Sequencing data from Massachusetts General Hospital shows Cas9 integration into the genome, highlighting a serious hazard in gene-editing therapeutics

Introduction

Nuclease based gene-editing techniques (Cas9/ZFN/TALEN - CaZiTa) introduce a double stranded break at a specified location with the guide of DNA-binding proteins (ZFN/TALEN) or RNA (CRISPR)¹. Delivery within cells is a critical step for such gene-therapies². The ability of recombinant adeno-associated virus (rAAV) to enter cells makes it a perfect choice as a vector for gene therapy³. A plasmid comprising the rAAV, CaZiTa, guide RNAs (for CRISPR), etc. is expected to enter the cell, edit, and remain episomal⁴. However, the rather obvious danger of integration of the plasmid into the genome is ignored. A recent pre-print⁵ has highlighted that bacterial genes from the template plasmid (pCR2.1-TOPO) has integrated into bovine genomes⁶.

Recently, Massachusetts General Hospital published data on CRISPR edits (Accid:PRJNA563918), and concluded that ‘AAV integration should be recognised as a common outcome for applications that utilize AAV for genome editing’⁷. However, there was no report of Cas9 integration. Here, data showing Cas9 integrating in the exact edit sites is shown. The same caveat applies to all three CaZiTa gene-therapies¹.

Methods

Sequencing data was obtained from BioProject accession number, PRJNA563918, using SRA download tools (https://github.com/ncbi/sra-tools/wiki). This project aims at finding “the genomic consequences of transduction with AAV vectors encoding CRISPR-Cas nucleases”⁷.

The reads were uniquified, split into open-reading frames using the getorf (version:6.6.0.0) program from the EMBOSS suite (http://emboss.sourceforge.net/download/)⁸.

Command: “getorf -find 1 -sequence <infile> -outseq <output> -minsize 10”.

Exact 10-kmer were aligned to the Cas9 protein (Accid:AGZ01981.1, 1417aa). Subsequently, these reads were then aligned to the gene of interest - TMC1(Accid:NG_008213.1) or DMD(Accid:NM_001314034.1). The online BLAST interface using the default settings (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to generate images of integration with the genes of interest⁹. The number of reads with integration is conservative, since reads with less than a 10-kmer match were ignored. The AAV genome used was Accid:MK163936.1. Sequences that integrate Cas9/AAV with TMC1 and DMD are provided in Extended data: TMC1.cas9.fa/TMC1.aav.fa and DMD.cas9.fa/DMD.aav.fa, respectively.

Results and discussion

Cas9 integration in transmembrane channel like 1 (TMC1)

TMC1, a transmembrane protein, is required for proper functioning of cochlear hair cells, and has been implicated in hearing loss and prelingual deafness¹⁰. In mice, this gene is located in chr19 (Accid:NG_008213.1)). Table 1 lists the samples sequenced for targeting this gene. As expected, the non-injected controls have no Cas9 reads. The sample SRR10068671 (marked with triple asterisks) has probably been mis-annotated as one with “no gRNA”, since Cas9 integrations are detected in that sample. From the Cas9 integration site, the guide RNA (gRNA) for the TMC1 gene can be deduced to be “CATGGTAATGTCCCTCCTGGGGA”, although this information is not yet available. The sequences for these reads are provided as extended data. As a specific example, the sequence (SRR10068639.63180.1) encodes the 26aa peptide=SPEKLLMYHHDPQTYQKLKLIMEQYG from Cas9 and is merged with the TMC1 gene (Figure 1).

Table 1. Integration of Cas9 into the edited gene.

The paired reads are clubbed into a single file, and then uniquified. Open reading frames from these are then matched to Cas9 proteins for 10 aa, and subsequently these reads are matched to the gene of interest (TMC1 or DMD), helping identify the exact edit site. The sample SRR10068671 (marked with triple asterisks) has probably been mis-annotated as one with “no gRNA”, since Cas9 integrations are detected in that sample. These integrations happen both for SpCas9 and SaCas9. From the Cas9 integration site, the gRNA for the TMC1 gene can be deduced to be “CATGGTAATGTCCCTCCTGGGGA”, although this information is not yet available. CN, cortical neuron; CA: cochlea, adult.

Gene	Accid	Description	NREADS	NUNIQ	NCas9	NTarget
	SRR10068641	In vivo CA non injected control	140156	12184	0	0
	SRR10068642	In vivo CA non injected control	160880	9511	0	0
	SRR10068670	CN neonatal no gRNA	164390	7079	0	0
***	SRR10068671	CN neonatal no gRNA	259600	10794	10	10
	SRR10068648	CN neonatal 2	243658	16919	90	77
TMC1	SRR10068659	CN neonatal 1	220840	14033	108	98
	SRR10068666	CN neonatal 2	230024	20975	772	682
	SRR10068667	CN neonatal 1	208190	17984	598	546
	SRR10068636	In vivo CA 4	187904	16498	0	0
	SRR10068638	In vivo CA 3	117948	7866	2	1
	SRR10068639	In vivo CA 2	222014	15268	10	8
	SRR10068640	In vivo CA 1	136336	9321	4	2
	SRR10068621	In vivo exon 53	324432	13477	2	2
	SRR10068622	In vivo exon 53	285824	12335	7	5
	SRR10068623	In vivo intron51-53	382044	18977	312	238
	SRR10068624	In vivo intron51-53	370728	19900	286	238
	SRR10068625	In vivo intron 53	289852	10673	6	6
DMD	SRR10068627	In vivo intron 53	253460	9596	14	12
SpCas9	SRR10068628	In vivo intron 51	388128	16116	4	3
	SRR10068629	In vivo intron 51	267736	10710	7	6
	SRR10068630	In vivo intron51-53	336368	12750	48	5
	SRR10068631	In vivo intron51-53	472724	20169	48	4
DMD	SRR10068632	In vivo intron 53	221456	7786	0	0
SaCas9	SRR10068633	In vivo intron 53	237768	8136	0	0
	SRR10068634	In vivo intron 51	428600	17698	0	0

Figure 1. Specific example of a sequence in the TMC1 gene which has Cas9 integrated.

The sequence (SRR10068639.63180.1) encodes the 26aa peptide=SPEKLLMYHHDPQTYQKLKLIMEQYG from Cas9 and is merged with the TMC1 gene.

Cas9 integration in dystrophin

Duchenne muscular dystrophy (DMD), a genetic disorder associated with progressive muscle degeneration (dystrophy), is caused by aberrations in the dystrophin protein, located on chromosome X in humans and mice¹¹. According to the data (Accid:PRJNA563918), different exons and introns have been targeted using two different variations of the Cas9 - SpCas9 and SaCas9 - which differ in certain characteristics¹². SaCas9 does seem empirically to have more samples without any integration, but that might just be random. The sequences for these reads are provided as extended data. As a specific example, the sequence (SRR10068622.33932.1) encodes the 12aa peptide=LDATLIHQSITG from Cas9 and is merged with the DMD gene (Figure 2).

Figure 2. Specific example of a sequence in the DMD gene which has Cas9 integrated.

The sequence (SRR10068622.33932.1) encodes the 12aa peptide=LDATLIHQSITG from Cas9 and is merged with the DMD gene.

Conclusions

Gene-editing based therapies provide revolutionary hope for curing many diseases. However, ensuring safety of any such endeavours must be paramount to avoid doing more harm^13,14. Plasmid integration is one such potential hazard⁵. Recently, Massachusetts General Hospital reported high-levels of in vivo AAV into the genome while providing sequencing data (Accid:PRJNA563918), and concluded that ‘AAV integration should be recognized as a common outcome for applications that utilize AAV for genome editing’⁷. In this study, in addition to AAV, Cas9 integration is shown in the same samples. The same caveat applies to gene-therapies using CaZiTa¹. Off-target edits (OTE) are an important aspect of CRISPR-cas gene-editing^15–19. Such integrations, found by targeting amplicon sequencing, will only get worse due to OTEs, which are hard to detect^20–22. Another problem is pre-existing immunity to Cas9 proteins^23,24. This problem can be mitigated by sending the CaZiTa as protein²⁵, but that would seriously restrict the use-cases, and also suffer from OTEs, large deletions, complex rearrangements and translocations²⁶, or even including fragments from exosomes²⁷. This is an important distinction between AAV and CaZiTa integration, since AAV integration can be tolerated (integration at chromosome breakage points²⁸, though there is debate on its role in hepatocellular carcinoma^29,30), Cas9 integration is a huge, and unacceptable danger. After integration, individuals may be expressing Cas9, and that is fraught with genotoxic danger.

Data availability