ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Note

GPR21 KO mice demonstrate no resistance to high fat diet induced obesity or improved glucose tolerance

[version 1; peer review: 1 approved, 2 approved with reservations]
PUBLISHED 04 Feb 2016
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Preclinical Reproducibility and Robustness gateway.

Abstract

Gpr21 KO mice generated with Gpr21 KO ES cells obtained from Deltagen showed improved glucose tolerance and insulin sensitivity when fed a high fat diet. Further mRNA expression analysis revealed changes in Rabgap1 levels and raised the possibility that Rabgap1 gene may have been modified. To assess this hypothesis a new Gpr21 KO mouse line using TALENS technology was generated. Gpr21 gene deletion was confirmed by PCR and Gpr21 and Rabgap1 mRNA expression levels were determined by RT-PCR. The newly generated Gpr21 KO mice when fed a normal or high fat diet chow did not maintain their improved metabolic phenotype. In conclusion, Rabgap1 disturbance mRNA expression levels may have contributed to the phenotype of the originally designed Gpr21 KO mice.

Keywords

GPCR, Rabgap1, Diabetes, Drug target, TALENS technology

Introduction

The G-protein receptors (GPCRs) are the largest family of proteins targeted by drug discovery. GPCRs are crucial molecular sensors for many vital physiological processes. GPR21 is part of the GPCRs family and shares 71% identity to GPR52. It was identified along with GPR22 and GPR23 based on their homology to GPR20 (O’Dowd et al., 1997). Originally, GPR21 was detected in regions of the brain and later, several other tissues as spleen, brown fat, and macrophages, were reported to express high levels of GPR21 mRNA (Gardner et al., 2012; Osborn et al., 2012). The natural ligand of GPR21 remains unknown; however, constitutive activity of the GPR21 receptor has been observed when it was co-transfected with Gα15/16 proteins in HEK293 cells (Gardner et al., 2012; Xiao et al., 2008). Also, GPR21 has been reported to activate the Gq pathway on calcium-sensitive CHO cells (Bresnick et al., 2003).

In Gpr21 KO mice generated with Gpr21 KO ES cells obtained from Deltagen (Deltagen GPR21, Deltagen San Mateo, CA), Osborn et al. and Gardner et al. have reported that glucose tolerance and insulin sensitivity were improved when compared to their wildtype control mice (Gardner et al., 2012; Osborn et al., 2012). These Gpr21 KO mice were leaner than their wildtype littermate control (Osborn et al., 2012) and were resistant to diet-induced obesity (Gardner et al., 2012), making GPR21 a potential drug target candidate for the treatment of diabetes and obesity. Reduced inflammation and macrophage infiltration were also observed in the KO mice (Osborn et al., 2012).

Mouse Gpr21 gene is located on chromosome 2 within the intron of Rabgap1 gene, between exon 13 and 14 according to the UCSC GRCm38/mm10 assembly. Strbp gene is located on the opposite strand in the same region. Deltagen Gpr21 KO mice contain a deletion in the gene of exon one with the insertion of a 5.3 kb lacZ/Neo cassette. After considering the location of the insertion of the neo cassette, we hypothesized that the gene structures, the expression and physiological functions of Rabgap1 and Strbp may have been altered.

In brief, small RAB GTPases are essential for the coordination of vesicle budding, transport, and fusion of vesicles (Frasa et al., 2012). RAB proteins are activated by guanine nucleotide exchange factors (GEFs) and inactivated by RAB GTPase activating proteins (RABGAPs). The TBC (TRE2-BUB2-CDC16) domain facilitates the RAB GTP hydrolysis from the GTP-bound active form to the GDP-bound inactive form. However, the physiological function of RABGAP1 (TBC1D11) is less understood. It may be implicated in microtubule and Golgi dynamics during cell cycle and regulation of spindle checkpoint (Cuif et al., 1999; Miserey-Lenkei et al., 2006). STRBP (SPNR) is a microtubule-associated RNA-binding protein localized in developing spermatids and plays an important role in normal spermatogenesis and sperm function (Pires-daSilva et al., 2001). Strbp deficient mice are smaller, have neurological defects, a high premature mortality rate, show reduced fertility and mating drive as well as abnormal sperm motility.

After further analysis of the Deltagen Gpr21 KO mice, we observed that Rabgap1 mRNA expression levels were modified. To assess if the metabolic phenotype observed in these KO mice (Gardner et al., 2012; Osborn et al., 2012) was solely related to knocking out the Gpr21 gene, we generated a new line of Gpr21 KO mice using the TALENS technology. We created a 29 bp deletion within the coding exon of Gpr21 (Gpr21 TAL 29bp), a location very close to the ATG, an out of frame mutation and an early termination of Gpr21. The phenotypic analysis of our new Gpr21 TAL 29bp KO mice showed no improvement of the previously observed metabolic parameters that were identified in Deltagen Gpr21 KO mice. The originally published improved metabolic phenotype of the Deltagen Gpr21 KO mice was not solely due to the deletion of the Gpr21 gene, Rabgap1 may have been implicated.

Materials and methods

Animals and Gpr21 KO mice generation

All animal experiments were approved by the Institutional Animal Care and Use Committee of Amgen (animal protocol #2006-00010). Mice were housed in a pathogen-free facility with a 12 h light-dark cycle. Mice were allowed ad libitum access to water and food. They were fed with normal chow (Harlan 2920) before starting a high fat diet (Research Diets D12451, 45 kcal % fat).

Gpr21 KO mice were created using a pair of transcription activator-like effector nucleases (TALENs) from Life Technologies targeting exon 2 of mouse Gpr21 TALEN binding sites are underlined below with a 15 base pair spacer between the 2 sites.

5 ’- TGAACTCCACCTGGGATGG TAATCAGAGCAGCCA TCCTTTCTGTCTTCTGGCA

ACTTGAGGTGGACCCTACC ATTAGTCTCGTCGGT AGGAAAGACAGAAGACCGT - 5’

Design, cloning and validation of the TALENs were performed by Life Technologies. Messenger RNA (provided from Life Technologies) for each of the TALENs were diluted in RNAse free microinjection buffer to a final concentration of 4.0 ng/µl for each TALEN (8.0 ng/µl total concentration). The TALENs were microinjected into the pronucleus of fertilized one-cell embryos (0.5 days post coitus) obtained from the mating of C57BL/6 (Taconic) males to superovulated C57BL/6 (Taconic) female mice. Microinjected eggs were transferred to pseudopregnant Swiss Webster recipients. Founder pups were screened for TALEN induced mutations in Gpr21 by sequencing across exon 2. Two founders, one with a 5 bp deletion and the other with a 29 bp deletion were expanded for further analysis.

Genomic DNA preparation and PCR genotyping

Genomic DNA was prepared from liver, BAT and spleen using DNeasy blood and tissue kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. PCR was carried out using the primers 5’-CAGCATGAAGTGAGAGCCAG-3’ and 5’-CAAGTAGCCCAGTGCCAGAAG-3’.

Microarray and data analysis

For the microarray analysis, mRNA was isolated from 6 animals for each group using Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA) and processed following the protocols described in section 2 (Eukaryotic Sample and Array Processing; 701024 rev 1) of the Affymetrix Technical Manual. Briefly, 5 µg total RNA was used to synthesize cDNA (10 pmol of T7-(dT)24 primer, and Superscript II (Invitrogen, Carlsbad, CA). Purified double-stranded cDNA (MinElute Reaction Cleanup Kit, Qiagen, Valencia, CA) was used to generate biotinylated cRNA using Bioarray HighYield RNA Transcript labeling Kit (Enzo Diagnostics, Farmingdale, NY) followed by purification with Qiagen RNeasy Mini kit and hybridization to the Affymetrix HT MG 430 PM array. Arrays were washed on a GeneChip Fluidic Station 450 (EukGE_WS2v4_450 protocol) and scanned using the Affymetrix GeneChip Scanner 3000 (Affymetrix, Santa Clara, CA). Data analysis was conducted with R (version 2.15, http://r-project.org), Bioconductor (version 2.10, http://bioconductor.org/) and ArrayStudio (Omicsoft, version 8.0). Briefly, Affymetrix CEL files were normalized in Bioconductor using the GCRMA method. Differentially regulated genes were identified using a moderated t-test. False discovery rate adjusted P-values were calculated using the method of Benjamini & Hochberg (1995).

RNA isolation and expression assays

Total RNA was isolated using Qiagen midi RNA preparation kit (Qiagen, Valencia, CA). The total RNA concentration was determined with a Nanodrop (ThermoFisher Scientific, Wilmington, DE). QPCR was performed using 10 ng RNA per well, Taqman master mix (Applied Biosystems, Foster City, CA). Rabgap1 gene expression was assessed using Taqman probes from Applied Biosystems (Mm01327207_m1 and Mm01327199_m1). Gpr21 mRNA level was measured using the forward primer 5’-CACCTGGGATGGTAATCAGAG-3’, reverse primer 5’- TCACAATGATGTTGCCAGAAAT-3’ and probe 5’ FAM/TTCTGGCAC/Zen/TGGGCTACTTGGAAA/IABkFQ-3’ from Integrated DNA Technologies (Coralville, IA). Results were evaluated using the ΔΔCT method and normalized relative to the expression of glyceraldehyde-3-phosphate dehydrogenase using QuantStudio 6 and 7 Flex Real-Time PCR System Software in a QuantStudio™ 7 Flex System.

Glucose tolerance test (GTT)

At 6 am, mice were fasted for 4 hr. Glucose levels were measured and blood samples were taken from the tail vein before oral glucose tolerance test (OGTT) was initiated. GTT was performed by oral administration of a bolus glucose (2g/kg body weight). Glucose levels were measured at 20, 40 and 60 min after glucose administration by using AlphaTrak blood glucose meter (Abbott, Chicago, IL).

Serum insulin measurement

Blood samples were collected from tail vein when mice were at 11 weeks old, 15 weeks old (on HFD for 4 weeks) and 26 weeks old (on HFD for 15 weeks) Terminal blood was collected by cardiac puncture. Blood samples were centrifuged at 10000 rpm. Serum insulin levels were determined by using Insulin (mouse) ultra-sensitive EIA kit 80-INSMSU-E10 or mouse high range insulin ELISA 80-INSMSH-E01 (ALPCO Diagnostics, Salem, NH).

Results and discussion

Rabgap1 expression was changed in Deltagen Gpr21 KO mice

We isolated RNA from spleen, liver, perirenal fat (WAT) and brown fat (BAT) from Deltagen Gpr21 KO mice and their wildtype littermate control mice. Microarray results identified that Rabgap1 was the only gene that was changed in all the tissues analyzed. Rabgap1 mRNA levels were increased by 1–4 fold when using two independent Rabgap1 probes (Figures 1A, B, Table 1) located upstream of Gpr21 gene and were down regulated by 5–15 fold when using one Rabgap1 probe located downstream of Gpr21 gene. This result indicated that the genetic modifications in the original KO line modified Rabgap1 mRNA expression levels (Figure 1B). Strbp mRNA expression levels were not changed when using multiple probes that were located upstream and downstream of the Strbp gene (Figure 1A).

58f95ffb-5686-4bf3-ad4b-704451f1230a_figure1.gif

Figure 1.

(A) Mouse Gpr21 is located on Chromosome 2 within the intron of Rabgap1 gene between exon 13 and 14 on the positive strand according to UCSC GRCm38/mm10 assembly. Strpb gene is on the opposite strand in the same region. The blue arrow represents the positive strand while the green one the negative strand. The bars under the genes represent microarray probe sets from Affymetrix mouse array HT MG-430PM platform. There is no probe set covering Gpr21 gene. The closest probe set 1421125_PM is located at 2,866 bases upstream of Gpr21. (B) The level of Rabgap1 transcript was shown as normalized expression intensity. RNA was prepared from BAT, liver, spleen and WAT of Deltagen Gpr21 KO mice and their WT littermate controls. Probe 1443535_PM, 1460486_PM and 1424188_PM allow detection of Rabgap1 mRNA expression levels.

Table 1. Sequences of the different probes used.

Primer/probeSequence (5'-3') or product No
genotyping forward primerCAGCATGAAGTGAGAGCCAG
genotyping reverse primerCAAGTAGCCCAGTGCCAGAAG
Gpr21 qPCR forward primerCACCTGGGATGGTAATCAGAG
Gpr21 qPCR reverse primerTCACAATGATGTTGCCAGAAAT
Gpr21 qPCR probeFAM/TTCTGGCAC/Zen/TGGGCTACTTGGAAA/IABkFQ
Rabgap1 primer/probe set 1Applied Biosystems, Mm01327207_m1
Rabgap1 primer/probe set 2Applied Biosystems, Mm01327199_m1
Strbp primer/probe setApplied Biosystems, Mm00486379_m1
microarray probe 1460486_PMProbe sequence (5'-3')
GACAAAAGTTCGAGTGTGCTCACCT
GTTCGAGTGTGCTCACCTAATGAAA
GTGTGCTCACCTAATGAAAGGTTAT
CCCTTCAGCAAACGAAGCACTACTG
AGCACTACTGAAAACTTCTTTCTGA
ATATGAAGTTGTGTGTTTGGAGAGT
GAAAACCACAGCCAGTCCTTCAGTT
TTCAGTTCGCCTGCCACAGTCTGGA
GATAATGATGAACCTCTCTTGAGTG
TGAACCTCTCTTGAGTGGATTTGGG
GGGATGTATCCAAAGAATGTGCAGA
microarray probe 1443535_PMProbe sequence (5'-3')
GAAATTAAAGCTATGTGACCACCCC
AAACATTTCCATTCCATCTGTCAAA
GGCTAAGAAGTTCCAGGGTTTCCTG
CAGGGTTTCCTGCATTCCAAGAATG
TTGTTTAACCCACAGAAGTTTTATG
GTTTTATGTCATTTAGCCTGGTCTA
AAAAGCTTGGGATCAGAACTGTTTC
ATGGTTTTGTCTGTCTTGGTTTGAT
TGTTGACTTATCAGTTAAACCACCA
GAAACCTTAGGCTATTGCAAGACTT
ATGCATACCTAGTTATTGCAGCTTC
microarray probe 1424188_PMProbe sequence (5'-3')
GAAAGTCCCTACACACTGTAAAGTC
TAAAGTCCTACTTTCCTGGCTGGAT
GGCTGGATCTCTGTCAGGCCTCTGA
CAGGTGTACATCTCACTGGTCAGGT
GAAAATGGCAGTTTTAGCACCTTTT
AGTGGTGTCACAAGTGGCTCATCCT
CTCTGTGTGCAGGTAGCTTGGGTTT
GTTGGCTTTTCTAATGCTTGATGAG
TCTGTCTCGTTCAGTTAACCCAAAC
AACCCAAACAGTATAAGCCCATCTT
TGGACATTGTGTGCTAGGGTAGTTT

Generation of Gpr21 specific KO (Gpr21 TAL 29bp) mice

A new line of Gpr21 KO mice (Gpr21 TAL 29bp) was created by deleting a 29 bp within the coding exon of Gpr21 gene. Using the TALENS technology, a 29 bp very close to the ATG codon was deleted, thus causing an out of frame mutation and early termination of Gpr21 gene (Figure 2A). Homozygous Gpr21 KO mice genotype was confirmed by PCR using primers located upstream and downstream of the 29bp deletion from genomic DNA of several tissues (Figure 2B). As predicted, a 100 bp band was identified for the wildtype mice and a 71 bp band for the Gpr21 TAL 29 bp homozygous KO mice (Figure 2C). The PCR fragment was sequenced and a 29 bp deletion was confirmed. From RNA isolated out of BAT and liver, no detectable Gpr21 mRNA levels were identified in Gpr21 TAL 29 bp KO mice using qPCR and Gpr21 probes that are located around the 29 bp deletion region (Figure 2D). Similar mRNA levels were detected using primer/probe that were located downstream of 29 bp deletion in exon 2 (data not shown). The result confirmed that Gpr21 transcripts in Gpr21 TAL 29bp KO mice had the 29 bp deletion.

58f95ffb-5686-4bf3-ad4b-704451f1230a_figure2.gif

Figure 2.

(A). Sequence and location of the 29 bp deletion in Gpr21 TAL 29bp KO mice. (B). sequence and location of genotyping primers. (C). Genotyping of Gpr21 TAL 29 bp KO mice. Genomic DNA was generated from liver and BAT. PCR with genotyping primers amplified a 100 bp fragment from the genome of WT littermate mice and a 71 bp fragment from homozygous Gpr21 TAL 29 bp KO mice. C: commercial mouse genomic DNA. L: 20 bp DNA ladder. (D). No wildtype Gpr21 transcript were detected. qPCR analysis of Gpr21 gene in liver and BAT using primer/probe set that is located in the 29 bp region and only detect wildtype Gpr21 transcript.

Rabgap1 and Strbp expression levels are not affected in Gpr21 TAL 29bp KO mice

Rabgap1 mRNA expression levels were assessed using 2 Taqman probes (Table 1) that amplified different regions of Rabgap1 in liver and BAT of KO and their wildtype littermate mice. One primer/probe set spanned Rabgap1 exon 3 and 4 (Table 1), which is located upstream of the Gpr21 gene. Another primer/probe set spanned Rabgap1 exon 17 and 18, which is located downstream of the Gpr21 gene (Table 1). Rabgap1 mRNA expression levels in Gpr21 TAL 29 bp KO mice were not changed compared with their wildtype littermate mice with both primer/probe sets (Figure 3A). Liver and BAT Strbp mRNA expression levels were also not changed between Gpr21 TAL 29bp KO mice and their wildtype littermate mice (Figure 3B).

58f95ffb-5686-4bf3-ad4b-704451f1230a_figure3.gif

Figure 3.

(A) Rabgap1 mRNA expression levels were assessed using 2 Taqman probes in liver (top left panel) and BAT (top right panel) of GPR21 TAL 29 bp KO and their wildtype littermate mice. (B) Liver (bottom left panel) and BAT (bottom right panel) strbp mRNA expression levels were assessed in wildtype and Gpr21 TAL 29 bp KO mice.

Gpr21 TAL 29bp KO mice do not show improvements in glucose and insulin metabolism

The body weight, OGTT and insulin levels of Gpr21 TAL 29 bp KO mice fed a normal chow were not different from the ones of their wildtype littermates (Figures 4A–C). Mice were then fed with a 45% high fat diet to induce obesity and insulin resistance. After 4 weeks and 15 weeks of high-fat feeding, Gpr21 TAL 29 bp KO mice gained similar body weight to that of their wildtype littermates, showed no difference on glucose tolerance and fasting blood glucose and insulin levels were not different from their wildtype littermates (Figures 4D–I), respectively.

58f95ffb-5686-4bf3-ad4b-704451f1230a_figure4.gif

Figure 4.

At 11 weeks of age, body weight (Figure 4A), OGTT (Figure 4B) and insulin levels (Figure 4C) were measured in wildtype (open bar and open circle) and Gpr21 TAL 29bp KO Mice (filled bar and open triangle) fed a normal chow diet. At 15 weeks of age and at 26 weeks of age body weight (Figures 4D & 4G), OGTT (Figures 4E & 4H) and insulin levels (Figures 4F & 4I) were measured in wildtype (open bar and open circle) and Gpr21 TAL 29bp KO Mice (filled bar and open triangle) fed a high fat diet for 4 weeks and 15 weeks, respectively.

Next steps

The results of Osborn and Gardner suggest that GPR21 may play an important role in regulating body weight and glucose metabolism. However, in our attempts presented here to replicate their findings we didn’t see the same effect. We would therefore like to encourage an open discussion in the wider community to further elucidate the potential effectiveness of pharmacologically inhibiting GPR21.

Data availability

Open Science Framework: Dataset: GPR21 KO mice demonstrate no resistance to high fat diet induced obesity or improved glucose tolerance, doi: 10.17605/OSF.IO/SQB2X (Wang et al., 2016).

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 04 Feb 2016
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Wang J, Pan Z, Baribault H et al. GPR21 KO mice demonstrate no resistance to high fat diet induced obesity or improved glucose tolerance [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2016, 5:136 (https://doi.org/10.12688/f1000research.7822.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 04 Feb 2016
Views
55
Cite
Reviewer Report 24 Mar 2016
Michelle Kimple, Division of Endocrinology, Diabetes and Metabolism, Department of Medicine, University of Wisconsin-Madison, Madison, WI, USA 
Approved with Reservations
VIEWS 55
The article by Wang and colleagues addresses the resistance of GPR21 knockout mice to insulin resistance and high-fat diet induced obesity and metabolic dysregulation. Two previous publications using a different GPR21 knockout mouse model generated with ES cells from Deltagen ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Kimple M. Reviewer Report For: GPR21 KO mice demonstrate no resistance to high fat diet induced obesity or improved glucose tolerance [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2016, 5:136 (https://doi.org/10.5256/f1000research.8421.r12685)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
76
Cite
Reviewer Report 07 Mar 2016
Richard Neubig, Department of Pharmacology and Toxicology, Michigan State University, East Lansing, MI, USA 
Approved
VIEWS 76
The title is appropriate.
 
The design, methods, and analysis are generally complete and appropriate with the following exceptions:
  1. The methods to obtain data from the Deltagen GPR21 mutant mice are not sufficiently described. The source of the mice, genetic, background, and backcross
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Neubig R. Reviewer Report For: GPR21 KO mice demonstrate no resistance to high fat diet induced obesity or improved glucose tolerance [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2016, 5:136 (https://doi.org/10.5256/f1000research.8421.r12759)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
87
Cite
Reviewer Report 07 Mar 2016
Mary Pelleymounter, Office of Translational Research Program (OTR), National Institute of Neurological Disorders and Stroke (NINDS), Bethesda, MD, USA 
Approved with Reservations
VIEWS 87
Dr. Wang and colleagues have provided intriguing evidence to suggest that the metabolic phenotype of the Deltagen GPR21 KO mouse may not be completely due to deletion of the GPR21 gene.  Rather, these authors suggest that the metabolic phenotype of ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Pelleymounter M. Reviewer Report For: GPR21 KO mice demonstrate no resistance to high fat diet induced obesity or improved glucose tolerance [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2016, 5:136 (https://doi.org/10.5256/f1000research.8421.r12620)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 04 Feb 2016
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.