ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Antimicrobial resistance surveillance among gram-negative bacterial isolates from patients in hospitals in Khartoum State, Sudan

[version 1; peer review: 3 approved with reservations]
PUBLISHED 05 Feb 2019
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Pathogens gateway.

This article is included in the Antimicrobial Resistance collection.

Abstract

Background: Antimicrobial resistance (AMR) among gram-negative bacilli is a global health problem. Surveillance of AMR is required to advise on empirical antimicrobial therapy. This study aimed at evaluating the frequency and the AMR patterns of gram-negative isolates from patients treated in eight hospitals in Khartoum State, Sudan.
Methods: A cross-sectional laboratory-based study was conducted over a 6 months period at the Microbiology Department, Soba University Hospital- Khartoum State, Sudan. All gram-negative isolates from blood, urine, wound, and sputum during the period of study were included. Identification and antimicrobial susceptibility testing were carried out for all isolates.
Results: A total of 734 Gram-negative bacilli were isolated. Klebsiella pneumoniae (249 isolates, 34%) was the most frequently encountered one, followed by Pseudomonas aeruginosa (153 isolates, 21%), E.coli (123 isolates, 17%), Acinetobacter baumannii (75 isolates, 10%), Burkholderia cepacia (42 isolates, 6%), Proteus mirabilis and Proteus vulgaris (28 isolates, each, (4%) Enterobacter colecaes (28 isolates, 4%), Stenotrophomonas maltophilia (21 isolates, 2.8%), and other gram-negative bacilli (15 isolates, 2.2%) The analysis of the antimicrobial susceptibility patterns showed that 134 (22.3%) isolates were resistant to three or more classes of antibiotics, including cephalosporins, β-lactam–β-lactamase inhibitor, quinolones, aminoglycosides and carbapenems.
Conclusion: This high level of resistance among gram-negative bacilli in Khartoum state hospitals is alarming. The local health authorities should be prompted to step up infection control programs and introduce the concept of antimicrobial stewardship in Khartoum State hospitals.

Keywords

Gram-negative bacilli, Multidrug resistant bacteria, laboratory-based study, Surveillance.

Introduction

Antimicrobial resistance (AMR) constitutes a continuously growing threat to the effective treatment of microbial infections1. However, the direct impact of AMR on the health of hospitalized patients or the people in the community, as well as the financial burden experienced by health care systems in managing the infections and complications due to AMR, are still mostly uncertain2. Antibacterial drugs are widely used worldwide both in human health and food industry. Overuse of these medications can favor the selection and the spread of multidrug resistant (MDR) bacteria1. Multi drug resistance is defined as resistance to at least three different antibiotic groups, as reported by Masgala and Kostaki3. Antibiotic resistance among a variety of bacterial species is increasing in healthcare and community setting. Extended-spectrum β-lactamase and carbapenemase production are the most frequently emerging resistance mechanisms among gram-negative bacilli4. Gram-negative bacilli including Enterobacteriaceae and non-lactose fermenting bacteria such as Pseudomonas spp. and Acinetobacter spp. are the main causes of hospital-acquired infection in critical care units2,5. The antibiotic resistance rates among these organisms have amplified uncontrollably in a matter of a few years to become worldwide2. According to the Centre for Disease Control and Prevention, gram-negative bacilli are able to develop antibiotic resistance through multiple methods and are particularly competent at spreading the resistance among species via horizontal gene transfer6. The enigma of AMR is particularly plaguing low- and middle-income countries, where infectious diseases are the commonest cause of hospitalization and death; and the newer antibiotics cannot be afforded7.

AMR surveillance is key for determining the prevalence patterns of AMR, which is fundamental for the development of national and international treatment strategies. Most of the available surveillance data are derived from developed countries; the studies conducted in developing countries are unfortunately not adequate.

This surveillance study was undertaken in order to find out the different types of the AMR patterns of bacterial pathogens isolated from patients in Khartoum State, Sudan. This study may help in formulating antibiotic policies tailored to our hospitals. These data can be used as “information for action” antibiotic stewardship and interventions to optimize antibiotic prescribing practice, therefore prolongs the usefulness of existing antibiotics.

Methods

Study design and clinical strains

This is a cross-sectional laboratory based study carried out in the department of medical microbiology Soba University Hospital (SUH) and Institute of Endemic Diseases, University of Khartoum, Sudan. A total of 734 Gram-negative bacteria were isolated from patients treated in eight hospitals in Khartoum state including: two university hospitals (Soba university hospital and Bashaier); three teaching hospitals (Ibrahim Malik, Bahri and Sadabulalla) , a specialized hospital (Elfouad), and two private hospitals (Imperial and Elswedy). This study included all clinical specimens received in Soba University hospital microbiology laboratory in a period from October 2016 to February 2017 from various wards in the aforementioned hospitals including: intensive care units (ICUs), neonatal ICUs, medicine units, surgery units, pediatric units, and renal units. The isolates were collected from different clinical specimens including: blood (243 isolates, 33.1%), urine (230 isolates, 31.3%), wounds (183 isolates, 25%), sputum (22 isolates, 3%), catheter tips (26 isolates, 3.4%) and body fluids (including cerebrospinal, peritoneal, pleural, acetic and synovial fluid; 30 isolates 4.2%). Microorganisms were grown on Blood, Chocolate and MacConkey agar. Then, they were identified according to standard microbiological procedures (based on colony morphology, microscopy, and biochemical tests)8. Quality control strains were used in biochemical tests and antimicrobial susceptibility testing [E. coli (ATCC #25922) and P. aeruginosa (ATCC #27853)].

Most gram-negative Bacilli isolates were further identified and confirmed by PCR. Guanidine chloride method, as described by Alsadig et al.9, was used for DNA extraction followed by PCR which it was carried out using thermal cycler (analytikjena® Biometra TADVANCED, Germany), by using the following primers (Macrogen, Korea), using species-specific primers for Klebsiella pneumoniae, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii and Universal 16S rRNA primers (Table 1) the reaction was carried out in a total reaction volume of 25 μl (5μl Master mix of Maxime RT premix kit (iNtRON Biotechnology, Seongnam, Korea), 0.6 μl of forward primer, 0.6 μl of reverse primer, 2μl of DNA and 16.8 μl deionized sterile water). The cycle condition as the following: initial denaturation step at 94°C for 5-min, followed by 30 cycles of denaturation at 94°C for 45 seconds, primer annealing temperature according to the primers Table 1 for 45 seconds, followed by step of elongation at 72°C for 60 seconds and the final elongation at 72°C for 5 min10. The purity and integrity of each PCR product was evaluated electrophoresis in a 2% agarose gel in TBE 1X, that contain 2.5 μl of (20mg/ml) ethidium bromide at 100V for 40 min. The specific amplified product were detected by comparing with 100 base-pairs standard DNA ladder (iNtRON BIOTECHNOLOGY, Seongnam, Korea) Bands were visualized under U.V transilluminater (analytikjena® Biometra BDAcompact, Germany). The PCR product of 16SrRNA were purified and Sanger sequencing was performed by Macrogen Company (Seoul, Korea). Then nucleotides sequences of the genes 16SrRNA achieved were searched for sequence similarity using nucleotide BLAST for species identification11.

Table 1. Bacterial gene primers used for PCR.

Species specific
primers
Primer (5' to 3')Tm (°C)Band
size (bp)
Ref
Universal 16S rRNAF=AGAGTTTGATCCTGGCTCAG5889010
R=CTACGGCTACCTTGTTACGA58
K. pneumoniaePf = ATTTGAAGAGGTTGCAAACGAT5613
Pr1=TTCACTCTGAAGTTTTCTTGTGTTC56130
Pr2 = CCG AAG ATG TTT CAC TTC TGA TT56260
E.coli ECA75F=GGAAGAAGCTTGCTTCTTTGCTGAC5254414
ECR619R=AGCCCGGGGATTTCACATCTGACTTA52
Pseudomonas spp.F= GGGGGATCTTCGGACCTCA5895615
R=TCCTTAGAGTGCCCACCCG58
Acinetobacter sp4F CACGCCGTAAGAGTGCATTA5829416
sp4R AACGGAGCTTGTCAGGGTTA58
A. baumannii13TU,sp2FGTTCCTGATCCGAAATTCTCG58490

Antimicrobial susceptibility testing

Susceptibility testing was performed using the Kirby-Bauer disc-diffusion method; each isolate was swabbed on the Muller-Hinton agar and the antibiotic discs were placed on top and incubated at 37°C for 18–24 hours12. all isolates were tested against the following antibiotic disc (Mast Diagnostic): amoxycillin clavulanate (AMC) (30 μg), cefuroxime (CXM) (30 μg), cephalexin (CL) (30 μg), ceftriaxone (CRO) (30 μg), ceftazidime (CAZ) (30 μg), meropenem (MEM) (10 μg), imipenem (IPM) (10 μg), amikacin (AK) (30 μg), gentamicin (Gen) (10 μg), ciprofloxacin (CIP) (5 μg), trimethoprim-sulfamethoxazole (SXT) (25 μg), temocillin (TEM) (30 μg), azteroname (AZT) (30 μg) and nitrofrantoine (NIT) (300 μg). Results were interpreted according to the Clinical Laboratory Standards Institute (CLSI) guidelines12.

Classification of MDR gram-negative Bacilli

MDR has been considered for clinically significant gram-negative Bacilli such as E. coli, K. pneumoniae, P. aeruginosa, and A. baumannii based on the aforementioned antimicrobial resistance definition. Classes of antibiotics used for MDR-GNB analysis were aminoglycoside (AMG), cephalosporins (CEPH), carbapenems (CARB), and fluroquinolones (FQ) as follows: bacteria that were MDR for four classes of antibiotics (AMG+ CEPH+ CARB+ FQ) and bacteria that were MDR for three classes of antibiotics (either AMG+CEPH +FQ, CARB+CEPH+FQ, AMG+CEPH+CARB, or AMG+FQ+CARB)3.

Cephalosporin resistance was defined as resistance to ceftriaxone and ceftazidime, except for P. aeruginosa, where only ceftazidime was used. Carbapenem resistance was defined as resistance to both meropenem and imipenem. Aminoglycoside resistance was defined as resistance to both gentamicin and amikacin, Ciprofloxacin resistance was considered an indication to fluoroquinolones resistance.

Ethical consideration

Formal permission was obtained from the managers of Soba University Hospital and the Institutional Research Ethics Committee of the Institute of Endemic Diseases, University of Khartoum, approved this study under reference number IEND_REC 12/2017. Patient consent was waived by the Research Ethics Committee.

Statistical analysis

Data were analysed using Microsoft Excel and SPSS version 20.0. Cross-tabulation was used to present the different relations between data, qualitative data were performed using a χ2 test (significance was set at p≤0.05), which was performed to find the differences between bacterial isolates with resistance to at least one class of antibiotics by specimens (blood, urine, wound and other samples) p-values were determined for primary and secondary outcomes.

Results

Bacterial identification

Isolated Gram-negative bacilli showed different strains, including E. coli (123 isolates, 17%), K. pneumoniae (249 isolates,34%), P. aeruginosa (153 isolates, 21%), A. baumannii (75 isolates, 10%), Burkholderia cepacia (42 isolates, 6%), Proteus mirabilis and Proteus vulgaris (28 isolates, 4%), Enterobacter colecaes (28 isolates, 4%), Stenotrophomonas maltophilia (21 isolates, 2.8%) and other gram-negative bacilli (15 isolates, 2.2%).

While isolates were distributed among the different hospital units, most of the pathogenic strains were isolated from neonatal intensive care unit (ICU) (182 isolates, 24.8%) mainly K. pneumoniae (77 isolate, 42.3%) and pediatric units (175 isolates 23.8%) the most prevalent strains were K. pneumoniae (50 isolate, 29%) and P. aeruginosa (44 isolates, 25.1), while medicine (147 isolates, 20%), K. pneumoniae and E.coli (45 isolates 30.6%) for both. For the surgery unit (103 isolates, 14%) renal unit (78 isolates, 10.7%) and ICU (49 isolates, 6.7%) mainly K. pneumoniae (19 isolates, 39%), P. aeruginosa and A. baumannii were (9 isolates, 20.4) for both. Klebsiella pneumoniae was the most isolated organism from all hospital units. The distribution of different gram-negative isolates is shown in Table 2.

Table 2. The incidence of gram-negative Bacilli isolated from patients admitted to different hospital wards in Khartoum State between October 2016 and February 2017.

BacteriaHospital wardP-value
ICU,
n (%)
NICU,
n (%)
Medicine,
n (%)
Surgery,
n (%)
Renal
unit, n (%)
Paediatric,
n (%)
Klebsiella pneumoniae (249)19 (39)77 (42.3)45 (30.6)34 (33)24 (31)50 (29)<0.001
Escherichia coli (123)4(8.1)9 (5)45 (30.6)22 (21.3)16 (21)25 (14.2)<0.001
Pseudomonas aeruginosa (153)10 (20.4)40 (21.9)24 (16.3)17 (16.5)19 (24.3)44 (25.1)<0.001
Acinetobacter baumannii (75)10 (20.4)18 (9.9)9 (6.1)8 (8)7 (9)24 (14)<0.001
Burkholderia cepacia (42)3 (6.1)11 (6)7 (4.7)6 (6)4 (5.1)11 (6.3)<0.001
Proteus spp. (28)1 (2)3 (2)4 (2.7)9 (9)3 (4)8 (5)<0.001
Enterobacer spp. (28)1 (2)10 (5.5)4 (3)3 (3)4 (5.1)6 (3.4)<0.001
Stenotrophomonas spp. (21)1 (2)10 (5.5)3 (2)2 (2)1 (1)4 (2)<0.001
Other gram-negative Bacilli (15)0 (0)4 (2.2)6 (4)2 (2)0 (0)3 (2)<0.001
Total (734)49 (6.7)182 (24.8)147 (20)103 (14)78 (10.7)175 (23.8)<0.001

*Other Gram-negative bacilli include Citrobacter species, Serratia species, Vebrio vurneficus and Morganella morganii. †Body fluids include cerebrospinal fluid, peritoneal fluid, pleural fluid, acetic fluid and synovial fluid.

With regard to the distribution of the isolates among different clinical specimens, Klebsiella pneumoniae and Pseudomonas aeruginosa were isolated mainly in blood specimens 39% and 25% respectively, while K. pneumoniae and E.coli were 36% and 30% of urine samples. A. baumannii was isolated from 14% of wound specimens and P. aeruginosa was isolated from 23% of wound specimens. For more details about gram-negative bacilli among different specimen see Table 3.

Table 3. The frequency of gram-negative bacilli isolated from different clinical samples obtained from patients treated at Khartoum State hospitals between October 2016 and February 2017.

BacteriaSpecimenP-value
Blood,
n (%)
Urine,
n (%)
Wounds,
n (%)
Sputum,
n (%)
Catheter
tips, n (%)
Bodily
fluids†, n (%)
Klebsiella pneumoniae (249)94 (39)82 (36)50 (27)7 (32)7 (28)9 (29)<0.001
Escherichia coli (123)15 (6.1)70 (30)31 (17)2 (9)1 (4)4 (12.9)<0.001
Pseudomonas aeruginosa (153)60 (25)32 (14)42 (23)6 (27.2)7 (28)6 (25)<0.001
Acinetobacter baumannii (75)18 (7.4)13 (5.6)25 (14)6 (27.2)7 (28)6 (25)<0.001
Burkholderia cepacia (42)20 (8)9 (4)9 (5)1 (5)1 (4)2 (6.4)<0.001
Proteus spp. (28)6 (2.5)7 (3)12 (6.5)0 (0)2 (8)1 (3.2)<0.001
Enterobacer spp. (28)13 (5)8 (3.5)7 (4)0 (0)0 (0)0 (0)<0.001
Stenotrophomonas spp. (21)12 (5)2 (0.9)5 (3)0 (0)0 (0)2 (6.4)<0.001
Other gram-negative Bacilli* (15)5 (2)7 (3)2 (1)0 (0)1 (0)0 (0)<0.001
Total (734)243 (33.1)230 (31.3)183 (25)22 (3)26 (3.4)30 (4.2)<0.001

*Other Gram-negative bacilli include Citrobacter species, Serratia species, Vebrio vurneficus and Morganella morganii.

Antimicrobial resistance pattern of clinical isolates

Antibiotic resistance pattern are shown in Figure 1. Out of 734 isolates tested using the disk diffusion method, the highest percentage of resistance, in 97% and 93.5% of isolates, were found against ampicillin and cephalexin, respectively, followed by amoxicillin/clavulanic acid(90%), cefotaxime (89.7%), ceftriaxone (88.4%) and ceftazidime (79.2%). In addition, co-trimoxazole and nitrofurantoin resistance were detected in 74.4% and 75.2% of isolates, respectively. Resistance rates also were high in ciprofloxacin (45.2%), gentamicin (52.5%) and amikacin (18.3%). Meropenem and imipenem were the most effective antibiotic tested, with resistance observed in 21.6% and 16.2% of isolates, respectively.

5c8fa659-eabf-441d-a7e0-aeca7828435b_figure1.gif

Figure 1. Antimicrobial resistance pattern among different gram-negative Bacilli isolated from patients treated at Khartoum State hospitals between October 2016 and February 2017.

The antimicrobial resistance patterns of most commonly isolated organisms are shown in Figure 2. K. pneumoniae resistant pattern as the following (22%) of them were resistant to meropenem while (11%) were resistant to imipenem, ceftazidime (80.6%), Gentamicin (52%), ciprofloxacin (42%) and amikacin (16.7%). With regard to the E. coli antimicrobial resistant pattern, meropenem (9%), imipenem (8%), ceftazidime (84.2%), ciprofloxacin (66.4%), Gentamicin (53.1%) and amikacin (12.0%). In Pseudomonas aeruginosa the resistance rate was meropenem (20%), imipenem (22%) ceftazidime (81%) followed by gentamicin (57.5%), ciprofloxacin (22.5%) and amikacin (9.5%). The rate of antimicrobial resistant among A. baumannii was as the following; meropenem (73.7%), imipenem (66.7%), amikacin (63.2%), gentamicin (79%) and ciprofloxacin (79%).

5c8fa659-eabf-441d-a7e0-aeca7828435b_figure2.gif

Figure 2. Antimicrobial resistance pattern of commonly isolated organisms’ different antibiotics between October 2016 and February 2017.

MER, meropenem; IMP, imipenem; AK, amikacin; GEN, gentamicin; CIP, ciprofloxacin; CAZ, ceftazidime; CRO, ceftriaxone; CXM, cefuroxime; CN, cephalexin; AM, ampicillin; AMC, amoxycillin-clavulanate; SXT, trimethoprim-sulfamethoxazole; NIT, nitrofurantoin; TEM, temocillin; ATZ, azetronam.

Multidrug resistance patterns among gram negative Bacilli

The gram-negative bacilli that were resistant to several antibiotic groups are shown in Table 4. Of 600 GNB isolates, 134 (22.3%) isolates were MDR. Of those MDR organisms, 48 isolates (8%) were resistant to four classes of antimicrobial drugs: A. baumannii (38 isolates, 50.6%), K. pneumoniae (9 isolates, 3.6%), and E. coli (1 isolate, 0.8%). A further 86 isolates (14.2%) were resistant to three classes of antimicrobial drugs: A. baumannii (38 isolates, 50.6%), K. pneumoniae (47 isolates, 18.8%), P. aeruginosa (21 isolates, 13.7%) and E. coli (6 isolate, 4.8%).

Table 4. Multidrug resistance among gram-negative isolates.

ClassResistance toKlebsiella
pneumoniae,
n (%)
Escherichia
coli, n (%)
Pseudomonas
aeruginosa, n (%)
Acinetobacter
baumannii, n (%)
Total, n (%)
All
isolates
NA24912315375600
4MDRAMG+ CEPH+ FQ+ CARB9 (3.6%)1 (0.8%)0 (0%)38(50.6%)48 (8%)
3MDRAMG+ CEPH+ FQ31(12.4%)5(4%)4 (2.6%)2 (2.6%)42 (7%)
3MDRCARB+ CEPH+ FQ6 (2.4%)0 (0%)8 (5.2%)8 (10.6%)22(3.6%)
3MDRAMG+ CEPH+ CARB2 (0.8%)0 (0%)5 (3.2%)1 (1.3%)8 (1.3%)
3MDRAMG+ FQ+ CARB8 (3.2%)1(0.8%)4 (2.6%)1 (1.3%)22(3.6%)
Total 56 (22.4%)7 (5.6%)21 (13.7%)50 (66.6%)14 (2.3%)

NA, not applicable; AMG, aminoglycoside; CEPH, cephalosporins; FQ, florquinolones; CARB, carbapenem.

Discussion

Infection with MDR gram-negative Bacilli is a major problem worldwide, associated with increased patients morbidity and mortality17. In Sudan, the increasing number of MDR bacteria is a real clinical challenge18,19. This study was undertaken; to identify the different patterns of AMR in bacterial pathogens isolated from patients treated in various wards of hospitals.

In this study, K. pneumoniae and P. aeruginosa strains were more prevalent in blood specimens while K. pneumoniae and E.coli strains were more frequently isolated in urine specimens.

K. pneumoniae is a prominent pathogen causing both hospital-acquired and community-associated infections, including bacteremia, wound infection, pneumonia, urinary tract infections and other infections20,21. In this study, K. pneumoniae was the most commonly isolated organism from the blood specimens mainly in neonatal sepsis in a high rate (39.8%). Most of these strains resistant to cephalosporins and other class of antibiotics including carbapenem as reported worldwide7,21,22.

E. coli is regarded as the commonest pathogen of the urinary tract, causing complicated and uncomplicated urinary tract infections23. In this study, the most frequently observed pathogens in urine specimens were E. coli (30%) and K. pneumoniae (36%). This finding is in harmony with the results of several other studies, including: de Francesco et al., who found that E.coli was the commonest GNB (42.4%) isolate from urine specimens of patients with urinary tract infection24; a study in Tanzania reported 38% of E.coli isolated from urinary specimens25 and other studies from Pakistan and India25,26.

In this study, non-lactose-fermenting gram-negative bacilli such as P. aeruginosa and A. baumannii were mostly encountered in ICU patients, these organisms were isolated in 20.4% of samples, and were found in different clinical samples such as: blood, wound and sputum. This finding agrees with a study by Vincent et al. that reported P. aeruginosa and A. baumannii were frequently isolated from ICU patients by Vincent et al.27; Jitendra et al., reported that A. baumannii was the second most common pathogen in an ICU of a tertiary care center28.

Concerning the infection type, we found that P. aeruginosa were associated with 25% of blood stream infections and 23% of wound infection, while A. baumannii mainly associated with wound infection in 14% in agree with Gales et al. 201029.

Resistance of gram-negative bacilli is widespread and multidrug resistance has been reported in many studies2,4,5, causing challenges in the treatment of nosocomial infections. The resistance pattern was commonly reported in classes such as cephalosporins, carbapenem, aminoglycosides and quinolones3032. In this study, we observed high rates of resistance to extended-spectrum β-lactamases (ESBL), resistance to cephalexin, cefuroxime, ceftazidime and ceftriaxone, in addition to resistance to ampicillin and amoxicillin/clavulanic acid.

The analysis of the antimicrobial susceptibility patterns of the study isolates showed high rate of MDR organisms that were resistant to three or more classes of antibiotics, including carbapenem and aminoglycosides. This pattern was observed mainly among Acinetobacter baumannii, Pseudomonas aeruginosa and Klebsiella pneumoniae.

The most resistant strain was Acinetobacter baumannii, being resistant to all four classes of antibiotics used in 50.6% of isolates. A total of 73.7% of A. baumannii were found to be resistant to meropenem, and 66.7% to imipenem, while in the cephalosporin class, more than 91% of the isolates were resistant. A. baumannii also have high resistance rate to aminoglycosides and quinolones (63.2% for amikacin and 79% for both gentamicin and ciprofloxacin). This increasing resistance among A. baumannii has become a public-health issue, because this bacterium frequently causes nosocomial infections31.

In this study the most common clinical isolates of the Enterobacteriaceae family were K. pneumonia and E. coli. In both species, there was a high prevalence of resistance against quinolones, aminoglycosides and beta-lactams. Rates of resistance to carbapenems were alarmingly high: 22% in K. pneumoniae and 9% in E. coli. These bacteria have high resistance rate to ceftazidime and cephalexin, (80.6% and 92%, respectively). These rates are much higher than those observed in 2013 by Ali in Soba University hospital, who found that ceftriaxone and ceftazidime resistance rates ranged from 56% to 79%21,33. Aminoglycoside (specifically amikacin) resistance rates among K. pneumoniae and E. coli were 16.7% and 12.1%, respectively, which is higher than those observed by Lee in 2013, who found the resistance rate to amikacin was 6.2% in K. pneumoniae and 1.3% in E. coli30. In this study Gentamicin resistance among both K. pneumoniae and E. coli was 53%, which is a high resistance rate. E. coli was highly resistant to quinolones like ciprofloxacin (in 66.4%), whereas K. pneumoniae was resistant in 42% of isolates. This finding is much lower than that observed by Moolchandani et al. in 201732.

Pseudomonas aeruginosa was resistant to carbapenem in 22% of isolates and was highly resistant to ceftazidime (in 81% of isolates) followed by gentamicin (57.5%), ciprofloxacin (22.5%) and amikacin (9.5%). resistance to many antibiotic among P. aeruginosa was reported in many studies4,34.

The high level of resistance in the current study can be attributed to the unrestricted use of antibiotics in Sudanese hospitals; this injudicious use has been shown to have, an important role in increasing carbapenem resistance32. During this study, 134 gram negative bacilli resistant to three or four classes of antibiotics were isolated over a period of six months, which is relatively higher rate than the rate reported in a previous study also conducted in SUH over 30 months, from January 2011 to June 201333. This concerning finding indicates the rapid acceleration in the rate of emergence of MDR organisms in our local sittings. Moreover, 80 bacterial strains were resistant to all available antibiotics, including meropenem.

In addition, microbiology laboratories play a crucial role against the spread of antimicrobial resistance by accurately identifying causative pathogens and detecting their antimicrobial susceptibility profile, so as to guide the proper use of antibiotics by the care providers. Unfortunately, in Sudan the lack of reliable microbiology laboratory services adds yet another layer to the multifactorial problem of MDR organisms’ epidemic in our country. Most of the laboratories in our country use the disk diffusion method for antimicrobial susceptibility testing; however, there are no policies regarding phenotypic screening for antibiotic resistance among certain organisms; resulting in that the laboratory report may not be accurate and misguide the doctors. For instance, in the disk diffusion method, if the inhibitory zone around ceftazidime was ≤22 mm, ideally this should trigger testing for the presence of ESBLs in the isolated pathogen, because the presence of these enzymes renders all penicillins, cephalosporins and monobactams12 useless against that certain isolate, even if they shows susceptible results in the routine test. Yet, this extra step is not taken and only the routine susceptibility results will be reported, which may inaccurately show some antibiotics as susceptible while in reality the organism is resistant to them. Lastly, there is a limited choice of available antibiotics in Sudan; the most widely available are cephalosporins, which makes them the backbone of treating infectious diseases regardless of the isolate or its susceptibility profile. Carbapenems are believed to treat all evils, once they were reserved for the treatment of MDR organisms causing systemic infections4, but the recent trend led to over use them for treating infections that can be managed by less potent antibiotics, contributing to this vicious cycle that aggravate the AMR issue even more.

Conclusion

In conclusion, there was a high prevalence of gram negative bacterial pathogen associated hospital and community acquired infections, with increasing rates of resistance to available antibiotics. Strict infection control measures should be implemented, and antimicrobial stewardship should be initiated and policed to decrease the spread of MDR pathogens in Sudanese hospitals.

Data availability

Raw data for the present study, including the genotypes, isolation location and resistance status of each bacterial isolate, is available of figshare. DOI: https://doi.org/10.6084/m9.figshare.758444935.

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 05 Feb 2019
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Elbadawi HS, Elhag KM, Mahgoub E et al. Antimicrobial resistance surveillance among gram-negative bacterial isolates from patients in hospitals in Khartoum State, Sudan [version 1; peer review: 3 approved with reservations]. F1000Research 2019, 8:156 (https://doi.org/10.12688/f1000research.17744.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 05 Feb 2019
Views
9
Cite
Reviewer Report 17 Jun 2021
Roberto G Melano, Public Health Ontario Laboratory, University of Toronto, Toronto, Ontario, Canada 
Approved with Reservations
VIEWS 9
In Methods, I suggest this modification for the very long (and unclear) sentence:
"Guanidine chloride method, as described by Alsadig et al.9, was used for DNA extraction followed by PCR. Species-specific primers (Macrogen, Korea) were used for identification of ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Melano RG. Reviewer Report For: Antimicrobial resistance surveillance among gram-negative bacterial isolates from patients in hospitals in Khartoum State, Sudan [version 1; peer review: 3 approved with reservations]. F1000Research 2019, 8:156 (https://doi.org/10.5256/f1000research.19402.r86820)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
16
Cite
Reviewer Report 14 Jun 2021
Rayane Rafei, Laboratoire Microbiologie Santé et Environnement (LMSE), Doctoral School of Science & Technology, Faculty of Public Health, Lebanese University, Tripoli, Lebanon 
Approved with Reservations
VIEWS 16
This manuscript presents the surveillance data of antimicrobial resistance patterns of Gram-negative bacteria from patients in Khartoum State, Sudan. Such data are highly valuable from underrepresented regions. Nevertheless, this manuscript contains several flaws that must be addressed before acceptance.
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Rafei R. Reviewer Report For: Antimicrobial resistance surveillance among gram-negative bacterial isolates from patients in hospitals in Khartoum State, Sudan [version 1; peer review: 3 approved with reservations]. F1000Research 2019, 8:156 (https://doi.org/10.5256/f1000research.19402.r86818)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
15
Cite
Reviewer Report 04 May 2021
Robby Markwart, Infectious Disease Epidemiology, Robert Koch Institute, Jena University Hospital, Nordufer, Berlin, 13353, Germany;  Jena University Hospital, Institute of General Practice and Family Medicine, Jena, Germany 
Approved with Reservations
VIEWS 15
The study Antimicrobial resistance surveillance among gram-negative bacterial isolates from patients in hospitals in Khartoum State, Sudan by Hana Salaheldin Elbadawi et al. investigates the spectrum of gram-negative bacterial pathogens and antimicrobial resistance patterns in Khartoum State, Sudan.

... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Markwart R. Reviewer Report For: Antimicrobial resistance surveillance among gram-negative bacterial isolates from patients in hospitals in Khartoum State, Sudan [version 1; peer review: 3 approved with reservations]. F1000Research 2019, 8:156 (https://doi.org/10.5256/f1000research.19402.r84294)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 05 Feb 2019
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.