Identification of <i>Mycoplasma genitalium</i> from clinical swabs by direct PCR

Robinson M. Irekwa; Perpetual Ndung'u; Peter Kipkemboi; Tonny Teya; Anne Wanjiru Mwangi; Matthew Mutinda; Caroline Njoroge; Joanne Yego; Irumva Vanessa; Samson Muuo Nzou

doi:10.12688/f1000research.21218.1

Home Browse Identification of Mycoplasma genitalium from clinical swabs by direct...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Brief Report

Identification of Mycoplasma genitalium from clinical swabs by direct PCR

[version 1; peer review: 1 approved, 1 approved with reservations]

Robinson M. Irekwa ¹, Perpetual Ndung'u², Peter Kipkemboi³, [...] Tonny Teya³, Anne Wanjiru Mwangi^3,4, Matthew Mutinda³, Caroline Njoroge³, Joanne Yego³, Irumva Vanessa¹, Samson Muuo Nzou^3,5

Robinson M. Irekwa ¹, Perpetual Ndung'u², [...] Peter Kipkemboi³, Tonny Teya³, Anne Wanjiru Mwangi^3,4, Matthew Mutinda³, Caroline Njoroge³, Joanne Yego³, Irumva Vanessa¹, Samson Muuo Nzou^3,5

PUBLISHED 26 Nov 2019

Author details Author details

¹ Department of Molecular Biology and Biotechnology, Pan Africa University Institute of Basic Sciences, Technology and Innovation (PAUSTI-JKUAT), Juja, Kiambu, Kenya
² Department of Parasitology, Jomo Kenyatta University of Agriculture and Technology, Juja, Kiambu, Kenya
³ NUITM, Nairobi, Kenya
⁴ Production Department, Kenya Medical Research Institute (KEMRI), Nairobi, Kenya
⁵ Institute of Tropical Medicine and Global Health, Nagasaki University, Nagasaki, Japan

Robinson M. Irekwa
Roles: Conceptualization, Methodology

Perpetual Ndung'u
Roles: Supervision

Peter Kipkemboi
Roles: Methodology

Tonny Teya
Roles: Investigation

Anne Wanjiru Mwangi
Roles: Investigation

Matthew Mutinda
Roles: Investigation

Caroline Njoroge
Roles: Investigation

Joanne Yego
Roles: Investigation

Irumva Vanessa
Roles: Investigation

Samson Muuo Nzou
Roles: Conceptualization, Supervision

OPEN PEER REVIEW

REVIEWER STATUS

Abstract

Mycoplasma genitalium is one of the smallest self-replicating organisms. It is an obligate parasite found in the human genital tract. In men, the bacteria cause both acute and chronic non-gonococcal urethritis (NGU). In women, it has been associated with pelvic inflammatory disease and cervicitis among other related infections. Treatment of M. genitalium related infections has been effective using antibiotics such as the macrolides (e.g. azithromycin) and fluoroquinolones. However, there have been recorded cases of resistance to these antibiotics in various parts of the world as a result of a mutation in the 23SrRNA gene, although the antibiotic resistance has not been well established. The aim of this study was to detect M. genitalium in 352 swab samples collected from a clinic for sex workers in Nairobi, Kenya. DNA was extracted from the swabs and stored as a crude extract at -31°C. The swab lysates were subjected to direct polymerase chain reaction using primers that specifically target the 16S rRNA gene for M. genitalium. A total of 29 samples tested positive for M. genitalium. The data results showed a M. genitalium prevalence of 8.24% among sex workers in Nairobi, Kenya.

Keywords

Direct PCR, Mycoplasma genitalium

Corresponding author: Robinson M. Irekwa

Competing interests: No competing interests were disclosed.

Grant information: This project was funded by the Pan Africa University Institute of Basic Sciences, Technology and Innovation hosted at the Jomo Kenyatta University of Agriculture and Technology (PAUSTI-JKUAT) and Nagasaki University Institute of Tropical Medicine-Kenya Medical Research Institute project (NUITM-KEMRI).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2019 Irekwa RM et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Irekwa RM, Ndung'u P, Kipkemboi P et al. Identification of Mycoplasma genitalium from clinical swabs by direct PCR [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2019, 8:1993 (https://doi.org/10.12688/f1000research.21218.1) First published: 26 Nov 2019, 8:1993 (https://doi.org/10.12688/f1000research.21218.1) Latest published: 26 Nov 2019, 8:1993 (https://doi.org/10.12688/f1000research.21218.1)

Introduction

Mycoplasma genitalium is an emerging sexually transmitted disease that was first identified and isolated in 1980¹ from men with non-gonococcal urethritis (NGU). Its epidemiology in connection to other STI syndromes been established since nucleic acid amplification assay development in the early 1990s². The bacteria have been detected in substantial amounts from men with urethritis and women with cervicitis³. M. genitalium prevalence in the general population has been studied and found to be ranging between 1–3%⁴.

M. genitalium is found in roughly 15% of men with NGU and in 22% of men with non-chlamydial NGU. However, the associated infections do not have unique clinical symptoms, making it difficult to use clinical signs as a mode of identification⁵. Cervicitis has been described as the female version of male urethritis. M. genitalium is found in 10% of women with cervicitis⁶. Chlamydial coinfections in women with cervicitis are also common in some settings⁷. M. genitalium is a very fastidious bacterium and culturing of the bacterium is exhaustive and time consuming.

The introduction of polymerase chain reaction (PCR) assays has provided the necessary data for its clinical prevalence⁸. Many assays have been developed for the detection of M. genitalium in human specimens^8–17. Most of these assays are mainly based on the PCR detection technique. Use of these PCR tests have shown that the disease spectrum is similar to those caused by Chlamydia trachomatis and Neisseria gonorrhoeae in both males and females¹³. However, these assays differ in their target DNA sequences, specimen preparation and amplicon detection methods. Many of these detection methods target the 16S rRNA and the MgPa protein genes. Conventional and, more recently, real-time PCR assays have been applied. Most of the detection studies have been conducted in the U.S.A, Europe and Australia, with various strains being discovered. In line with the detection of the bacterial species and its related infections in Africa, more studies need to be conducted on possible strains and their epidemiology. Whether the bacteria have links with other sexually transmitted infections can also be investigated. In this study, it is shown that direct PCR can be applied to the detection of M. genitalium from crude DNA extracts. M. genitalium prevalence and characteristics among female sex workers have been studied in Kenya and Uganda^18–21. Its prevalence has also been studied among males who underwent circumcision in order to prevent HIV acquisition in Kisumu, Kenya²². However, most of these studies have focused on conventional, real-time PCR or transcription-mediated amplification assays for the detection of M. genitalium. This study reports the use of direct PCR for M. genitalium detection from crude DNA extracts using specific primers that target the 16S rRNA gene.

Methods

Ethical statement

This study was approved by the Jomo Kenyatta University of Agriculture and Technology Institutional Ethics Review Committee (JKUAT-IERC): reference number JKU/2/4/896B. The swab samples were collected with written informed consent for the performance of further analysis.

Source of samples

The samples used in this study were collected as part of the sex workers outreach program (SWOP) central business district clinic in Nairobi, Kenya. As part of this program, patients who showed STI symptoms and consented to the study were sampled by taking vaginal swabs. The specimens were then put into sterile containers and transported to the Pan Africa Hub Laboratory (NUITM-KEMRI) within an hour and stored at -80°C. Anonymized samples were retrieved for use in this study.

Sample preparation

The 352 swab lysates were prepared using the MightyPrep reagent for DNA (TAKARA BIO INC, Kusatsu, Shiga Prefecture, Japan; Cat No: 9182) using the manufacturer’s protocol with a slight modification. Swabs were cut and put into 1.5ml Eppendorf tubes. A total of 200uL of the MightyPrep reagent was added to the tubes and later centrifuged at 15krpm for one minute. The tubes were then transferred to a heated block at 95°C with shaking at 800rpm for 15 minutes. Later, the tubes were cooled down by lowering the heat block temperature to 25°C, followed by hard vortexing of each tube for one minute and, finally, centrifugation at 15krpm for two minutes before storage at -31°C.

Direct PCR

The master mix was prepared using the manufacturer’s protocol with slight modifications (Hotstar Taq^® Master Mix Kit 2.5 Units, Qiagen; Cat No: 203443). 100μM primer concentration was achieved by adding 303μl and 353μl of Tris EDTA (Nippon Gene Company Ltd, Japan, Cat No: 314-90021; 10mM Tris-HCl [pH 8.0], 1mM EDTA [pH 8.0]) to the forward and reverse primers (Table 1; Sigma-Aldrich, Darmstadt, Germany), respectively. The primers (Table 1) targeted the 16S rRNA gene²³ giving 433bp amplicon size fragments. Master mix components were: RNase- free water (1x = 7.84μl); primer mix (1x = 0.08μl, 0.2μM of each primer); and HotStar Taq^® master mix (2x), comprised of 2.5 units HotStarTaq DNA polymerase (1x = 10μl),1x PCR buffer (1x, contains 1.5mM MgCl₂) and 200μM of each dNTP.

Table 1. Primer sequences.

Forward primer	Reverse primer
MG16-45F (TACATGCAAGTCGATCGGAAGTAGC)	MG16-447R (AAACTCCAGCCATTGCCTGCTAG-3’)

After vortexing the master mix for five seconds, 18μl was aliquoted to each of the labeled 96 PCR tubes. 2μl of the swab lysates was added to each tube to make a final reaction volume of 20μl and the tubes were finger tapped for five seconds to mix the contents. A positive control (M. genitalium positive sample) and negative control (PCR water) were used. The PCR tubes were placed in the SimpliAmp^™ Thermal Cycler (Applied Biosystems) and run under the following reaction conditions.

An initial antibody inactivation step was carried at 95°C for 15 minutes, followed by 35 cycles of: denaturation at 94°C for 60 seconds, annealing at 67°C for 60 seconds and extension at 72°C for 60 seconds. A final extension step was carried out at 72°C for 10 minutes, followed by the final hold at 4°C for ∞.

Agarose gel electrophoresis

The PCR products were subjected to gel electrophoresis using 2.5% agarose gel SeaKem^® GTG^® agarose (Lonza, Rockland, ME, USA; Cat No: 50074) at 100V for 45 minutes. 6x loading dye (Nippon Gene; Cat No: 314-90261) was diluted with sample to make 1x and loaded onto the gel. The 100bp GelPilot^® Ladder marker (Qiagen; Cat No: 239035) was used. The gels were stained with 2x GelRed™ Nucleic Acid Gel Stain (Biotium; Cat No: 41003) for one hour on a shaker. The image was viewed using the UltraSlim UV Transilluminator (Maestrogen).

Amplification of the PCR products

The PCR products were subjected to another PCR. Master mix components were as described above. 18μl was aliquoted into the PCR tubes. 1μl of the sample products was added to the tubes to make a 19 μl final volume. The PCR tubes were placed in the SimpliAmp™ Thermal Cycler (Applied Biosystems) and run under the following reaction conditions.

An initial antibody inactivation step was carried out at 95°C for 15 minutes, followed by 30 cycles of: denaturation at 94°C for 60 seconds, annealing at 69°C for 60 seconds and extension at 72°C for 60 seconds. A final extension step was carried out at 72°C for 10 minutes, followed by the final hold at 4°C for ∞.

The products were run on a 2.0% agarose gel at 100V for 40 minutes. A 3000bp ladder (Solis BioDyne, Tartu, Estonia) was used. The gels were stained using 2x GelRed for one hour and viewed under an UltraSlim UV Transilluminator.

Results

A total of 352 lysates were analyzed in this study. The results show evidence for the presence of M. genitalium from swabs taken from the female sex workers who were sampled. 352 lysates were prepared using the MightyPrep reagent.

M. genitalium detection

M. genitalium was detected among the 352 swab lysates. Examples of M. genitalium detection are shown in Figure 3 to Figure 4. Figure 1 shows clear bands at positions 1, 2, 9, 10 and 17 on a 26-well agarose gel. The same kind of bands can be seen in Figure 2 at positions 9, 10, 11 and 18. The positive and negative controls are at positions 24 and 25, respectively, on each gel. A 600bp ladder was used at positions 1 and 26 to track the M. genitalium amplicon sizes of interest.

Figure 1. First representative gel for Mycoplasma genitalium detection using direct PCR.

Ultraviolet camera gel image showing 22 samples run on a 26-well gel. The ladder is at positions 1 and 26 (Gel Pilot^®). Clear Mycoplasma genitalium positive bands can be seen at positions 1, 2, 9, 10 and 17 (Sexually transmitted infection lysates S099, S100, S108, S109 and S116, respectively). The positive control (PC) and negative control (NC) are at positions 24 and 25, respectively.

Figure 2. Second representative gel for the detection of Mycoplasma genitalium using direct PCR.

UV camera gel image showing the 22 samples run on a 26-well gel. The first and last wells represent the ladder (GelPilot^®). Clear Mycoplasma genitalium positive bands can be seen at positions 9, 10, 11 and 18 (lysates S137, S138, S139 and S146, respectively). The positive control (PC) is shown at position 24 and the negative control (NC) at position 25.

Figure 3. First representative gel showing the amplification of the PCR products.

The selected PCR products were amplified: the above image shows the first nine PCR products run on a gel after the amplification was conducted. The ladder (Solis BioDyne) is at the first and last lanes. The positive control (PC) is at lane 11, while the negative control (NC) is at lane 12.

Figure 4. Second representative gel showing the amplification of the PCR products.

This gel shows PCR products of the samples that were selected for amplification. The first and last lane contain the ladder marker (Solis BioDyne), the PCR products run from lanes 2 to 10 and the positive control (PC) is at position 11, while the negative control (NC) is at position 12.

The PCR products were subjected to another amplification reaction. After the reaction, the products were run on a 13-well agarose gel. A 3000bp ladder was loaded on positions 1 and 13, with the positive and negative controls at positions 11 and 12, respectively, as can be seen in Figure 3 and Figure 4. Out of the 352 swab lysates used, 29 tested positive for M. genitalium.

M. genitalium prevalence

M. genitalium prevalence among the cohort of female sex workers was found to be at 8.24% (29/352), showing one out of eight patients had M. genitalium related infections.

Discussion

Recently, DNA amplification protocols using PCR have been employed in the detection of M. genitalium. To investigate the presence of M. genitalium from the clinical swab samples collected from a clinic for sex workers in Nairobi, Kenya, a direct PCR technique was used for the detection of M. genitalium. This technique involves the use of target-specific primers to select the DNA of interest from a crude extract. The study detected M. genitalium using primers that bind to the 16SrRNA gene from the crude DNA extract. Jensen and his colleagues²³ developed a wide range of primers that target the 16S rRNA gene, producing different amplicon sizes. A novel PCR was used²⁴ to detect M. genitalium using oligonucleotide primers that corresponded to sequences along its 16S rRNA gene.

The study was able to detect 29 M. genitalium positive samples out of the 352 lysates. However, the challenge experienced with this method was non-specific amplification, realized from the multiple fragments produced. A possible solution to this is in the use of more precise target-specific primers to prevent the amplification of genes with closely related sequences. Application of this method can be a remedy to the constant loss of DNA due to long extraction processes, at the same time maintaining its quality for further downstream analysis.

M. genitalium prevalence was shown to be at 8.24%. This shows that one out of every eight patients sampled was positive for M. genitalium related infections. Balkus and colleagues in 2018 were able to detect M. genitalium from 25 out of 221 (11.3%) women from Kenya and the US²⁵. Prevalence rates of 12.9%¹⁸ and 16%¹⁹ have also been reported among sex workers in Nairobi, Kenya. The prevalence obtained in this study therefore does not show any significant drop in M. genitalium infections. Despite better and improved access to healthcare, M. genitalium infections seem to continue to be a burden. Possible reasons might be due to having multiple sex partners²⁶ or antibiotic resistance to drugs of choice such as macrolides and fluoroquinolones^27,28

Overall, the prevalence results suggest that more measures need to be taken to control M. genitalium infections. Awareness campaigns need to be carried out to sensitize people on preventive measures rather than taking potential risks that may lead to exposure to the infection. Studies need to be done to investigate M. genitalium drug resistance. This will be helpful in informing policy and practice. As a result, screening can be done in patients to check for resistance before prescribing medication.

Data availability

Underlying data

Figshare: Detection of Mycoplasma genitalium using Direct PCR. https://doi.org/10.6084/m9.figshare.10282691.v1²⁹.

This project contains the following underlying data:

- Direct PCR 1.docx – Direct PCR 4.docx (lists of the samples tested for Mycoplasma genitalium in four sets of 88 samples)
- Exp 1 Gel 1.JPG - Exp 4 Gel 4.JPG (gel electrophoresis of PCR products; 100bp GelPilot^® Ladder marker [Qiagen] at positions 1 and 26, samples from positions 2 to 23, positive control at position 24 and negative control at position 25)
- Amplification Gel 1.JPG - Amplification Gel 3.JPG (gel electrophoresis of the amplified products; 100bp ladder [Solis BioDyne] at positions 1 and 13, samples from positions 2 to 10, positive control at position 11 and negative control at position 12)
- Amplification Gel 4.JPG (gel electrophoresis of the amplified products; 100bp ladder [Solis BioDyne] at positions 1 and 13, samples from positions 2 to 7, positions 8, 11 and 12 contain no samples [blanks], positive control at position 9 and negative control at position 10).

Data are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

Acknowledgements

The authors would like to thank the Nagasaki University Institute of Tropical Medicine in collaboration with the Kenya Medical Research Institute (NUITM-KEMRI), The Pan Africa University Institute of Science Technology and Innovation hosted at the Jomo Kenyatta University of Agriculture and Technology, Kenya (PAUSTI-JKUAT) for the research conceptualization and support.

Faculty Opinions recommended

References

1. Huengsberg M: Sexually Transmitted Diseases. 3rd ed. Ed King K Holmes, P Frederick Sparling, Per-Anders Mardh, Stanley M Lemon, Walter E Stamm, Peter Piot, Judith N Wasserheit. $170.50. New York: McGraw Hill, 1999. Sex Transm Infect. 2000; 76(6): 498. Publisher Full Text
2. Tully JG, Cole RM, Taylor-Robinson D, et al.: A Newly Discovered Mycoplasma In The Human Urogenital Tract. Lancet. 1981; 1(8233): 1288–91. PubMed Abstract | Publisher Full Text
3. Taylor-Robinson D, Jensen JS: Mycoplasma genitalium: from Chrysalis to Multicolored Butterfly. Clin Microbiol Rev. 2011; 24(3): 498–514. PubMed Abstract | Publisher Full Text | Free Full Text
4. Andersen B, Sokolowski I, Ostergaard L, et al.: Mycoplasma genitalium: prevalence and behavioural risk factors in the general population. Sex Transm Infect. 2007; 83(3): 237–41. PubMed Abstract | Publisher Full Text | Free Full Text
5. Wetmore CM, Manhart LE, Lowens MS, et al.: Ureaplasma urealyticum Is Associated With Nongonococcal Urethritis Among Men With Fewer Lifetime Sexual Partners: A Case-Control Study. J Infect Dis. 2011; 204(8): 1274–82. PubMed Abstract | Publisher Full Text | Free Full Text
6. Brunham RC, Paavonen J, Stevens CE, et al.: Mucopurulent cervicitis--the ignored counterpart in women of urethritis in men. N Engl J Med. 1984; 311(1): 1–6. PubMed Abstract | Publisher Full Text
7. Gaydos C, Maldeis NE, Hardick A, et al.: Mycoplasma genitalium as a Contributor to the Multiple Etiologies of Cervicitis in Women Attending Sexually Transmitted Disease Clinics. Sex Transm Dis. 2009; 36(10): 598–606. PubMed Abstract | Publisher Full Text | Free Full Text
8. Palmer HM, Gilroy CB, Furr PM, et al.: Development and evaluation of the polymerase chain reaction to detect Mycoplasma genitalium. FEMS Microbiol Lett. 1991; 61(2–3): 199–203. PubMed Abstract | Publisher Full Text
9. Wroblewski JK, Manhart LE, Dickey KA, et al.: Comparison of transcription-mediated amplification and PCR assay results for various genital specimen types for detection of Mycoplasma genitalium. J Clin Microbiol. 2006; 44(9): 3306–12. PubMed Abstract | Publisher Full Text | Free Full Text
10. Björnelius E, Lidbrink P, Jensen JS: Mycoplasma genitalium in non-gonococcal urethritis--a study in Swedish male STD patients. Int J STD AIDS. 2000; 11(5): 292–6. PubMed Abstract | Publisher Full Text
11. Deguchi T, Gilroy CB, Taylor-Robinson D: Comparison of two PCR-based assays for detecting Mycoplasma genitalium in clinical specimens. Eur J Clin Microbiol Infect Dis. 1995; 14(7): 629–31. PubMed Abstract | Publisher Full Text
12. Dutro SM, Hebb JK, Garin CA, et al.: Development and performance of a microwell-plate-based polymerase chain reaction assay for Mycoplasma genitalium. Sex Transm Dis. 2003; 30(10): 756–63. PubMed Abstract | Publisher Full Text
13. Jensen JS: Mycoplasma genitalium: the aetiological agent of urethritis and other sexually transmitted diseases. J Eur Acad Dermatol Venereol. 2004; 18(1): 1–11. PubMed Abstract | Publisher Full Text
14. Jensen JS, Uldum SA, Søndergård-Andersen J, et al.: Polymerase chain reaction for detection of Mycoplasma genitalium in clinical samples. J Clin Microbiol. 1991; 29(1): 46–50. PubMed Abstract | Free Full Text
15. Jurstrand M, Jensen JS, Fredlund H, et al.: Detection of Mycoplasma genitalium in urogenital specimens by real-time PCR and by conventional PCR assay. J Med Microbiol. 2005; 54(Pt 1): 23–9. PubMed Abstract | Publisher Full Text
16. Yoshida T, Deguchi T, Ito M, et al.: Quantitative detection of Mycoplasma genitalium from first-pass urine of men with urethritis and asymptomatic men by real-time PCR. J Clin Microbiol. 2002; 40(4): 1451–5. PubMed Abstract | Publisher Full Text | Free Full Text
17. Yoshida T, Maeda S, Deguchi T, et al.: Rapid Detection of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum, and Ureaplasma urealyticum Organisms in Genitourinary Samples by PCR-Microtiter Plate Hybridization Assay. J Clin Microbiol. 2003; 41(5): 1850–5. PubMed Abstract | Publisher Full Text | Free Full Text
18. Gomih-Alakija A, Ting J, Mugo N, et al.: Clinical characteristics associated with Mycoplasma genitalium among female sex workers in Nairobi, Kenya. J Clin Microbiol. 2014; 52(10): 3660–6. PubMed Abstract | Publisher Full Text | Free Full Text
19. Cohen CR, Nosek M, Meier A, et al.: Mycoplasma genitalium infection and persistence in a cohort of female sex workers in Nairobi, Kenya. Sex Transm Dis. 2007; 34(5): 274–9. PubMed Abstract
20. Vandepitte J, Muller E, Bukenya J, et al.: Prevalence and correlates of Mycoplasma genitalium infection among female sex workers in Kampala, Uganda. J Infect Dis. 2011; 205(2): 289–96. PubMed Abstract | Publisher Full Text
21. Vandepitte J, Weiss HA, Kyakuwa N, et al.: Natural history of Mycoplasma genitalium Infection in a Cohort of Female Sex Workers in Kampala, Uganda. Sex Transm Dis. 2013; 40(5): 422–7. PubMed Abstract | Publisher Full Text | Free Full Text
22. Mehta SD, Gaydos C, Maclean I, et al.: The effect of medical male circumcision on urogenital mycoplasma genitalium among men in kisumu, kenya. Sex Trans Dis. 2012; 39(4): 276–80. PubMed Abstract | Publisher Full Text | Free Full Text
23. Jensen JS, Borre MB, Dohn B: Detection of Mycoplasma genitalium by PCR Amplification of the 16S rRNA Gene. J Clin Microbiol. 2003; 41(1): 261–6. PubMed Abstract | Publisher Full Text | Free Full Text
24. Eastick K, Leeming JP, Caul EO, et al.: A novel polymerase chain reaction assay to detect Mycoplasma genitalium. Mol Pathol. 2003; 56(1): 25–8. PubMed Abstract | Publisher Full Text | Free Full Text
25. Balkus JE, Manhart LE, Jensen JS, et al.: Mycoplasma genitalium Infection in Kenyan and US Women. Sex Transm Dis. 2018; 45(8): 514–21. PubMed Abstract | Publisher Full Text | Free Full Text
26. Pepin J, Labbé AC, Khonde N, et al.: Mycoplasma genitalium: an organism commonly associated with cervicitis among West African sex workers. Sex Transm Infect. 2005; 81(1): 67–72. PubMed Abstract | Publisher Full Text | Free Full Text
27. Anderson T, Coughlan E, Werno A: Mycoplasma genitalium Macrolide and Fluoroquinolone Resistance Detection and Clinical Implications in a Selected Cohort in New Zealand. J Clin Microbiol. 2017; 55(11): 3242–3248. PubMed Abstract | Publisher Full Text | Free Full Text
28. Tagg K, Jeoffreys N, Couldwell DL, et al.: Fluoroquinolone and macrolide resistance-associated mutations in Mycoplasma genitalium. J Clin Microbiol. 2013; 51(7): 2245–2249. PubMed Abstract | Publisher Full Text | Free Full Text
29. Irekwa R, Nzou SM: Detection of Mycoplasma genitalium using Direct PCR. figshare. Dataset. 2019. http://www.doi.org/10.6084/m9.figshare.10282691.v1

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 26 Nov 2019

Author details Author details

Robinson M. Irekwa
Roles: Conceptualization, Methodology

Perpetual Ndung'u
Roles: Supervision

Peter Kipkemboi
Roles: Methodology

Tonny Teya
Roles: Investigation

Anne Wanjiru Mwangi
Roles: Investigation

Matthew Mutinda
Roles: Investigation

Caroline Njoroge
Roles: Investigation

Joanne Yego
Roles: Investigation

Irumva Vanessa
Roles: Investigation

Samson Muuo Nzou
Roles: Conceptualization, Supervision

Competing interests

No competing interests were disclosed.

Grant information

This project was funded by the Pan Africa University Institute of Basic Sciences, Technology and Innovation hosted at the Jomo Kenyatta University of Agriculture and Technology (PAUSTI-JKUAT) and Nagasaki University Institute of Tropical Medicine-Kenya Medical Research Institute project (NUITM-KEMRI).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (1)

version 1

Published: 26 Nov 2019, 8:1993

https://doi.org/10.12688/f1000research.21218.1

© 2019 Irekwa RM et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Irekwa RM, Ndung'u P, Kipkemboi P et al. Identification of Mycoplasma genitalium from clinical swabs by direct PCR [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2019, 8:1993 (https://doi.org/10.12688/f1000research.21218.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 26 Nov 2019

Views

Reviewer Report 14 Jul 2020

Mihaela Laura Vică, Department of Cell and Molecular Biology, 'Iuliu Haţieganu' University of Medicine and Pharmacy, Cluj-Napoca, Romania

Approved with Reservations

https://doi.org/10.5256/f1000research.23360.r66861

This paper presents a laboratory method used for detection of Mycoplasma genitalium in swab samples collected from sex workers. The authors provide descriptions of the method used and the results obtained. I consider that, in order to be indexed, the paper needs some revisions and explanations.

Abstract
The paragraph on treatment and antibiotic resistance is not necessary because they are not the subject of this article.

Introduction
The phrase "Most of the detection studies have been conducted in the U.S.A, Europe and Australia, with various strains being discovered" requires citations from literature to exemplify what is stated.
The phrase “In this study, it is shown that direct PCR can be applied to the detection of M. genitalium from crude DNA extracts.” should not be placed in this section. It must be moved to the Discussions section.

Methods
In Sample preparation and Direct PCR sections, the authors declare that they used the manufacturer’s protocol “with slight modifications”. What are these changes and for what purpose were they made?
A positive control (M. genitalium positive sample) was used. Where does it come from?
Why two PCR amplifications were made? The authors should explain why they have amplified PCR products.

Results
I think two Figures are enough: a representative gel for direct PCR and a representative gel for the amplification of the PCR products.
There are mistakes in the legends of the Figures regarding the positive positions: e.g. in Figure 1 “The ladder is at positions 1 and 26” and “Clear Mycoplasma genitalium positive bands can be seen at positions 1, 2, 9, 10 and 17”.
How do you explain that in Figure 4 the band corresponding to sample S163 is at a different level than the others?

Discussion
There is too little discussion about the technique used.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: molecular biology, microbiology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 13 Oct 2021

Robinson Irekwa, Department of Molecular Biology and Biotechnology, Pan Africa University Institute of Basic Sciences, Technology and Innovation (PAUSTI-JKUAT), Juja, Kiambu, Kenya

13 Oct 2021

Author Response

Thank you for the comments given, will work on the sections. Truly appreciate
Competing Interests: No competing interests were disclosed
Thank you for the comments given, will work on the sections. Truly appreciate
Thank you for the comments given, will work on the sections. Truly appreciate
Competing Interests: No competing interests were disclosed Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 13 Oct 2021

Robinson Irekwa, Department of Molecular Biology and Biotechnology, Pan Africa University Institute of Basic Sciences, Technology and Innovation (PAUSTI-JKUAT), Juja, Kiambu, Kenya

13 Oct 2021

Author Response

Thank you for the comments given, will work on the sections. Truly appreciate
Competing Interests: No competing interests were disclosed
Thank you for the comments given, will work on the sections. Truly appreciate
Thank you for the comments given, will work on the sections. Truly appreciate
Competing Interests: No competing interests were disclosed Close
Report a concern

Views

Reviewer Report 25 Feb 2020

Hans Fredlund, World Health Organization Collaborating Centre for Gonorrhoea and Other Sexually Transmitted Infections (STIs), National Reference Laboratory for STIs, Department of Laboratory Medicine, Faculty of Medicine and Health, Örebro University, Örebro, Sweden

Approved

https://doi.org/10.5256/f1000research.23360.r59417

A commecial PCR method to detect M.genitalium was used in this study and a prevalence of 8% was found in female sex workers in Nairobi, Kenya. The manuscript is well written. It is of interest to perform such studies in many countries and cities globally to follow and understand the epidemiology of this STI. Of that reason the study can be accepted for indexing as it is. What is not studied is the antibiotic sensitivity of M.genitalium. In coming studies this has to be performed.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Infectious diseases and microbiology, epidemiology especially in the area of Neisseria sp and STI.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Author Response 13 Oct 2021

Robinson Irekwa, Department of Molecular Biology and Biotechnology, Pan Africa University Institute of Basic Sciences, Technology and Innovation (PAUSTI-JKUAT), Juja, Kiambu, Kenya

13 Oct 2021

Author Response

Thank you Dr. Huns Fredlund.
Competing Interests: No competing interests were disclosed.
Thank you Dr. Huns Fredlund.
Thank you Dr. Huns Fredlund.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 13 Oct 2021

Robinson Irekwa, Department of Molecular Biology and Biotechnology, Pan Africa University Institute of Basic Sciences, Technology and Innovation (PAUSTI-JKUAT), Juja, Kiambu, Kenya

13 Oct 2021

Author Response

Thank you Dr. Huns Fredlund.
Competing Interests: No competing interests were disclosed.
Thank you Dr. Huns Fredlund.
Thank you Dr. Huns Fredlund.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 26 Nov 2019

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 1 26 Nov 19	read	read

Hans Fredlund, Örebro University, Örebro, Sweden
Mihaela Laura Vică, 'Iuliu Haţieganu' University of Medicine and Pharmacy, Cluj-Napoca, Romania

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

9 Views

14 Jul 2020 | for Version 1

Mihaela Laura Vică, Department of Cell and Molecular Biology, 'Iuliu Haţieganu' University of Medicine and Pharmacy, Cluj-Napoca, Romania

9 Views Cite this report Responses(1)

Approved With Reservations

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

molecular biology, microbiology

Respond to this report

Responses (1)

Back to all reports

Reviewer Report

14 Views

25 Feb 2020 | for Version 1

14 Views Cite this report Responses(1)

Approved

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Infectious diseases and microbiology, epidemiology especially in the area of Neisseria sp and STI.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (1)

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Huengsberg M: Sexually Transmitted Diseases. 3rd ed. Ed King K Holmes, P Frederick Sparling, Per-Anders Mardh, Stanley M Lemon, Walter E Stamm, Peter Piot, Judith N Wasserheit. $170.50. New York: McGraw Hill, 1999. Sex Transm Infect. 2000; 76(6): 498. Publisher Full Text

[2] 2. Tully JG, Cole RM, Taylor-Robinson D, et al.: A Newly Discovered Mycoplasma In The Human Urogenital Tract. Lancet. 1981; 1(8233): 1288–91. PubMed Abstract | Publisher Full Text

[3] 3. Taylor-Robinson D, Jensen JS: Mycoplasma genitalium: from Chrysalis to Multicolored Butterfly. Clin Microbiol Rev. 2011; 24(3): 498–514. PubMed Abstract | Publisher Full Text | Free Full Text

[4] 4. Andersen B, Sokolowski I, Ostergaard L, et al.: Mycoplasma genitalium: prevalence and behavioural risk factors in the general population. Sex Transm Infect. 2007; 83(3): 237–41. PubMed Abstract | Publisher Full Text | Free Full Text

[5] 5. Wetmore CM, Manhart LE, Lowens MS, et al.: Ureaplasma urealyticum Is Associated With Nongonococcal Urethritis Among Men With Fewer Lifetime Sexual Partners: A Case-Control Study. J Infect Dis. 2011; 204(8): 1274–82. PubMed Abstract | Publisher Full Text | Free Full Text

[6] 6. Brunham RC, Paavonen J, Stevens CE, et al.: Mucopurulent cervicitis--the ignored counterpart in women of urethritis in men. N Engl J Med. 1984; 311(1): 1–6. PubMed Abstract | Publisher Full Text

[7] 7. Gaydos C, Maldeis NE, Hardick A, et al.: Mycoplasma genitalium as a Contributor to the Multiple Etiologies of Cervicitis in Women Attending Sexually Transmitted Disease Clinics. Sex Transm Dis. 2009; 36(10): 598–606. PubMed Abstract | Publisher Full Text | Free Full Text

[8] 8. Palmer HM, Gilroy CB, Furr PM, et al.: Development and evaluation of the polymerase chain reaction to detect Mycoplasma genitalium. FEMS Microbiol Lett. 1991; 61(2–3): 199–203. PubMed Abstract | Publisher Full Text

[9] 9. Wroblewski JK, Manhart LE, Dickey KA, et al.: Comparison of transcription-mediated amplification and PCR assay results for various genital specimen types for detection of Mycoplasma genitalium. J Clin Microbiol. 2006; 44(9): 3306–12. PubMed Abstract | Publisher Full Text | Free Full Text

[10] 10. Björnelius E, Lidbrink P, Jensen JS: Mycoplasma genitalium in non-gonococcal urethritis--a study in Swedish male STD patients. Int J STD AIDS. 2000; 11(5): 292–6. PubMed Abstract | Publisher Full Text

[11] 11. Deguchi T, Gilroy CB, Taylor-Robinson D: Comparison of two PCR-based assays for detecting Mycoplasma genitalium in clinical specimens. Eur J Clin Microbiol Infect Dis. 1995; 14(7): 629–31. PubMed Abstract | Publisher Full Text

[12] 12. Dutro SM, Hebb JK, Garin CA, et al.: Development and performance of a microwell-plate-based polymerase chain reaction assay for Mycoplasma genitalium. Sex Transm Dis. 2003; 30(10): 756–63. PubMed Abstract | Publisher Full Text

[13] 13. Jensen JS: Mycoplasma genitalium: the aetiological agent of urethritis and other sexually transmitted diseases. J Eur Acad Dermatol Venereol. 2004; 18(1): 1–11. PubMed Abstract | Publisher Full Text

[14] 14. Jensen JS, Uldum SA, Søndergård-Andersen J, et al.: Polymerase chain reaction for detection of Mycoplasma genitalium in clinical samples. J Clin Microbiol. 1991; 29(1): 46–50. PubMed Abstract | Free Full Text

[15] 15. Jurstrand M, Jensen JS, Fredlund H, et al.: Detection of Mycoplasma genitalium in urogenital specimens by real-time PCR and by conventional PCR assay. J Med Microbiol. 2005; 54(Pt 1): 23–9. PubMed Abstract | Publisher Full Text

[16] 16. Yoshida T, Deguchi T, Ito M, et al.: Quantitative detection of Mycoplasma genitalium from first-pass urine of men with urethritis and asymptomatic men by real-time PCR. J Clin Microbiol. 2002; 40(4): 1451–5. PubMed Abstract | Publisher Full Text | Free Full Text

[17] 17. Yoshida T, Maeda S, Deguchi T, et al.: Rapid Detection of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum, and Ureaplasma urealyticum Organisms in Genitourinary Samples by PCR-Microtiter Plate Hybridization Assay. J Clin Microbiol. 2003; 41(5): 1850–5. PubMed Abstract | Publisher Full Text | Free Full Text

[18] 18. Gomih-Alakija A, Ting J, Mugo N, et al.: Clinical characteristics associated with Mycoplasma genitalium among female sex workers in Nairobi, Kenya. J Clin Microbiol. 2014; 52(10): 3660–6. PubMed Abstract | Publisher Full Text | Free Full Text

[19] 19. Cohen CR, Nosek M, Meier A, et al.: Mycoplasma genitalium infection and persistence in a cohort of female sex workers in Nairobi, Kenya. Sex Transm Dis. 2007; 34(5): 274–9. PubMed Abstract

[20] 20. Vandepitte J, Muller E, Bukenya J, et al.: Prevalence and correlates of Mycoplasma genitalium infection among female sex workers in Kampala, Uganda. J Infect Dis. 2011; 205(2): 289–96. PubMed Abstract | Publisher Full Text

[21] 21. Vandepitte J, Weiss HA, Kyakuwa N, et al.: Natural history of Mycoplasma genitalium Infection in a Cohort of Female Sex Workers in Kampala, Uganda. Sex Transm Dis. 2013; 40(5): 422–7. PubMed Abstract | Publisher Full Text | Free Full Text

[22] 22. Mehta SD, Gaydos C, Maclean I, et al.: The effect of medical male circumcision on urogenital mycoplasma genitalium among men in kisumu, kenya. Sex Trans Dis. 2012; 39(4): 276–80. PubMed Abstract | Publisher Full Text | Free Full Text

[23] 23. Jensen JS, Borre MB, Dohn B: Detection of Mycoplasma genitalium by PCR Amplification of the 16S rRNA Gene. J Clin Microbiol. 2003; 41(1): 261–6. PubMed Abstract | Publisher Full Text | Free Full Text

[24] 24. Eastick K, Leeming JP, Caul EO, et al.: A novel polymerase chain reaction assay to detect Mycoplasma genitalium. Mol Pathol. 2003; 56(1): 25–8. PubMed Abstract | Publisher Full Text | Free Full Text

[25] 25. Balkus JE, Manhart LE, Jensen JS, et al.: Mycoplasma genitalium Infection in Kenyan and US Women. Sex Transm Dis. 2018; 45(8): 514–21. PubMed Abstract | Publisher Full Text | Free Full Text

[26] 26. Pepin J, Labbé AC, Khonde N, et al.: Mycoplasma genitalium: an organism commonly associated with cervicitis among West African sex workers. Sex Transm Infect. 2005; 81(1): 67–72. PubMed Abstract | Publisher Full Text | Free Full Text

[27] 27. Anderson T, Coughlan E, Werno A: Mycoplasma genitalium Macrolide and Fluoroquinolone Resistance Detection and Clinical Implications in a Selected Cohort in New Zealand. J Clin Microbiol. 2017; 55(11): 3242–3248. PubMed Abstract | Publisher Full Text | Free Full Text

[28] 28. Tagg K, Jeoffreys N, Couldwell DL, et al.: Fluoroquinolone and macrolide resistance-associated mutations in Mycoplasma genitalium. J Clin Microbiol. 2013; 51(7): 2245–2249. PubMed Abstract | Publisher Full Text | Free Full Text

[29] 29. Irekwa R, Nzou SM: Detection of Mycoplasma genitalium using Direct PCR. figshare. Dataset. 2019. http://www.doi.org/10.6084/m9.figshare.10282691.v1

Identification of Mycoplasma genitalium from clinical swabs by direct PCR

Abstract

Keywords

Introduction

Methods

Ethical statement

Source of samples

Sample preparation

Direct PCR

Table 1. Primer sequences.

Agarose gel electrophoresis

Amplification of the PCR products

Results

M. genitalium detection

Figure 1. First representative gel for Mycoplasma genitalium detection using direct PCR.

Figure 2. Second representative gel for the detection of Mycoplasma genitalium using direct PCR.

Figure 3. First representative gel showing the amplification of the PCR products.

Figure 4. Second representative gel showing the amplification of the PCR products.

M. genitalium prevalence

Discussion

Data availability

Underlying data

Acknowledgements

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated