishing, while traps were used to catch glass eels. Eel larvae are called glass eels; they have translucent white bodies and measure about 5–10 cm. The length of adult eels is species dependent but most measure between 40–120 cm.

Approximately 1 cm2 of caudal fin tissue was taken from each specimen using a sterile procedure to avoid contamination of specimens. The tissue was placed into 2.0 ml tubes containing 96% alcohol. Genomic DNA was isolated using Aqua Genomic DNA solution following the manufacturer’s protocol78. DNA electrophoresis was carried out on a 0.8% agarose gel at 100V. The quality and quantity of extracted DNA was assessed using a spectrophotometer. A genomic region approximately 655 bp in size was amplified from the 5’ region of the Mitochondrial Cytochrome Oxidase Subunit I (cox1) gene following the protocol from Ward et al.9 with these primer pairs:

FishF1: 5’TCAACCAACCACAAAGACATTGGCAC3’

FishR1: 5’TAGACTTCTGGGTGGCCAAAGAATCA3’

After amplification, PCR products were run on 1.2% agarose gels at 100V. The clearest band was selected and purified using purification kits (PCR Clean-Up System, Promega), following the manufacturer's protocol. The purified products were run on 1.2% agarose gels at 100V to check for bands and only clear products were sent for sequencing to First BASE Laboratory Sdn Bhd in Kuala Lumpur, Malaysia. All obtained sequences were edited and aligned using MEGA 6.0 program10. Multiple sequence alignments were performed on the edited sequences with Cluster W, which is integrated into the MEGA 6.0 program. The sequences were then blasted into the NCBI database to compare and identify species. Nucleotide divergence among sequences was estimated for their genetic distance by Neighbour-Joining (NJ) based on Kimura 2 parameter. NJ was also used to construct phylogenetic trees to determine genetic relationships among haplotypes.

Statement on animal ethics

All procedures involving animals were conducted in compliance with The Syiah Kuala University Research and Ethics Guidelines, Section of Animal Care and Use in Research (Ethic Code No: 958/2015). Please refer to Supplementary File 1 for the completed ARRIVE guidelines checklist.

Results

Genomic DNA from the 5’ region of the cox1 gene from a total of 13 glass eel samples and 31 adult eel samples were successfully amplified (Table 1). The results from NCBI BLAST identified two species of eel from adult eel samples, shortfin eel A. bicolor bicolor and giant mottled eel A. marmorata. In addition, there were three species of eels that were recognized among the glass eel samples, namely A. bicolor bicolor, A. marmorata and Indian mottled eel A. bengalensis bengalensis. A total of 20 haplotypes, consisting of 3 haplotypes of the A. bengalensis bengalensis, 1 haplotype of the A. marmorata, 15 haplotypes of the A. bicolor bicolor and 1 haplotype of the Uroconger lepturus (out-group) were produced from 44 samples (Table 2), out of 132 variable sites. and a haplotype diversity (Hd) of 0.8742. The haplotype number four belongs to A. marmorata and was shared by 9 samples from 4 different locations. The haplotype number 5 belongs to A. bicolor bicolor and was shared by 13 samples from 6 locations. All of the haplotype sequences have been deposited in the NCBI GenBank with accession numbers KY618767 to KY618795.

Table 1. Total sample and code of the tropical eels collected from Aceh waters.

DistrictSampling siteTotal
sample
Stage
Aceh BesarBeureunut River13Glass
eels
Kajhu swamp5Adult
Tibang reservoir5Adult
Aceh River1Adult
Pulo Aceh Island1Adult
Nagan RayaGeutah River2Adult
Gayo LuesAlas River
(Blangkejeren)
1Adult
Aceh Barat DayaKuala Batee River1Adult
Aceh SingkilSingkil swamp5Adult
Aceh JayaLamno River1Adult
Aceh TenggaraAlas River4Adult
Aceh BaratMeurebo River3Adult
Pidie JayaUlim River1Adult
Aceh SelatanTerbangan1Adult
Total44

Table 2. Haplotypes according to species and sampling location.

HaplotypeSpeciesTotal
sample
Sampling location
1 Anguilla bengalensis bengalensis 2Beureunut River (Glass eels)
2 Anguilla bengalensis bengalensis 1Beureunut River
3 Anguilla bengalensis bengalensis 2Beureunut River
4 Anguilla marmorata 9Beureunut River, Blangkeujeren,
Geutah River, Alas River,
5 Anguilla bicolor bicolor 13Beureunut River, Kajhu swamp,
Singkil swamp,
Meurebo River, Ulim River,
Tibang reservoir
6 Anguilla bicolor bicolor 1Beureunut River
7 Anguilla bicolor bicolor 1Beureunut River
8 Anguilla bicolor bicolor 1Beureunut River
9 Anguilla bicolor bicolor 3Aceh River, Pulo Aceh River,
Terbangan
10 Anguilla bicolor bicolor 1Kuala Batee River
11 Anguilla bicolor bicolor 1Kajhu swamp
12 Anguilla bicolor bicolor 1Kajhu swamp
13 Anguilla bicolor bicolor 1Meurebo River
14 Anguilla bicolor bicolor 1Meurebo River
15 Anguilla bicolor bicolor 1Lamno River
16 Anguilla bicolor bicolor 1Singkil swamp
17 Anguilla bicolor bicolor 1Tibang reservoir
18 Anguilla bicolor bicolor 1Tibang reservoir
19 Anguilla bicolor bicolor 1Tibang reservoir
20 Uroconger lepturus (out-group)1Beureunut River
Total3 species eels (minus out-group)4414 locations

Therefore, the study revealed that there are three valid species of tropical eels found in Aceh waters: A. bicolor, A. marmorata, and A. bengalensis; the last species being a newly recorded species in Aceh waters. The study indicates that multiple species of glass eels migrate from the sea into freshwater. One interesting finding was that one sample of conger eels (Uroconger lepturus) was detected among the Tropical glass eel samples. This is indicatory of DNA barcoding being successful in identifying species of eels in Aceh waters which cannot be identified by biometric data. Genetic data has become an important tool in assessing gene flow between marine populations11, species identification12 and monitoring the resources of marine fisheries13.

The genetic divergence between A. bicolor and A. marmorata was 5.0%, between A. bicolor and A. bengalensis it was 6.7% and between A. marmorata and A. bengalensis genetic divergence was 4.0% (Table 3). The phylogenetic tree showed a close relationship between A. marmorata and A. bengalensis (Figure 1). Based on IUCN14 data, A. bengalensis bengalensis and A. bicolor bicolor are categorized as near threatened, while the status of A. marmorata is on least concern. However, based on direct sampling in Aceh waters the shortfin eels are still abundant and most frequently caught, and are distributed over a wide range of areas including small streams, marshes, peat swamp, estuaries and irrigation channel in paddy fields1,15. Indian mottled and giant mottled eels on the other hand have been very rarely caught and are generally only found in large rivers directly connected to the sea.

Table 3. The genetic distance between three species of Anguilla.

NoSpecies123
1Anguilla bicolor bicolor---
2Anguilla marmorata5.0-
3Anguilla bengalensis
bengalensis
6.74.0-
885e1629-1cf3-4440-bd17-3a52955ca4dd_figure1.gif

Figure 1. The phylogenetic tree of individual of Anguilla samples using the Neighbour-Joining (NJ) method.

Conclusion

It is concluded that three species of tropical eels are found in Aceh waters, namely, A. marmorata, A. bicolor bicolor, and A. bengalensis bengalensis where A. bengalensis bengalensis is the newly recorded species.

Data availability

Sequenced DNA of Tropical eels from Aceh waters can be found in the NCBI GenBank repository (https://www.ncbi.nlm.nih.gov/genbank/) with accession numbers KY618767 to KY618795.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 13 Mar 2017
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Muchlisin ZA, Batubara AS, Fadli N et al. Assessing the species composition of tropical eels (Anguillidae) in Aceh Waters, Indonesia, with DNA barcoding gene cox1. [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2017, 6:258 (https://doi.org/10.12688/f1000research.10715.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 13 Mar 2017
Views
9
Cite
Reviewer Report 11 May 2017
Murugaiyan Kalaiselvam, Centre of Advanced Study in Marine Biology, Faculty of Marine Sciences, Annamalai University, Tamil Nadu, India 
Approved with Reservations
VIEWS 9
  1. In Introduction, add few more points regarding the importance of Genetic identification, and demerits of conventional identification strategies (Only one point had been given in introduction for name sake, add few more)
     
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Kalaiselvam M. Reviewer Report For: Assessing the species composition of tropical eels (Anguillidae) in Aceh Waters, Indonesia, with DNA barcoding gene cox1. [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2017, 6:258 (https://doi.org/10.5256/f1000research.11554.r22410)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
15
Cite
Reviewer Report 18 Apr 2017
Mudjekeewis D. Santos, Genetic Fingerprinting Laboratory, National Fisheries Research and Development Institute, Quezon City, Philippines 
Approved with Reservations
VIEWS 15
This paper has some scientific merit in providing new information about species composition of eel in Aceh waters and in using COX1 gene as a marker. As such I find it suitable for indexing after major revisions:
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Santos MD. Reviewer Report For: Assessing the species composition of tropical eels (Anguillidae) in Aceh Waters, Indonesia, with DNA barcoding gene cox1. [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2017, 6:258 (https://doi.org/10.5256/f1000research.11554.r21916)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
15
Cite
Reviewer Report 22 Mar 2017
Salman Abdo Al-Shami, Department of Biology, University College of Taymma, University of Tabuk, Tabuk, Saudi Arabia 
Approved
VIEWS 15
The manuscript in hands present interesting information about species diversity of tropical eels (Anguilla spp.) in Aceh, Indonesia. Although the manuscript is nicely presented, few justifications and clarification are still required. 

Title 
  • For
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Al-Shami SA. Reviewer Report For: Assessing the species composition of tropical eels (Anguillidae) in Aceh Waters, Indonesia, with DNA barcoding gene cox1. [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2017, 6:258 (https://doi.org/10.5256/f1000research.11554.r20933)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 13 Mar 2017
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.