Role of pharmacogenetics and clinical parameters on nevirapine plasma concertation among HIV-1 patients receiving Antiretroviral Therapy in Kenya

Ethical statement

This study was approved by the Kenya Medical Research Institutes’ (KEMRI) Scientific Review Unit (SERU) (KEMRI/SERU/CVR/002/3214) and NACOSTI (NACOSTI/P/19/11747/28173). Before recruitment in this study, all patients filled in written informed consent for study participation.

Design and study population

This was a cross-sectional study conducted between August 2018 to January 2020 and was part of an ongoing study designed to establish a cost-effective laboratory method to monitor antiretroviral adherence in HIV-1 infected individuals on treatment in Kenya. Patients were recruited in this study if they were: (i) HIV-1 infected adults (aged above 18 years), attending the two HIV treatment programs, (ii) willing to voluntarily give written informed consent, (iii) able to read either English or Kiswahili, (iii) be on ARV treatment for 12 months, (iv) be on NVP based 1st line ARV treatment regimen and (v) HIV patients with viral load results at month 12 of treatment. The patients were categorized as either failing (HIV viral load >1000 copies/mL) or responding (HIV viral load <1000 copies/mL) to treatment.

Sample size and recruitment

Using the case control sample size formula described by Lemeshow et al.¹⁹, and using the previous study of Ahoua et al.²⁰, which showed that among HIV patients with virological failure at month 12, 12.8% of them developed sub-optimal drug level/drug resistance. In this study, we wished to have a 90% chance of detecting an odds ratio significantly different from 1 at the 5 % level. Considering an odds ratio of 2 as an important difference between the two groups, a total of 376 (188 cases and 188 controls) were to be recruited from each of the two sites. A two-stage sampling method was then used to select patients meeting the inclusion criteria from the two sites. First, the overall number of patients meeting the inclusion criteria was generated based on the laboratory records. A total of 272 patients from Kisumu (western Kenya) and 105 patients from Malindi (costal Kenya) were then selected based on probability proportionate to size. Second, a consecutive sampling technique was used to obtain consent from and recruit every patient meeting the inclusion criteria until the required sample size was achieved.

Data collection

An exhaustive structured interview (including demographic data, clinical history, adherence, HIV stigma and medical history) was used to collect patient-related information (see Extended data)²¹. These interviews were conducted by medical clinician or doctor employed by the two organizations and who regularly attends to these patients. Each interview was conducted in a separated private room and lasted for about 45 minutes.

After the interviews, the patients were sent to the phlebotomy room where blood specimens were drawn by a trained phlebotomist into ethylenediaminetetraacetic acid (EDTA)-containing Vacutainers^® (BD, US) for determination of NVP plasma concentration and CYP2B6 516G>T and 983T>C genetic analysis. From each of the patients, approximately 5ml of intravenous blood was collected in EDTA tubes. Blood samples were centrifuged at 20,000g to collect plasma, which was stored at -20°C at each research site until it was shipped in dry ice to the KEMRI Nairobi laboratory for storage and laboratory testing.

The plasma HIV-1 RNA

RNA was extracted manually from 1ml of all HIV-1 samples using QIAmp viral RNA mini kit (Cat. No. 52906, Qiagen Inc., USA) according to the manufacturer instructions. Purified RNA was eluted in 60μL of molecular grade water. A volume of 10μL of RNA extract was used for quantification with the Generic HIV Viral Load assay (Biocentric, Bandol-France). The cycling conditions comprised of 50°C for 10 minutes and 95°C for 5 minutes, followed by 50 cycles of 95°C for 15 seconds and 60°C for 1 minute. Amplification and data acquisition were carried out using the ABI Prism 7300 Sequence Detection System (Applied Biosystems) and the detection cut-off value was 60 HIV-1 RNA copies/ml.

NVP plasma concentrations

The NVP plasma concentrations were measured using a Xevo TQ-S tandem quadrupole mass spectrometer (Waters Corporation, U.S.A) designed for ultra-high performance as described by Reddy et al.²². First, the HIV virus was inactivated as follows. Into a 1.5ml Eppendorf tube, 50μl of plasma and 5μl internal standard (2μg/ml nevirapine, purity: 100 %, from Vivan Life Sciences, Mumbai, India prepared in methanol) was added. This was heated at 65°C for 10 minutes, followed by 10 minutes cooling at room temperature. 100μl cold methanol (-20^oC) was then added to each sample and kept at -20°C for 10 minutes. This was followed by eight minutes of centrifugation at 20,000g, 20°C to collect the supernatant in a clean 1.5ml tube. Then, 850μl ammonium acetate buffer (pH = 3.00) was added to the supernatant and briefly centrifuged. The sample was considered safe to be handled in a non P3 laboratory.

Solid phase extraction was carried out using Bond Elut C18 cartridges. The cartridges were prepared and placed onto the Visiprep Vacuum Manifold with standard lid (Merck, Germany). The Bond Elute C18 150×4.6mm, 5μm column was conditioned by first passing through 1ml methanol, followed by 1ml ultrapure water. Each column was then charged with 150μl samples containing 850μl ammonium acetate buffer (pH = 3.00), followed by twice cleaning using 1ml ultrapure water. The first cleaning was collected into clean separate tube while the second water cleaning collected in the waste tubes. The columns were vacuum dried (5–10 kPa). NVP elution was carried out at a flow rate of 1ml/min twice using 500μl methanol with vacuum drying between the two elutions. Elutes were then completely evaporated using Thermo Scientific™ Reacti-Vap™ Evaporators (Thermo Fisher Scientific Inc, USA) at 37°C for 30 minutes. This was then reconstituted using 100μl of equal parts 1:1 acetonitrile and water, vortexed briefly and transferred into 50ml capped vials and placed into the Xevo TQ-S for quantification. Approximately 1μl of the samples was injected automatically into the LC/MS/MS instrument and quantified within five minutes. NVP plasma concentration was categorized as <3100 ng/mL (below therapeutic range), 3100–4300 ng/mL (therapeutic range) and >4300 ng/mL (above therapeutic range) as previously defined²³.

CYP2B6 genotyping

DNA was extracted from patients’ blood samples using the QIAamp DNA Blood Mini Kit (Cat. No. 51106, Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. Briefly, 20μl QIAGEN Protease and 200μl blood sample were added into a 1.5ml microcentrifuge tube and 200μl of Buffer AL added and mixed by pulse-vortexing for 15 seconds. This was incubated at 56°C for 10 minutes. This was followed by a series of washing and eventually the DNA was eluted using 200μl Buffer AE at 6000 × g (8000 rpm) for one minute. The quality of DNA was measured using a ND-1000 UV spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Genotyping was carried out on an ABI 7500 Fast Sequence Detection System (Applied Biosystems, Foster City, CA, USA). SNPs were analyzed using the validated Taqman Genotyping Assays for CYP2B6 516G>T (rs3745274; assay ID C_7817765_60) and CYP2B6 983T>C (rs28399499; assay ID C_60732328_20), according to the manufacturer’s instructions. Briefly, in a final volume for each reaction of 25μl, consisting of 2x TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 20x drug metabolizing genotype assay mix and 10ng genomic DNA. The PCR profile consisted of an initial step at 50°C for 2 minutes and 50 cycles at 95°C for 10 minutes and 92°C for 15 seconds. The plates were read using the allelic discrimination settings. The SNP assay was set up using SDS, version 1.3.0 as an absolute quantification assay. Post-assay analysis was done using SDS software. The results for CYP2B6 516G>T and 983T>C genotypes were defined as follows: homozygous wild type as 516GG or 983TT, heterozygous as 516GT or 983TC, and homozygous mutated as 516TT or 983CC.

HIV drug-resistant genotyping

The presence of HIV drug-resistant mutation was tested using an in-house genotypic method previously described Lehman et al.²⁴. This involved the following steps:

RNA extraction. The viral RNA was extracted from plasma using QIAamp Viral RNA Extraction Kit (Cat. No. 52906, Qiagen Inc., USA) according to manufacturer’s instructions.

Nested PCR amplification and visualization. A nested PCR was then performed using AmpliTaq Gold (Roche Molecular Systems, Branchburg, NJ). Briefly, in the first round; HIV- 1 pol gene was amplified using primers (RT18: 5′ GGAAACCAAAAATGATAGGGGGAATTGGAGG 3′ and RT21: 5′ CTGTATTTCTGCTATTAAGTCTTTTGATGGG 3′) achieved as follows: one cycle of 45°C for one minute and 94°C for two minutes, followed by 35 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for one minute, with a final extension of 72°C for two minutes. The second-round amplification used primers (RT1: 5′ CCAAAAGTTAAACAATGGCCATTGACAGA 3′ and RT4: 5′ AGTTCATAACCCATCCAAAG 3′) was achieved as follows: one cycle of 94°C for two minutes and 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for one minute, with a final extension of 72°C for 10 minutes. The PCR amplification was confirmed by visualization with ethidium bromide staining of agarose gel. The nested reverse transcriptase-polymerase chain reaction (RT-PCR) amplified a positive sample of 645 base pairs.

BigDye sequencing reactions. The PCR positive samples were first cleaned to remove excess primers and nucleotides in a single step up using ExoSAP-IT™ PCR technology (Cat. No. 78200, Applied Biosystems, Foster City, CA, USA). Briefly, for each positive PCR product visualized on the gel, 5ul of the PCR product was mixed with 2ul ExoSAP-IT reagent and held at 37°C for 15 minutes, followed by 80°C for 15 minutes in a thermocycler.

The cleaned DNA was then amplified using a BigDye Terminator Kit (Cat. No. 4337457, Applied Biosystems, Foster City, CA, USA) and an ABI Prism 3300 Genetic Analyzer (Applied Biosystems, Foster City, US). Briefly, a 10µl reaction comprising 5.5µl DNA grade water, 2µl 5x BigDye buffer, 1ul BigDye 0.5µl primers (RT 1: 5’ CCAAAAGTTAAACAATGGCCATTGACAGA 3’ and RT4: 5’ AGTTCATAACCCATCCAAAG 3’), and 1ul PCR product template was amplified as follows: one cycle of 94°C for 10 seconds and 25 cycles of 94°C for 10 seconds, 50°C for 5 seconds, and 60°C for 4 minutes²⁴.

This BigDye PCR amplification product was cleaned up using spin columns impregnated with Sephadex® G-50 (Sigma, US) and denatured using 10 ul Hi-Di™ Formamide and heated at 95°C for two minutes using a thermocycler. The 20ul of the denature BigDye product were sequenced using BigDye technology on an ABI 310 Genetic Analyzer (Applied Biosystems, Foster City, CA).

Drug resistant interpretation. The ART drug resistance mutations were identified using the Stanford University and International AIDS Society-USA website. Genotypic resistance was defined as the presence of resistance mutations associated with impaired drug susceptibility using the Stanford Genotypic Resistance Interpretation Algorithm.

Data analysis

Frequencies and percentages were used to present the sociodemographic data. The relationship between NVP plasma concentrations and CYP2B6 516G>T and 983T>C and the presence of HIV drug-resistant mutations were determined using Kruskal-Wallis test and Dunn’s test. Univariate and multivariate linear regression analyses were performed to determine the relationship between NVP plasma concentration and genetic polymorphisms, presence of HIV drug-resistant mutations and other clinical characteristics at the significance level of p<0.05. All statistical analyses were performed using STATA v 13 (StataCorp LP, Texas, USA).

Baseline characteristics

The results from the 377 patients were assessed, of whom 272 (72.2%) were from Kisumu county (western Kenya), 223 (59.2%) were female and 114 (30.2%) had a HIV viral load of >1000 copies/mL²⁵. The median age of the patients was 41 years (IQR = 34–49 years), with a median duration of living with HIV infection of five years (IQR = 1–11years) and a median duration since ART initiation of three years (IQR = 1–8 years). There were 306 (81.2%) patients currently taking lamivudine, nevirapine, tenofovir regimen, while 97 (25%) had missed an ART scheduled visit due to HIV-related illness and 205 (54.4%) reporting missing taking current ART at least once (Table 1).

NVP plasma concentration

The steady-state NVP plasma concentrations varied widely among patients, ranging from 4 ng/mL to 44,207 ng/mL (median 5179 ng/mL, IQR 2557–7453 ng/mL). Out of the total 377 patients, 96 (25.5%) had an NVP concentration <3100 ng/mL and 26 (6.9%) had an NVP concentration of 3100–4300 ng/mL, with the majority, 255 (67.6%), of the patients having an NVP concentration >4300 ng/mL (Table 2). No significant differences were found with regards to region of origin between patients with NVP levels <3100 ng/mL and those with NVP levels of 3100–4300 ng/mL or >4300 ng/mL (p=0.829). Further, no differences were observed with regards to gender, HIV RNA viral load, age and duration infected with HIV in patients with NVP levels >4300 ng/mL when compared to patients with lower NVP levels. Similarly, no significant correlations were observed with regards to age of sexual debut (p = 0.785), duration since ART initiation (p=0.888), initial ART regimen type (p=0.883), current ART regimen type (p=0.972), missing scheduled HIV care visit (p=0.644), or non-adherence to current ART regimen (p=0.769) in patients with NVP levels >4300 ng/mL when compared to patients with lower NVP levels (Table 1).

Prevalence of CYP2B6 516G>T and 983T>C genotypes

The number of patients with GG, GT and TT genotypes for the CYP2B6 516G>T SNP were 142 (37.7%), 187 (49.6%) and 48 (12.7%), respectively. In the case of the CYP2B6 983T>C SNP, the majority of patients (n = 326, 86.5%) had the homozygous wild type TT genotype. There were 48 patients (12.7%) who had the heterozygous mutant TC genotype, while three (0.7%) patients had the homozygous mutant CC genotype.

Relationship between CYP2B6 516G>T and 983T>C genotypes, HIV drug-resistant mutation and plasma NVP levels

In this study, CYP2B6 516G>T and 983T>C SNPs were correlated with increased mean NVP plasma concentrations (Table 2). For CYP2B6 516G>T, patients who had the homozygous mutation (CYP2B6 516TT) had higher median NVP plasma levels (6753.5 ng/mL, IQR 4595.5–11046 ng/mL), as did those who were heterozygous for the mutation (CYP2B6 516GT; 5579 ng/mL, IQR 2960–8323 ng/mL), compared to those with the wild-type (CYP2B6 516GG; 3920.5 ng/mL, IQR 1416–6278 ng/mL) (p<0.0001). In the case of CYP2B6 983T>C, although the median NVP plasma concentrations were higher among patients who had the heterozygous genotype (CYP2B6 983TC; 5987 ng/mL, IQR 3101.5–9143 ng\mL) than those who had homozygous wild-type (CYP2B6 983TT; 5132 ng/mL, IQR 2394–7384 ng\mL), the distribution was not significant (p=0.33).

With regard to the presence of a HIV drug-resistant mutation, although there were only 31 (8.2%) patients with an NVP-based resistant mutation as opposed to 346 (91.8%) without, the median plasma NVP levels for those with resistant mutations was almost half (2283 ng/mL, IQR 18–5283 ng/mL) that of those without (5498 ng/mL, IQR 2960–7690 ng/mL) (p=0.001) (Table 2). The associations between log₁₀-transformed plasma NVP concentrations and CYP2B6 genotypes and the presence of HIV drug-resistant mutations are shown in Figure 1.

Figure 1. The differences in log₁₀-transformed nevirapine plasma concentrations by genotype and HIV drug-resistant mutation.

A) Log₁₀-transformed nevirapine plasma levels for each CYP2B6 516G>T genotype: GG, GT, and TT. B) Log₁₀-transformed nevirapine plasma levels for each CYP2B6 983T>C genotype: TC, TT and CC. C) Log₁₀-transformed plasma NVP levels for the presence (yes) and absence (no) of HIV drug-resistant mutations.

Regression analysis

In the multivariate linear regression model, factors that remained significantly associated with a higher NVP plasma levels included: the T allele of CYP2B6 G516T genotype (adjusted β 0.71, 95% CI 0.4–0.98; p<0.0001), male gender (adjusted β 0.45, 95% CI 0.01–0.9; p=0.047) and presence of drug-resistant virus (adjusted β 1.98, 95% CI 1.24–2.72; p<0.001) (Table 3).

Underlying data

Figshare: Role of pharmacogenetics and clinical parameters on nevirapine plasma concentration among HIV-1 patients receiving antiretroviral therapy in Kenya. https://doi.org/10.6084/m9.figshare.11977680.v1²⁵

Extended data

Figshare: Role of pharmacogenetics and clinical parameters on nevirapine plasma concentration among HIV-1 patients receiving antiretroviral therapy in Kenya. https://doi.org/10.6084/m9.figshare.12033699²¹

This project contains the following extended data:

Data are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).