ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Brief Report

Sequencing data from Massachusetts General Hospital shows Cas9 integration into the genome, highlighting a serious hazard in gene-editing therapeutics

[version 1; peer review: 2 approved with reservations]
PUBLISHED 04 Nov 2019
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

The ability to edit a specific gene within our genomes using guided-nucleases (Cas9/ZFN/TALEN - CaZiTa) presents huge opportunities for curing many genetic disorders. Delivery of this ‘drug’ within cells is a critical step for such therapies. The ability of recombinant adeno-associated virus (rAAV) to enter cells makes it a perfect choice as a vector for gene therapy. A plasmid comprising the rAAV, the CaZiTa, guide RNAs (for CRISPR) is expected to enter the cell, edit the target gene(s), remain episomal, and thus fade away with time. However, the rather obvious danger of integration of the plasmid into the genome, if the episomal hypothesis is incorrect, is under-reported. A recent report has highlighted that bacterial genes from a plasmid were integrated into bovine genomes. Massachusetts General Hospital has recently published data on CRISPR edits (Accid:PRJNA563918), noting ‘high levels of AAV integration (up to 47%) into Cas9-induced double-strand breaks’. However, there is no mention of Cas9 integration. Here, the same data from Massachusetts General Hospital shows Cas9 integration in the exact edit sites provided for two genes - TMC1 and DMD. Also, there is a mis-annotation of one sample as ‘no gRNA’, since Cas9 integrations have been detected in that sample. This is an important distinction between AAV and CaZiTa integration: while AAV integration can be tolerated, Cas9 integration is a huge, and unacceptable, danger.

Keywords

Gene-editing , CRISPR-Cas, AAV, plasmid integration

Introduction

Nuclease based gene-editing techniques (Cas9/ZFN/TALEN - CaZiTa) introduce a double stranded break at a specified location with the guide of DNA-binding proteins (ZFN/TALEN) or RNA (CRISPR)1. Delivery within cells is a critical step for such gene-therapies2. The ability of recombinant adeno-associated virus (rAAV) to enter cells makes it a perfect choice as a vector for gene therapy3. A plasmid comprising the rAAV, CaZiTa, guide RNAs (for CRISPR), etc. is expected to enter the cell, edit, and remain episomal4. However, the rather obvious danger of integration of the plasmid into the genome is ignored. A recent pre-print5 has highlighted that bacterial genes from the template plasmid (pCR2.1-TOPO) has integrated into bovine genomes6.

Recently, Massachusetts General Hospital published data on CRISPR edits (Accid:PRJNA563918), and concluded that ‘AAV integration should be recognised as a common outcome for applications that utilize AAV for genome editing’7. However, there was no report of Cas9 integration. Here, data showing Cas9 integrating in the exact edit sites is shown. The same caveat applies to all three CaZiTa gene-therapies1.

Methods

Sequencing data was obtained from BioProject accession number, PRJNA563918, using SRA download tools (https://github.com/ncbi/sra-tools/wiki). This project aims at finding “the genomic consequences of transduction with AAV vectors encoding CRISPR-Cas nucleases”7.

The reads were uniquified, split into open-reading frames using the getorf (version:6.6.0.0) program from the EMBOSS suite (http://emboss.sourceforge.net/download/)8.

Command: “getorf -find 1 -sequence <infile> -outseq <output> -minsize 10”.

Exact 10-kmer were aligned to the Cas9 protein (Accid:AGZ01981.1, 1417aa). Subsequently, these reads were then aligned to the gene of interest - TMC1(Accid:NG_008213.1) or DMD(Accid:NM_001314034.1). The online BLAST interface using the default settings (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to generate images of integration with the genes of interest9. The number of reads with integration is conservative, since reads with less than a 10-kmer match were ignored. The AAV genome used was Accid:MK163936.1. Sequences that integrate Cas9/AAV with TMC1 and DMD are provided in Extended data: TMC1.cas9.fa/TMC1.aav.fa and DMD.cas9.fa/DMD.aav.fa, respectively.

Results and discussion

Cas9 integration in transmembrane channel like 1 (TMC1)

TMC1, a transmembrane protein, is required for proper functioning of cochlear hair cells, and has been implicated in hearing loss and prelingual deafness10. In mice, this gene is located in chr19 (Accid:NG_008213.1)). Table 1 lists the samples sequenced for targeting this gene. As expected, the non-injected controls have no Cas9 reads. The sample SRR10068671 (marked with triple asterisks) has probably been mis-annotated as one with “no gRNA”, since Cas9 integrations are detected in that sample. From the Cas9 integration site, the guide RNA (gRNA) for the TMC1 gene can be deduced to be “CATGGTAATGTCCCTCCTGGGGA”, although this information is not yet available. The sequences for these reads are provided as extended data. As a specific example, the sequence (SRR10068639.63180.1) encodes the 26aa peptide=SPEKLLMYHHDPQTYQKLKLIMEQYG from Cas9 and is merged with the TMC1 gene (Figure 1).

Table 1. Integration of Cas9 into the edited gene.

The paired reads are clubbed into a single file, and then uniquified. Open reading frames from these are then matched to Cas9 proteins for 10 aa, and subsequently these reads are matched to the gene of interest (TMC1 or DMD), helping identify the exact edit site. The sample SRR10068671 (marked with triple asterisks) has probably been mis-annotated as one with “no gRNA”, since Cas9 integrations are detected in that sample. These integrations happen both for SpCas9 and SaCas9. From the Cas9 integration site, the gRNA for the TMC1 gene can be deduced to be “CATGGTAATGTCCCTCCTGGGGA”, although this information is not yet available. CN, cortical neuron; CA: cochlea, adult.

Gene AccidDescriptionNREADS NUNIQNCas9NTarget
SRR10068641In vivo CA non injected control1401561218400
SRR10068642In vivo CA non injected control160880951100
SRR10068670CN neonatal no gRNA164390707900
***SRR10068671CN neonatal no gRNA259600107941010
SRR10068648CN neonatal 2243658169199077
TMC1SRR10068659CN neonatal 12208401403310898
SRR10068666CN neonatal 223002420975772682
SRR10068667CN neonatal 120819017984598546
SRR10068636In vivo CA 41879041649800
SRR10068638In vivo CA 3117948786621
SRR10068639In vivo CA 222201415268108
SRR10068640In vivo CA 1136336932142
SRR10068621In vivo exon 533244321347722
SRR10068622In vivo exon 532858241233575
SRR10068623In vivo intron51-5338204418977312238
SRR10068624In vivo intron51-5337072819900286238
SRR10068625In vivo intron 532898521067366
DMDSRR10068627In vivo intron 5325346095961412
SpCas9SRR10068628In vivo intron 513881281611643
SRR10068629In vivo intron 512677361071076
SRR10068630In vivo intron51-5333636812750485
SRR10068631In vivo intron51-5347272420169484
DMDSRR10068632In vivo intron 53221456778600
SaCas9SRR10068633In vivo intron 53237768813600
SRR10068634In vivo intron 514286001769800
24ed758b-29da-482f-9b7e-d918b81cc34e_figure1.gif

Figure 1. Specific example of a sequence in the TMC1 gene which has Cas9 integrated.

The sequence (SRR10068639.63180.1) encodes the 26aa peptide=SPEKLLMYHHDPQTYQKLKLIMEQYG from Cas9 and is merged with the TMC1 gene.

Cas9 integration in dystrophin

Duchenne muscular dystrophy (DMD), a genetic disorder associated with progressive muscle degeneration (dystrophy), is caused by aberrations in the dystrophin protein, located on chromosome X in humans and mice11. According to the data (Accid:PRJNA563918), different exons and introns have been targeted using two different variations of the Cas9 - SpCas9 and SaCas9 - which differ in certain characteristics12. SaCas9 does seem empirically to have more samples without any integration, but that might just be random. The sequences for these reads are provided as extended data. As a specific example, the sequence (SRR10068622.33932.1) encodes the 12aa peptide=LDATLIHQSITG from Cas9 and is merged with the DMD gene (Figure 2).

24ed758b-29da-482f-9b7e-d918b81cc34e_figure2.gif

Figure 2. Specific example of a sequence in the DMD gene which has Cas9 integrated.

The sequence (SRR10068622.33932.1) encodes the 12aa peptide=LDATLIHQSITG from Cas9 and is merged with the DMD gene.

AAV integration in TMC1 and DMD

The integration of AAV into the genome has already been noted7. This has been replicated in this study as well. The AAV genome used was Accid:MK163936.1. The reads can be found in Extended data: TMC1.aav.fa (N=5000) and DMD.aav.fa (N=14000).

Conclusions

Gene-editing based therapies provide revolutionary hope for curing many diseases. However, ensuring safety of any such endeavours must be paramount to avoid doing more harm13,14. Plasmid integration is one such potential hazard5. Recently, Massachusetts General Hospital reported high-levels of in vivo AAV into the genome while providing sequencing data (Accid:PRJNA563918), and concluded that ‘AAV integration should be recognized as a common outcome for applications that utilize AAV for genome editing’7. In this study, in addition to AAV, Cas9 integration is shown in the same samples. The same caveat applies to gene-therapies using CaZiTa1. Off-target edits (OTE) are an important aspect of CRISPR-cas gene-editing1519. Such integrations, found by targeting amplicon sequencing, will only get worse due to OTEs, which are hard to detect2022. Another problem is pre-existing immunity to Cas9 proteins23,24. This problem can be mitigated by sending the CaZiTa as protein25, but that would seriously restrict the use-cases, and also suffer from OTEs, large deletions, complex rearrangements and translocations26, or even including fragments from exosomes27. This is an important distinction between AAV and CaZiTa integration, since AAV integration can be tolerated (integration at chromosome breakage points28, though there is debate on its role in hepatocellular carcinoma29,30), Cas9 integration is a huge, and unacceptable danger. After integration, individuals may be expressing Cas9, and that is fraught with genotoxic danger.

Data availability

Underlying data

Raw sequence reads from Massachusetts General Hospital, Accession number PRJNA563918, https://www.ncbi.nlm.nih.gov/bioproject/PRJNA563918/

Extended data

Zenodo: Sequencing data from Massachusetts General Hospital shows Cas9 integration into the genome, highlighting a serious hazard in gene-editing therapeutics, https://doi.org/10.5281/zenodo.346030531

This project contains the following extended data:

  • DMD.aav.fa

  • DMD.cas9.fa

  • TMC1.aav.fa

  • TMC1.cas9.fa

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 04 Nov 2019
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Chakraborty S. Sequencing data from Massachusetts General Hospital shows Cas9 integration into the genome, highlighting a serious hazard in gene-editing therapeutics [version 1; peer review: 2 approved with reservations]. F1000Research 2019, 8:1846 (https://doi.org/10.12688/f1000research.20744.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 04 Nov 2019
Views
11
Cite
Reviewer Report 14 Apr 2023
Saravanabhavan Thangavel, Centre for stem cell research (CSCR), a unit of inStem Bengaluru, Christian Medical College Vellore Association, Vellore, Tamil Nadu, India 
Approved with Reservations
VIEWS 11
Recombinant adeno-associated virus (rAAV) is one of the tools to deliver Crispr CAS9 into the target cells. The author uses the publicly available dataset containing rAAV delivered Cas9 edited cells to analyse the genomic regions around the cutsite. While it ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Thangavel S. Reviewer Report For: Sequencing data from Massachusetts General Hospital shows Cas9 integration into the genome, highlighting a serious hazard in gene-editing therapeutics [version 1; peer review: 2 approved with reservations]. F1000Research 2019, 8:1846 (https://doi.org/10.5256/f1000research.22812.r167874)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
54
Cite
Reviewer Report 06 Feb 2020
Rakesh Chatrikhi, Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA 
Approved with Reservations
VIEWS 54
Chakraborty studied sequencing data on CRISPR-induced DNA edits from Massachusetts General Hospital to show Cas9 integration into the genome. The author analyzed previously published data on CRISPR-induced DNA edits to highlight integration of Cas9 into the genome, which was not ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Chatrikhi R. Reviewer Report For: Sequencing data from Massachusetts General Hospital shows Cas9 integration into the genome, highlighting a serious hazard in gene-editing therapeutics [version 1; peer review: 2 approved with reservations]. F1000Research 2019, 8:1846 (https://doi.org/10.5256/f1000research.22812.r59005)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 04 Nov 2019
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.