ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Characterization of CTX-M-15-Klebsiella pneumoniae from inpatients and outpatients of a teaching hospital

[version 1; peer review: 1 approved with reservations, 1 not approved]
PUBLISHED 04 Jun 2021
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Background 
The presence of Extended-spectrum β-lactamase (ESBL) positive bacteria in hospital setting is an aggravating influential factor for hospitalized patients, and its consequences may be hazardous. Therefore, there is a need for rapid detection methods for newly emerging drug-resistant bacteria. This study was aimed at the molecular characterization of ESBL-positive Klebsiella pneumoniae isolates recovered from clinical samples.  
Methods 
A total of 513 K. pneumoniae isolates were obtained from various clinical samples during June 2019 to May 2020. The collected isolates were investigated for antimicrobial susceptibility (antibiogram), and PCR and DNA sequencing were performed to analyse the ESBL genes.  
Results 
Among the 513 isolates, as many as 359 (69.9%) were ESBL producers and 87.5% were multi-drug resistant, while none had resistance to imipenem. PCR scored 3% blaTEM, 3% blaSHV, and 60% blaCTX-M-15 genes for the tested isolates.  
Conclusion 
The study showed that CTX-M-15 was the major prevalent ESBL type among the isolates. Additionally, all the isolates were susceptible to carbapenems. Screening and detection of ESBL tests are necessary among all isolates from the enterobacteriaceae family in routine microbiology laboratory to prevent associated nosocomial infections. A larger study is essential to understand molecular epidemiology of ESBL producing organisms to minimize morbidities due to these multidrug resistant organisms.

Keywords

K. Pneumoniae, ESBL, TEM, SHV, CTX-M-15

Introduction

The emergence of Extended-spectrum β-lactamase (ESBLs) producing organisms has imposed a great threat on majority of the antibiotic classes, particularly cephalosporins.1 The situation worsens when the patient infected with ESBL-producing organism is administered an antibiotic to which the organism is resistant.1 Clinical practitioners globally have been facing problems related to plasmid mediated ESBL producing Klebsiella pneumoniae (K. pneumoinae). These plasmids contain genes encoding resistance to antibiotics such as aminoglycosides, sulfonamides, tetracycline, chloramphenicol, and quinolones.2 Cephalosporins are β-lactam antibiotics that are widely used in clinical practice and in the treatment of bacterial infections.3 In addition, K. pneumoniae is reported in nosocomial infections and community acquired infections.4

A study conducted by Maltezou et al.5 revealed that the incidence rate of ESBL producing K. pneumoniae infection was 16.71% for Northern Europe, 24.41% for Southern Europe, 58.71% for Eastern Europe, 28.2% for the Asia Pacific region, 51.9% for South America, and 12.3% for North America.5

CTX-M-type β-lactamase, has become more predominant than conventional SHV and TEM-type ESBL, which have covered an extensive range of clinically significant bacteria and over a wide environmental area.6 Moreover, strains that yield ESBL often reveal resistance to antibiotics belonging to other classes (i.e. aminoglycosides, quinolones, and sulfonamides); making its management more complicated.7

Consequently, this class of bacteria makes a need to ensure the reporting of ESBL producers in clinical isolates and detection of newly emerging drug resistant isolates. The changing trends of drug resistant ESBL-producing K. pneumoniae need time to watch for management, confinement and isolation of patients in hospitals before discharge. It is also necessary to monitor the prevalence and types of ESBLs and define the appropriate therapeutic options accordingly. Hence, the purpose of the current study was to observe the current trends of ESBL producing K. pneumoniae drug resistant patterns and to identify the occurrence of ESBL genes in Sindh region of Pakistan.

Methods

Isolation and identification

A total of 1458 non-duplicate clinical samples were collected between June 2019 and May 2020 from outpatient and inpatient wards of People's University of Medical and Health Sciences, Nawabshah, Pakistan through its diagnostics and research laboratory. The samples were not specifically collected for this research, they were used after the completion of routine laboratory investigations upon the permission of the concerned laboratory's authority. The isolation of bacteria was carried out by conventional bacteriological techniques and identification was confirmed by API 20E identification kit (BioMerieux, France).8 As many as 513 K. pneumoniae isolates from various clinical samples and sites (Figure 1A) were obtained and included in the present study.

d5db4120-bafa-45c6-968f-e9d91e0e25fc_figure1.gif

Figure 1.

K. pneumoniae isoaltes obtained from various clinical samples showed high prevalence as blood borne infections (A); genotypic distribution showed blaCTX-M-15 to be highly prevalent (B); age group wise analysis showed elderly group of 50 years old and above showed high incidences (C); ESBL positivitiy to be 70% among all isolates tested (D), with their antibiotic susceptibility profile (E).

Inclusion and exclusion criteria

Patients referred by their primary physicians for screening tests (such as blood complete count and erythrocyte sedimentation rate (ESR)) were recruited in the study. The clinical samples including blood, sputum, urine, cerebrospinal fluid, tracheal secretions, and pus samples were collected by standard techniques (Figure 1A). The clinical samples, which yielded the K. pneumoniae were selected for further assessment, while others were excluded. The demographic data was retrieved from clinical survey that included age, gender, specimen type, town, and susceptibility patterns (Table 2).

Antimicrobial susceptibility test

Antimicrobial susceptibility testing (AST) was performed by Kirby Bauer method on Mueller-Hinton agar plates (Beckton Dickinson, Sparks, MD, USA) according to Clinical Laboratory Standards Institute (CLSI).8 Disks (Beckton Dickinson) comprising of the following antibiotics were used: cefixime 30 μg, amoxicillin 30 μg, ceftazidime 30 μg, cefotaxime 30 μg, Ofloxacin 10 μg, imipenem 10 μg, amikacin 30 μg, gentamicin 10 μg, ciprofloxacin 5 μg and chloramphenicol 30 μg.

ESBL screening and confirmation by phenotypic methods

Double disk diffusion methods were used to detect ESBL using four antibiotic disks: cefotaxime 30 μg, cefotaxime with clavulanic acid 10 μg, ceftazidime 30 μg, and ceftazidime with clavulanic acid 10 μg. A more than 5 mm increase in zone of inhibition width for whichever antimicrobial agent tested in combination with clavulanic acid against its zone of inhibition when tested alone was labelled as ESBL positive.9 The inoculum and incubation conditions were the same as recommended for standard disk diffusion. K. pneumoniae ATCC 700603 (American type culture collection, ATCC, Manassas, USA) was used as quality control strain.

Detection of ESBL genotypes by PCR amplification

Bacterial genomic DNA was seperated by boiling the young bacterial colony in 50μl distilled water in a hot bath set at 98°C. This DNA template was used for all PCR reactions. Amplification of blaTEM, blaSHV and blaCTX-M-15 ESBL genes was done on GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA, USA). The primers used are given in Table 1. The PCR yields were run on 1% agarose gels and observed in UV light. Purified PCR products of CTX-M genes were sequenced on an Applied Biosystems 3730 DNA analyzer (Applied Biosystems, Foster City, CA, USA).

Table 1. List of primers used.

ESBL GenePrimerSequence (5′-3′)*Product size (bp)Annealing temperature (°C)
blaTEMForwardATGAGTATTCAACATTTCCGTG86155
ReverseTTACCAATGCTTAATCAGTGAG
blaSHVForwardATTTGTCGCTTCTTTACTCGC105160
ReverseTTTATGGCGTTACCTTTGACC
blaCTX-M-15ForwardCACACGTGGAATTTAGGGACT99650
ReverseGCCGTCTAAGGCGATÁAACA

* Ref: Muzaheed et al., 2008 (32).

Data analysis

The data were analyzed by Statistical Package of Social Sciences (SPSS) version 21.0. Continuous and categorical variables were analyzed by t-test and Chi-square testing, respectively (these tests can also be carried out on the open source software R). Variance of resistance levels of various antimicrobials in ESBL producing isolates versus non-ESBL producing isolates were calculated by the Fisher exact test. The data was analyzed at 95% Confidence interval (p ≤ 0.05 indicates a significant difference).

Results

During the study period, a total of 513 (35.18%) K. pneumoniae were isolated. From those 513 positive cultures, 411 (80.1%) belonged to males and 102 (19.8%) to females (p = 0.0001). The demographic characteristics of patients including age, gender, rural or urban, and clinical interventions are summarized in Table 2. The results show that the majority of patients were in the older age group (50 and above) and lived in urban areas. The categories of patient's ages have been shown in Figure 1C. The mean age of the total study subjects was 48.5 ± 8.9 years.

Table 2. Demographic characteristics and interventions in study population (n = 513).

SpecimenKlebsiella pneumoniae
N%
Age (mean ± SD)47 ± 17.5 (range: 9-56 years)
Male41180.1
Female10219.8
Rural12424.17
Urban38975.8
Children11522.41
Old age39877.58
History of interventions
Nasogastric intubation
Intravenous line
Central venous line
Urinary catheters
Tracheotomy
Endotracheal intubation
Surgery

76
319
11
217
9
23
19

14.81
62.18
2.14
42.3
1.75
4.39
3.7

Out of 513 isolates 359 (69.9%) were ESBL producing K. pneumoniae (Figure 1D). The incidences of ESBL was higher in males as compared to females. The frequency of ESBL producing K. pneumoniae from different samples (n = 359) has been shown in Table 3 and Figure 1A. The means ± SD age of patients with ESBL positive and negative was 47 ± 17.5 years and 47.5 ± 12.8 years, respectively (p = 0.093).

Table 3. Frequency of ESBL - K. pneumoniae in various clinical specimens (n = 513).

SpecimenESBL Positive
Klebsiella pneumoniae
N%
Blood11221.8
Sputum7113.8
Pus519.9
Cerebrospinal fluid122.3
Ear swabs50.97
Wound swabs112.14
Pleural fluid71.36
Urine8516.5
Tracheal secretions50.97
Total359/51369.9

The results show that 64% of K. pneumoniae in our sample were resistant to Amoxicillin and Cefixime. In addition, an important drop of 30–40% was perceived in the susceptibility for all Cephalosporins. However, K. pneumoniae presented a dissimilar sensitivity rate to Chloramphenicol, Ofloxacin, Gentamicin and Amikacin with 94%, 98%, 97%, and 97%, respectively and depicted in Table 4.

Table 4. Antibiotic resistance pattern.

Name of antibioticsSusceptibility (%)Resistance (%)
Ceftazidime (CAZ)3565
Cefotaxime (CTX)3367
Cefixime (CFM)3664
Amoxicillin (AM)3664
Ofloxacin (OFL)9802
Imipenem (IPM)10000
Ciprofloxacin (CIP)10000
Chloramphenicol (C)9406
Gentamicin (CN)9703
Amikacin (AK)9703

Regarding the PCR and DNA sequencing of ESBL genotypes, it was found that all of the ESBL-positive K. pneumoniae isolates had one or more ESBL genes that were tested in the present study and presented in Table 5. Overall, 83.56% (300/359) of K. pneumoniae isolates were positive for one or more ESBL genes. The PCR assay and DNA sequencing results indicated the following frequencies of ESBL genotypes: 85% blaCTX-M-15 gene, 26% blaSHV gene, and 28% blaTEM gene.

Table 5. Prevalence of ESBL genotypes.

GenotypesIncidences n (%)*
blaTEM9 (3%)
blaSHV9 (3%)
blaCTX-M-15180 (60%)
blaTEM+ blaSHV+ blaCTX-M-1515 (5%)
blaTEM+ blaSHV27 (9%)
blaTEM+ blaCTX-M-1533 (11%)
blaSHV+ blaCTX-M-1527 (9%)

* Overall Total CTX-M-15 is 255 [85]; SHV = 78 [26] and TEM = 84 [28].

Discussion

ESBL's are the major causes of β-lactam antibiotic resistance, particularly in K. pneumoniae, which is amongst the most common gram-negative bacteria belonging to Enterobacteriaceae families.10 A study from Ziauddin University Karachi, Pakistan has showed that ESBL producing K. pneumoniae frequency is 84.16% amongst reported cases.11 Similarly, Saleem et al. (Aga Khan University, Karachi, Pakistan) have reported a frequency of 80% of ESBL producing K. pneumoniae.12 These findings were higher as compared to the results presented in the current study, which showed that the frequency of ESBL producing K. pneumonia is 69.6% with a higher incidence in male than in female patients. In this repect, the frequency of EBSL producing K. pneumoniae varies from one institution/hospital to another. Several factors could govern this variation such as; the use of antibiotics, drug dose, infection control measures, treating physicians, and the duration of drug therapy - all of these elements may cause a difference in results. The frequency of ESBL producing K. pneumoniae in previous research conducted at Aga Khan University Karachi, Pakistan was 30.1% and 47.8%, which is low compared to the present study, as well as, previous studies conducted by Mansouri et al.10 and Ejaz et al.13 A Pakistani study found a frequency of ESBLs producing K. pneumoniae of 70%,14 which is in agreement with our study.

Carbapenems are often the final influential therapy of choice to treat infections resulting from MDR Enterobacteriaceae. Based on our study and other studies, 100% sensitivity was seen with Imipenem, which have been found to be the most effective antibiotics on the isolates that produce ESBLs. This is an important result of the present study because many infections can be treated with Carbapenems.12,15

blaCTX−M is a predominant genotype in this area of the subcontinent. A further study from Pakistan has reported that 72% of ESBL producing strains had the blaCTXM−15 gene, which was higher than the prevalence of blaCTX-M gene reported in the present study.16 Limited studies from different regions have also shown a higher prevalence of the blaCTX-M genotype amongst strains including 84.7% (Chile), whereas a very high prevalence of 98.8% was reported in China and, significantly, a low prevalence of 13.6% in Tanzania.1719

In conclusion, the findings of the current study emphasizes the urgent need for screening and surveillance of ESBL producing K. pneumoniae in routine microbiology laboratories for early detection, prompt intervention, and successful clinical management before exacerbation of the infection magnitude. In this regard, the current findings may be a valuable contribution to the medical literature providing physicians with an updated prevelance status of ESBL producing K. pneumoniae. Finally, the limited sample size along with the limited time frame are two common limitations, which could affect the outcomes of the study.

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 04 Jun 2021
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Muzaheed M, Sattar Shaikh N, Sattar Shaikh S et al. Characterization of CTX-M-15-Klebsiella pneumoniae from inpatients and outpatients of a teaching hospital [version 1; peer review: 1 approved with reservations, 1 not approved]. F1000Research 2021, 10:444 (https://doi.org/10.12688/f1000research.53221.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 04 Jun 2021
Views
32
Cite
Reviewer Report 05 Jul 2021
Abbas Farahani, Infectious and Tropical Diseases Research Center, Hormozgan Health Institute, Hormozgan University of Medical Sciences, Bandar Abbas, Iran 
Not Approved
VIEWS 32
Summary: 

This research article seeks to isolate and characterize ESBL-producing K. pneumoniae from inpatients and outpatients. The ESBL genotype and molecular relatedness of strains identified here were done using standard and acceptable methods and procedures. K. pneumoniae ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Farahani A. Reviewer Report For: Characterization of CTX-M-15-Klebsiella pneumoniae from inpatients and outpatients of a teaching hospital [version 1; peer review: 1 approved with reservations, 1 not approved]. F1000Research 2021, 10:444 (https://doi.org/10.5256/f1000research.56580.r88330)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 23 Jul 2021
    Saeed Sattar Shaikh, Department of Clinical Laboratory Science, Imam Abdulrahman Bin Faisal University, Dammam, Saudi Arabia
    23 Jul 2021
    Author Response
    We thank the reviewer for taking time and reviewing our article. We have revised our manuscript to address the comments. Please, find below our responses to reviewer comments.
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 23 Jul 2021
    Saeed Sattar Shaikh, Department of Clinical Laboratory Science, Imam Abdulrahman Bin Faisal University, Dammam, Saudi Arabia
    23 Jul 2021
    Author Response
    We thank the reviewer for taking time and reviewing our article. We have revised our manuscript to address the comments. Please, find below our responses to reviewer comments.
    ... Continue reading
Views
30
Cite
Reviewer Report 05 Jul 2021
SUPRIT DESHPANDE, HIV Vaccine Translational Research Laboratory, NCR Biotech Science Cluster, Translational Health Science & Technology Institute, Faridabad, Haryana, India 
Approved with Reservations
VIEWS 30
In this manuscript “Characterization of CTX-M-15-Klebsiella pneumoniae from inpatients and outpatients of a teaching hospital” by Muzaheed et al., the authors studied and surveyed the prevalence of ESBL producing genes in Klebsiella pneumoniae infections. The authors have screened K. pneumoniae ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
DESHPANDE S. Reviewer Report For: Characterization of CTX-M-15-Klebsiella pneumoniae from inpatients and outpatients of a teaching hospital [version 1; peer review: 1 approved with reservations, 1 not approved]. F1000Research 2021, 10:444 (https://doi.org/10.5256/f1000research.56580.r86850)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 23 Jul 2021
    Saeed Sattar Shaikh, Department of Clinical Laboratory Science, Imam Abdulrahman Bin Faisal University, Dammam, Saudi Arabia
    23 Jul 2021
    Author Response
    We thank you for your valuable comments and suggestions.  We have revised our manuscript accordingly. Please, find below our responses to reviewer comments.
    • This paper imparts more of
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 23 Jul 2021
    Saeed Sattar Shaikh, Department of Clinical Laboratory Science, Imam Abdulrahman Bin Faisal University, Dammam, Saudi Arabia
    23 Jul 2021
    Author Response
    We thank you for your valuable comments and suggestions.  We have revised our manuscript accordingly. Please, find below our responses to reviewer comments.
    • This paper imparts more of
    ... Continue reading

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 04 Jun 2021
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.