Analysis of GABRB3 gene mRNA expression and motor coordination after administration of valerian extracts (Valeriana officinalis) in BALB/c mice

Ethical statement

Animals were treated according to the Ethical Principles and Guidelines for Scientific Experiments on Animals (2005) by the Swiss Academy of Medical Sciences and ARRIVE guidelines for animal studies. All experimental protocols employed in this study were approved by the Medical Research Ethics Committee of Hasanuddin University Makassar, Indonesia (903/H4.8.4.5.31/PP36-KOMTEK/2017). Principles for the ethical treatment of animals in research environments are described (Government Regulation of Republic of Indonesia No. 95 2012). Specific and detailed directions for the care and use of animals in biomedical research are available in the guidelines, developed in 2011 by Indonesia Health Research Ethics Committee of the Ministry of Health (Indonesia National Guidelines on Health Research Ethics 2011)³¹.

Study setting and design

This study was conducted at the Laboratory of Molecular Biology, Faculty of Medicine, Hasanuddin University, Makassar. This study was an experimental laboratory study with BALB/c mice as an animal model, using a posttest-only control group design.

Animals

This is an experimental study using 28 healthy adult male BALB/c mice that were eight weeks old, weighed approximately 25–35 grams, with no anatomical abnormality, that had never been used in experimental studies before. Mice were obtained from the maintenance and development unit of the experimental animal laboratory of Molecular Biology Faculty of Medicine, Hasanuddin University, Makassar, Indonesia. Out of 28 mice, 20 mice that could last ≥180 seconds in at least two of the three trials were included. All mice were housed in standard polycarbonate cages (60 cm long × 30 cm wide × 30 cm high) with rice husks, with each cage consisting of five mice. The animal housing kept was at 25±2°C under a 12-hour light/dark cycle. Mice were fed on standard diet in the form of mouse pellets (food made by Japfa Comfeed Indonesia Inc) and given tap water ad libitum for a period of seven days during this study. We assessed the clinical status of the mice every day during routine checks to prevent any clinical changes in the laboratory mice. No mice were found dead or having decreased appetite/growth during the study period. The mice were handled in accordance with the regulations set by the Animal Care and Use Committee at Indonesian National Guidelines on Health Research Ethics³¹.

Drugs and treatments

Valerian extracts used in this study were Blackmores Valerian Forte, a standardized herbal pill equivalent to 2 g (2000 mg) of Valeriana officinalis dry root or rhizome. The extract was diluted with Aqua Dest (distilled water) to 2 mg/0.1 mL. The drugs were administered via gastric gavage with 1 ml syringe. The dose was determined with the dose used in humans as a reference; the maximum tolerated dose in humans is 81.2 mg/kg as determined by Kakeshi (2014)³², or 51 mg/kg by Al-Majed (2006)²⁹. The Food and Drugs Administration (FDA) recommends converting the doses from human to mice by using 12.3 as a conversion factor, which led to the final dose of 2.5 mg/10 g and 5 mg/10 g as the dose for mice based on the average weight of 20 grams. Meanwhile, the dose of diazepam was adjusted from the human daily dose of 0.2 mg/kg, leading to the final dose of 2.5 mg/kg or 0.025 mg/10 g^33,34.

Motor coordination/sedation (rotarod test)

The rotarod test is one of the most commonly used methods to assess motor coordination and balance in mice. It has also been used to assess sedation level effectively in previous studies. The latency of falling from the rod at a constant speed is sensitive to the presence of a biological change (i.e. sedation) that affects motor coordination and balance^35,36. A rotarod consists of rods with multiple pointed edges along the seam, with a rod diameter of 3-7 cm, speed control, and a lever that halts the timer after the mice fell from the rod³⁷. The mice underwent a "trial" using the rotarod machine for 300 seconds, at a speed of 20 rotations per minute (rpm), repeated three times with intervals of 10–15 minutes. The trial was conducted 24 hours before the study began. All mice underwent rotarod machine "training" for 60 seconds, at a speed of 20 rpm, repeated three times with five minute intervals, for seven days, 30 minutes before drug administration. On the seventh day, 30 minutes after drug administration, mice were placed on the rotarod machine for 300 seconds, speed of 20 rpm, repeated five times with 10–15 minute intervals. The timer starts when the rotary engine is running. The timer stops when the mouse falls from the rod or until 300 seconds is reached. The time taken to fall from the rod was recorded.

Study protocol

After two-weeks acclimatization the mice were randomly divided into four groups (group I Aqua Dest, group 2 diazepam, group 3 valerian 2.5 mg and group IV valerian 5 mg) consisting of five animals each using the GraphPad calculator tool to prevent any bias. The sample size in this study refers to the minimum sample size according to the WHO for research on traditional short-term treatments using animal models, which is five animals per group and Federer’s formula³⁸. The intervention group, group I, was given 5 ml of Aqua Dest; group II was given 0.025 mg/10 g of diazepam diluted with distilled water to 0.5 mg/0.1 mL; group III was given 2.5 mg/10 g valerian extract diluted with distilled water to 2 mg/0.1 mL; and group IV was given 5 mg/10 g valerian extract diluted with distilled water to 2 mg/0.1 mL. All interventions were administered once daily every morning at 08:00 am for seven days through a gastric gavage in the animal laboratory. All mice were fasted for three hours before drug administration. The body weight of mice was also recorded before drug administration. On the seventh day, 30 minutes after drug administration, mice were placed on the rotarod machine. The time taken to fall from the rod was recorded. Mice were returned to the cage to rest during the intervals. A blood sample of 0.2 ml was taken on the first day before drug administration and after the rotarod test on the seventh day to be analyzed using quantitative real-time PCR (Bio-Rad CFX Connect, USA). The blood was taken from the tail vein without anesthesia. Efforts were made to minimize suffering, such as limiting the frequency of blood sampling, providing adequate space for living and performing no other experimentation or pain inducing procedures.

RNA nucleic acid extraction

Three important steps in this method are lysing, binding, and washing according to the Boom methods³⁹. A 100 µg/µl of blood volume sample was dissolved into 900 µl of L6 solution, which consists of 120 g of guanidium thyocyanate (GuSCN) (Fluka Chemie AG, Buchs, Switzerland, cat no. 50990) in 100 ml of 0.1 M Tris HCl, pH 6.4, 22 ml 0.2 M ethylenediaminetetraacetate (EDTA) pH 8.0 and 2.6 g Triton X-100 (Packard, Instrumens) with a final concentration of 50 mM Tris HCl, 5 M GuSCN, 20 mM EDTA, and 0.1% Triton X-100. The solution was centrifuged at 12,000 rpm. After the lysing process, 20 μl of diatom suspension consisting of 50 ml H₂O and 500 μl of 32% (w/v) Celite (diatom) (Jansen Chimica, Beerse, Belgium, 10.846.79) was added. Around 20 μl of this diatom suspension can bind to 10 μg RNA/tissue/blood DNA. Then, a vortex was performed, followed by centrifugation in a 1.5 ml Eppendorf tube with a speed of 12,000 rpm for 15 minutes. The supernatant was removed and the sediment was washed with 1 ml L2 solution, consisting of 120 g GuSCN in 100 ml of 0.1 M Tris-HCl, pH 6.4. The mixture was vortexed and centrifuged at 12,000 rpm for 15 minutes, and washed two times with an L2 solution, and washed again with 1 ml of 70% ethanol twice and with 1 ml of acetone. The solution was then heated in water at a temperature of 56°C for 10 minutes and 60 μl of TE solution, consisting of 1 mM EDTA in 10 mM Tris HCL pH 8.0, was added. The solution was then vortexed and centrifuged at 12,000 rpm for 30 seconds and incubated in the oven for 10 minutes at a temperature of 56°C. Following the incubation, the sample was vortexed and centrifuged again at 12,000 rpm for 30 seconds. The supernatant was obtained by nucleotide extraction and stored at -80°C before PCR analysis.

qRT-PCR analysis

Samples for GABRB3 gene mRNA measurements were collected from the tail vein (0.2 ml for each sample). Total RNA was isolated from venous blood using the Qiagen RNeasy Micro Kit (DNA Genotek, Qiagen, Cat No 74004) according to the manufacturer’s instructions. Complementary DNA synthesis was performed by using iScript™ Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad, Hercules, CA, USA, Cat No 172503) according to the manufacturer’s instructions. The synthesized cDNA was diluted 10 times and used to determine GABAAR subunit mRNA levels. Following reverse transcription, quantitative RT-PCR (qRT-PCR) was performed in triplicate using the iQ SYBR Green Supermix (Bio-Rad, Cat No 170-888) PCR mix containing 100 mM KCl, 40 mM Tris-HCl pH 8.4, 0.4 mM of each dNTP, 50 U/mL DNA Polymerase (iTaq), 6 mM MgCl2, SYBR Green I, 20 nM fluorescein, and stabilizers. The reaction was performed using a thermocycler (Real-Time PCR detection system C1000/CFX96, Bio-Rad, Hercules, CA, USA) in a final volume of 25 μL (5 μL RNase-free H2O, 5 μL cDNA template, 2.5 μL of each primer, and 12.5 μL of 2x iQ SYBRTM Green Supermix) under the following PCR conditions: initial heating at 95°C for three minutes to denature the cDNA and activate the Taq DNA Polymerase, followed by 40 cycles consisting of denaturation at 95°C for 30 seconds, annealing at 60°C for 60 seconds, and extension at 72°C for two minutes. The reaction was then stopped with a final step at 72°C for 15 minutes. Qiagen QuantiTect Primer Assay systems with the following 10X primers were used: GABRB3 (product number 249900, NM_021912, final concentration 1X), forward (5’ GCTTCTTGGCTTCTCTGGTG -3’) and reverse (5’- AACGAGATGCCATTCACTCC -3’). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (product number 249900, NM_002046, final conc.1X) was used as an internal control for normalization, GAPDH primer, forward (5’ TCCAGGGTTGGTCTTAGTGG -3’) and reverse (5’- TTCCACCAGGCTCTCTGTCT -3’). Analysis was performed using CFX Manager software (Bio-Rad) for calculating gene expression in the analysis mode ΔΔC(t) according to the manufacturer’s instructions. All measurements were conducted as per manufacturer’s instructions and repeated three times to ensure the validity. Target mRNA expression was read as fold change^40,41.

Statistical analysis

Statistical analysis was performed using the IBM^® SPSS^® Statistics version 26.0 for Windows (SPSS Inc., Chicago, IL, U.S.A.). Data normality tests were performed using the Shapiro-Wilks statistical test. ANOVA and Kruskal Wallis tests were used to analyze numerical differences between the four groups. The paired t-test was used to analyze mean values before and after treatment between each group, while the independent t-test was used to analyze mean values before and after treatment between two different groups. The analyzed variables were mouse weight, GABRB3 gene mRNA expression, and rotarod test results. A p-value of <0.05 was considered significant.

Normality test

GABRB3 mRNA expression before and after treatment showed normal data distribution, with a p-value of >0.05 within each group (Table 1)⁴². The Shapiro-Wilks normality test was also performed on motor coordination functions (Table 2). In this study, motor coordination functions were tested with the rotarod test, which showed a mean of 183.71 seconds with a median of 215.9 seconds⁴². The normality test showed normal data distribution with p-value of >0.05 in each group.

Mice body weight

The Kruskal Wallis test (Table 3) showed that there was no significant difference between the weight of each mouse (p>0.05)⁴².

GABRB3 gene mRNA expression

Table 4 shows the mean value of GABRB3 mRNA expression before and after treatment. In group I, there was no significant difference (p = 0.653). In group II, there was a significant increase (p <0.0001) from 5.88 to 8.064. The increase was most significant in group III (p <0.0001), from 6.321 to 12.796. In group IV, there was an increase from 6.028 to 9.778 (p <0.0001). The ANOVA test (Table 5) did not show any significant difference between each group before treatment (p = 0.562). However, there was a significant difference after treatment (p <0.0001). The independent t-test (Table 6) did not show any significant difference (p >0.05) between two groups before treatment. However, there were significant differences between two groups after treatment (p <0.0001) (Table 7).

Rotarod test

Table 8 shows the comparison of rotarod test results after treatment between two groups using the independent t-test. There were significant differences (p<0.05) between group I (Aqua Dest) and group II (diazepam), between group I (Aqua Dest) and the first treatment group (valerian 2.5 mg/10 g), and between group I (Aqua Dest) and the second treatment group (valerian 5 mg/10 g). There were no significant differences between the positive control group and either treatment group (p >0.05).

Underlying data

Open Science Framework: Effect of Valerian Extracts on GABRB3 Gene mRNA Expression and Motor Coordination in BALB/c mice. https://doi.org/10.17605/OSF.IO/CT52W⁴².

This project contains the following underlying data:

Data are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).