ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Whole-exome sequencing of de novo genetic variants in a Chinese family with a sporadic case of congenital nonsyndromic hearing loss

[version 1; peer review: 1 approved, 1 approved with reservations]
PUBLISHED 02 Feb 2021
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Background: We examined the genetic variants of a Chinese family with a 22-month-old infant with sporadic non-syndromic sensorineural hearing loss (NSHL).
Methods: The whole-exome sequence data in the family, especially the de novo variants presented in the patient, were analyzed and the effect of the disease-causing genetic variants on the protein expression level and cellular localization were examined by cell-based functional assay.
Results: The infant had no known NSHL-causing variants, except two compound heterozygous variants in connexin26 gene GJB2; one was the c.79G>A, c.341A>G haplotype from the asymptomatic mother which was benign, and the other was a de novo pathogenic c.262G>C (p.A88P). In vitro, GJB2 with c.262G>C was weakly expressed and displayed a punctate distribution in the cytoplasm and cytomembrane, while wild type GJB2 was robustly expressed in the cytomembrane. We deduced that the de novo pathogenic GJB2 c.262G>C exacerbated loss-of-function in the context of leaky variants c.79G>A, c.341A>G in the patient. Interestingly, further analysis of exome sequences revealed that the occurrence of de novo pathogenic variants in the infant was frequent. Among the total~47,000 variants, 143 were de novo in the patient, whereas among all 74 variants predicted to be pathogenic/likely pathogenic, 21 were heterozygous and two were homozygous de novo. The occurrence rate of de novo deleterious variants was much higher (31.1%, 23/74) than that in total (0.34%, 143/47,000). It is notable that most genes with de novo deleterious variants were environment-sensitive, such as GJB2, MNK1, MNK2, MUC4, RAD21 and DNA copy number variations.
Conclusions: The full picture of genetic variants in the exome might help us to interpret the NSHL-causing variants. More research is needed into the causes of de novo deleterious variants and gene-environment interactions in congenital NSHL.

Keywords

Whole-exome sequencing, de novo pathogenic variant, nonsyndromic hearing loss, compound heterozygosity, genetic and environmental interaction

Introduction

Hearing loss is one of the most common birth defects. Variants in the Gap Junction Protein Beta 2 gene (GJB2, HGNC: 4284), which encodes a beta-2 gap junction protein (connexin 26; Cx26), have been shown to be the leading genetic cause of non-syndromic sensorineural hearing loss (NSHL) (OMIM: 121011). GJB2-related autosomal recessive deafness explains approximately 50% of congenital autosomal recessive deafness, and GJB2-related autosomal dominant deafness is extremely rare.

GJB2 constitutes cell-to-cell channels and facilitates the intercellular exchange of ions and molecules1. The amino acid alanine at position 88 (p.A88) of GJB2, which is located in the second transmembrane domain of Cx26, is highly conserved in vertebrates. To date, five studies have reported five nucleotide changes in the p.A88 coding region that resulted in distinct clinical abnormalities and different inheritance patterns. Frei et al. first reported the heterozygous c.262G>T (p.A88S) variant in a male Austrian patient with NSHL. As the proband’s mother was an asymptomatic carrier, the authors inferred that the missense variant could be connected to deafness but not in a simple, monogenetic disease model2. Gravian et al. found that the c.262G>C (p.A88P) variant in compound heterozygosity with the nonpathogenic variant p.V27I in an Argentina child with profound deafness, implicating the destructive potential of the c.262G>T variant3. Other researchers have reported p.A88 coding variants at the 263rd nucleotide: one was the c.263C>G (p.A88G) variant in a Tunisian girl with autosomal recessive NSHL, where her consanguineous parents were healthy carriers4; another was the c.263C>A (p.A88E) variant in a Chinese patient with sporadic NSHL where the variant was in compound heterozygosity with the disease-causing c.235delC5; and another was the c.263C>T (p.A88V) variant in a Japanese girl with severe keratitis-ichthyosis-deafness syndrome and septic complications, with unaffected parents6. To date, by directly sequencing the GJB2 genetic region, studies have demonstrated that variants in GJB2 p.A88 have been associated with hearing loss in children. However, descriptions of the penetrance of the variants have been inconsistent.

On the other hand, the GJB2 c.79G>A (p.V27I, rs2274084) in cis with c.341A>G (p.E114G, rs2274083) forming a haplotype of p.[V27I; E114G] occurs frequently in East Asian populations7,8. P.V27I is located in the first transmembrane domain and p.E114G is located in the intracellular loop of Cx26.Both are classified as benign polymorphisms. However, several clinical studies have found the p.[V27I; E114G] haplotype to be a risk factor for hearing impairment7-10, and functional assays in vitro have demonstrated that the channel activities of VG (p.E114G variant only) and IG (both p.V27I; p.E114G variants) were reduced11. However, as both genotypes were detected in both patients and controls7-10, the exact pathogenic role of these variants in NSHL remains controversial.

Whole-exome sequencing enables a comprehensive and precise genetic investigation of congenital disorders and allows us to search highly heterogeneous genetic causes. This study aimed to explore possible molecular abnormalities in a Chinese non-consanguineous family with a 22-month old daughter suffering from NSHL. We carried out whole-exome sequencing, assessed the cytological/clinical characteristics of the genetic variants, and evaluated the possible cause of de novo pathogenic variants in the patient’s exome.

Methods

Patient details

The family included in this study is of Han Chinese heritage and resides in Chengdu City of Southwest China. The proband was a 22-month-old girl with NSHL who had previously been born in our hospital by spontaneous delivery at full term. Both of her parents were healthy during pregnancy. The baby failed the newborn hearing examination but no prenatal or postnatal risk factors for hearing loss were identified. Similarly, no family history of hearing abnormalities was reported. When the parents brought the 22-month-old child back to the hospital in October 2018, physical, biochemical, and otoscopic examinations were carried out. A CT scan of the temporal bones and MR analysis of the child’s head were also done to search for any organic brain lesions, and pure tone audiometry was performed in the girl and her parents.

Written informed consent was obtained from both parents for them and their daughter to participate in the study. The work was approved by the Research Ethics Committee of Sichuan Provincial People’s Hospital, School of Medicine, University of Electronic Science and Technology of China.

Whole-exome and mitochondrial DNA sequencing

Blood genomic DNA and mitochondrial DNA were extracted from all family members according to standard procedures (Abcam, Cambridge, UK) and stored in -20°C. The DNA concentration and quality were examined using a NanoDrop 2000 (Thermo, USA).

The whole-exome sequencing, the entire mitochondrial DNA and genetic variations analysis are described in our previous work12. The fragmented genomic DNA was enriched using a NimbleGen probe capture array SeqCap EZ Exome Kit v3.0 (Roche NimbleGen, Inc. Madison, WI). The kit using the SeqCap advanced design algorithm coupled with 2.1 million long oligonucleotide probes to achieve superior target enrichment performance, and detect genetic variants with ~98% sensitivity and 99% specificity. The enriched DNA fragments passed the qPCR test, and the size distribution and concentration were examined using the Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA). The samples were sequenced on an Illumina NovaSeq 6000 (Illumina, San Diego, CA), and two parallel reactions were performed. Raw image files were processed by the BclToFastq (Illumina) for base calling to generate the raw data. The low-quality variations were filtered out using the quality score =20 (Q20). The sequencing reads were aligned to the NCBI human reference genome (hg19) using Burrows-Wheeler Aligner (version 0.6.2). SAMtools and Pindel were used to analyze single nucleotide polymorphisms (SNPs) and insertion/deletion of the sequence. The coding variants and CNVs were filtered out in the dbSNP135, Exome Variant Server, 1000 Genomes, and in-house database with more than 100,000 Chinese exomes (Joy Oriental Co. Beijing, China). The variants and CNVs were also searched in the Human Gene Mutation Database (HGMD), ClinVar, and the Online Mendelian Inheritance in Man database (OMIM).

The entire mitochondrial DNA was enriched by long-range PCR followed by massively parallel sequencing.

The related primers are listed in Table 1.

Table 1: Primer list

Primer NamePrimer Sequence (5' to 3')
Primers for amplifying genomic DNA
GJB2-F5'-AGCAAACCGCCCAGAGTAGAAG-3'
GJB2-R5'-AAGATGACCCGGAAGAAGATGCT-3'
Primers for HA-tagged protein expression vector construction
WT-F5'-CTTGGTACCGAGCTCGGATCCATGGATTGGGGCACGCTG-3'
WT-R5'-TGCTGGATATCTGCAGAATTCAACTGGGCAATGCGTTAAACTG-3'
Mut-F5'-CCGCTCCTAGTGGCCATGCACGTGG-3'
Mut-R5'-GTGGCGTGGACACGAAGATCAGCTGCA-3'
Mitochondrial genome DNA sequencing
mt16426F5'-CCGCACAAGAGTGCTACTCTCCTC-3'
mt16425R5'-GATATTGATTTCACGGAGGATGGTG-3'

Sanger sequencing

Sanger sequencing was used to verify the variations of the candidate genes in the family members12. The primers for amplifying the targeted region of candidate genes are also shown in Table 1.

Variant functional assay

The wild-type GJB2 cDNA and GJB2 cDNA with the c.262G>C variant were amplified with the primers shown in Table 1. The HA-tagged wild-type and mutant coding sequences were inserted into the pcDNA3.1(+) vector (Invitrogen, Carlsbad, CA) using the Mut Express® II Fast Mutagenesis kit V2 (Vazyme, Nanjing, China). Human H1299 cells (ATCC, Manassas, VA) were transfected to express the vectors using the jetPRIME Transfection Kit (Polyplus, Illkirch, France) according to the manufacturer’s instructions. After 48 hours of transfection, the cells were collected for immunoblotting and immunohistochemical analysis.

Protein analysis

The online Clustal Omega and Conseq software programs were used to align the amino acid sequences in a variety of species. The Polyphen-2, SIFT and MutationTaster programs were used to predict the variants as “damaging” or “possibly damaging”. The clinical interpretation of genetic variants by the American College of Medical Genetics and Genomics/Association for Molecular Pathology (ACMG/AMP) guidelines was followed to classify the variants into “benign”, “likely benign”, “uncertain significance”, “likely pathogenic”, and “pathogenic”13.

Immunoblotting and western blot analysis

For immunoblotting analysis, the cells were lysed with RIPA buffer containing protease inhibitor cocktail (Roche Diagnostics GmgH, Mannheim, Germany). The lysate was centrifuged, collected, and boiled in SDS loading buffer. Then, the proteins were separated on 10% SDS-polyacrylamide gels. After the proteins were transferred onto polyvinylidene difluoride membranes (Millipore, USA), the membranes were blocked and incubated with rabbit polyconal anti-HA antibody (Dilution: 1:1000, Cat No.: 51064-2-AP, Proteintech, Chicago, USA) and the secondary antibodies (Dilution: 1:10000, Cat No.: BA1055, Boster Wuhan, China), and the protein bands were visualized using an HRP chemiluminescent substrate kit (Millipore) and a ChemiDoc XRS+ System (Bio-Rad Company, Berkeley, CA).

For immunohistochemical analysis, the cells were fixed with 4% paraformaldehyde in 0.1 M PBS for 20 min and then rinsed three times in PBS. Then, the coverslips were immersed in cold methanol for 15 min at -20°C. The primary antisera and dilutions were as follows: rabbit anti-HA antibody at 1:100 (Proteintech) for WT/MUT GJB2. After incubation with primary antiserum at 4°C overnight, the cells were rinsed in PBS three times before adding Alexa Fluor 488- and/or Alexa Fluor 594-conjugated secondary antibodies (Dilution: 1:500, Cat. No.: A-11008, Invitrogen). ER was stained with ER-Tracker Red at 1:2000 dilutions (Beyotime, Shanghai, China) for 10 min at room temperature. Preimmune rabbit serum was used as the primary antibody for the negative controls. The images were visualized using a Zeiss Axio Imager Z2 microscope (Carl Zeiss, Jena, Germany).

Results

Clinical characteristics of the patient’s family

The pedigree of the family is shown in Figure 1A. The kinship connection between the proband and parents is confirmed by the exome sequence data21. The proband had normal physical, biochemical and otoscopic evaluations. No abnormality was found in her cranium by MR examination or in her cochlear, vestibular, and semicircular canals by CT scan. Pure tone audiometry indicated that her left and right hearing thresholds were 78 dB and 87 dB, respectively, with severe hearing loss in both ears (Figure 1B). Since there was no family history of HL and the child’s parents had normal hearing, the affected infant is considered to be a sporadic case of NSHL.

df97f660-e9f8-46f0-bd8d-05ebb0615699_figure1.gif

Figure 1. Genetic characteristics of the family (A) and audiograms for the proband (B).

The horizontal axis of the audiogram shows the tone frequency (Hz) and the vertical axis displays hearing level (dBHL). Severe hearing loss was classified as a pure-tone average between 70-95 dBHL. х, left ear, о, right ear.

Analyses of variants detected in GJB2 gene in the patient’s exome

The mitochondrial sequencing showed no NSHL-causing variants or large deletions. The exome sequences revealed no known NSHL-causing variants in the family except that the proband had a de novo heterogeneous variant c.262G>C in the GJB2 gene (MAF unknown, Table 2 and Figure 2), whereas her parents were wild type. The c.262G>C variant led to a missense variant of p.A88P, which was graded to be “damaging” with a SIFT score of 0.00 and a Polyphen-2 score of 1.00. To examine the effect of the c.262G>C variant on the protein expression level and cellular localization, we transiently transfected the GJB2 c.262G>C mutant into H1299 cells and found that the mutant was expressed weakly and displayed a punctate distribution in the cytoplasm and cytomembrane. In contrast, wild-type GJB2 was expressed robustly and was distributed mainly in the cytomembrane (Figures 3A & B). This result confirmed that the GJB2 p.A88P mutant may fail to locate into the cell membrane and subsequently reduce the formation of gap junctions in quantity.

df97f660-e9f8-46f0-bd8d-05ebb0615699_figure2.gif

Figure 2. DNA and protein sequence analysis of GJB2.

(A) The DNA sequence electropherograms (I1 father, I2 mother, II1 daughter) revealing wild-type sequence of the parents and de novo 262G to C transversion from their daughter (black arrow). (B) The schematic diagram of Cx26, where M1-M4 are transmembrane domains, E1-E2 are two extracellular loops, CL is intracellular loop, and NH2 and COOH is N- and C-cytoplasmatic termini respectively. The non-pathogenic c.79G>A (p.V27I), c.341A>G (p.E114G) is in both the M1 and intracellular loop. The c.262G>C (p. A88E) is in the M2 of Cx26. (C) The alignment of the Cx26 amino acid sequences among the different species. The alanine at codon 88 is highly conserved.

df97f660-e9f8-46f0-bd8d-05ebb0615699_figure3.gif

Figure 3. Expression of the p.A88P Cx26 mutants in cells.

The immunofluorescence staining showed the wild-type GJB2 was expressed robustly and distributed mainly in the cytomembrane, while the p.A88P mutant was expressed weakly and displayed a punctate distribution in the cytoplasm and cytomembrane (A, arrow); the ER tracker red demonstrated the cytoplasm (A). The immunoblotting confirmed the wild-type GJB2 largely localized in the cytomembrane, while the p.A88P mutants co-localized in the cytoplasm and cytomembrane (B).

Table 2. All de novo variants which were predicted to be pathogenic or likely pathogenic in the proband’s whole exome.

GeneGene anotationGenetic LocationrsProbandFatherMatherde novo variantAmino acid variationTypeMAF (in-house database of Joy Oriental Co.)Clinical significance defined by ACMG
GJB2Gap junction protein beta 213q11-q12 (20763459)HeterozygoteWild typeWild typec.262(exon2)G>Cp.A88PMissensePathogenic
LOC100509263chr9 (35183448-35183484)rs1267269489HomozygoteWild typeWild typec.250(exon1)_c.286(exon1)delCCTCACCTCCCAGGCAGGGCGGCCGGGCAGAGGCGCTp.P84Pfs*18Frame shifting0.007Pathogenic
MUC4Mucin 4, cell surface associated3q29 (195506650)HomozygoteWild typeWild typec.11801(exon2)C>Tp.A3934VMissense0.016Likely pathogenic
3q29 (195506674-195506675)rs771640527HeterozygoteWild typeWild typec.11776(exon2)_c.11777(exon2)delGTp.V3926Ffs*23Frame shifting0.001Pathogenic
3q29 (195506677-195506678)HeterozygoteWild typeWild typec.11773(exon2)_c.11774(exon2)insCp.D3925Afs*25Frame shifting0.001Pathogenic
3q29 (195506678-195506679)HeterozygoteWild typeWild typec.11772(exon2)_c.11773(exon2)insAp.D3925Rfs*25Frame shifting0.000732Pathogenic
PHGR1Proline, histidine and glycine rich 115q15.1 (40648396-40648398)rs755350345HeterozygoteWild typeWild typec.141(exon4)_c.143(exon4)delTGGp.P47_G48delinsPInframe deletion0.000123Likely pathogenic
AGAP4ArfGAP with GTPase domain, ankyrin repeat and PH domain 410q11.22 (46322037)rs879947525HeterozygoteWild typeWild typec.1318(exon7)A>Gp.K440EMissense0.000259Likely pathogenic
MAPK8IP2Mitogen-activated protein kinase 8 interacting protein 222q13.33 (51043846)HeterozygoteWild typeWild typec.1816(exon6)G>Ap.E606KMissenseLikely pathogenic
ADAMTSL4Thrombospondin repeat-containing protein 11q21.3 (150529350)HeterozygoteWild typeWild typec.1750-65(IVS10)A>GNon-codingLikely pathogenic
MAPK8IP1Mitogen-activated protein kinase 8 interacting protein 111p11.2 (45927951)HeterozygoteWild typeWild typec.*679(exon12)C>TNon-coding0.0000456Likely pathogenic
FRG1Facioscapulohumeral muscular dystrophy region gene-14q35 (190880984)rs62345304HeterozygoteWild typeWild typec.538-919(IVS6)T>GNon-coding0.012Likely pathogenic
ZNF880Zinc finger protein LOC40071319q13.41 (52888074-52888075)HeterozygoteWild typeWild typec.1241(exon4)_c.1242(exon4)insATCATGAGGTCAGGAGATCGAGACCATCCTGGCTAACAAGGTGAAACCp.G414delinsGSX,162Stop gain0.006Pathogenic
RAD21protein involved in DNA double-strand break repair, sister chromatid cohesion 18q24 (117864951-117864952)HeterozygoteWild typeWild typec.1162-5(IVS9)_c.1162-4(IVS9)insGSplice-siteLikely pathogenic
8q24 (117864952)rs1419526108HeterozygoteWild typeWild typec.1162-5(IVS9)A>TSplice-siteLikely pathogenic
OPN1MW2Opsin 1, medium wave sensitive 2chrX (153485284-153498649)Loss of heterozygosityWild typeWild typeloss1(EXON:1-6)(all)Exon deletion0.047Pathogenic
ARHGEF5Rho guanine nucleotide exchange factor 5chr7 (144059762-144072768)Loss of heterozygosityWild typeWild typeloss1(EXON:2-12)Exon deletion0.05Pathogenic
chr3chr3 (15621416-15631119)Loss of heterozygosityWild typeWild typeloss1Large CNV deletion0.0064Pathogenic
chr10chr10 (48218794-48237210)Loss of heterozygosityWild typeWild typeloss1Large CNV deletion0.025Pathogenic
chr19chr19 (7981506-7985434)Loss of heterozygosityWild typeWild typeloss1Large CNV deletion0.0053Pathogenic
chr22chr22 (50320902-50355459)Loss of heterozygosityWild typeWild typeloss1Large CNV deletion0.019Pathogenic
chr16chr16 (28723007-28726011)Single repeatWild typeWild typegain1Large CNV duplication0.039Pathogenic
LOC81691chr16 (20838379-20839859)Single repeatWild typeWild typegain1(EXON:9-11)Exon duplication0.0056Pathogenic

Because heterozygous c.262G>C missense variants were previously found in both patients and healthy carriers in the clinic2,4, we rechecked the exome sequences of the family to search for any other possible genetic causes of NSHL. We failed to find any other NSHL-causing variants, but noticed that the mother was a heterozygote of GJB2 c.79G>A (p.V27I), c.341A>G (p.E114G), the father was wild type, and the affected infant was a heterozygote of c.79G>A (p.V27I) and c.341A>G (p.E114G). As mentioned before, although no significant loss of function has been detected when VG and IG gap junctions coexist with the VE and IE types, the VG and IG types have displayed a moderate deficit in biochemical coupling and reduced channel activity in vitro11. Hence, we deduced that the de novo p.A88P mutants in the infant dislocated from the cell membrane, exacerbating GJB2 loss-of-function in the context of the p.[V27I; E114G], whereas the wild-type p.A88 in her mother could compensate for the loss, thus the infant’s compound heterozygosity at p.A88P and p.[V27I; E114G] was affected while her mother is an asymptomatic carrier of p.[V27I; E114G]. This result indicates that the multiple genetic variants in GJB2 could influence protein function additively.

Analyses of de novo variants detected in the patient’s exome

As we noticed that the c.262G pathogenic variant was de novo, we examined the de novo variants in the patient’s exome. It showed that there were approximately 47,000 variants, of which 143 variants were de novo (0.34%, 143/47,000). Among these 47,000 variants, 74 (0.016%, 74/47,000) were predicted to be pathogenic or likely pathogenic. Remarkably,23 de novo variants were predicted to be pathogenic or likely pathogenic, including 21 heterozygous and two homozygous variants. The de novo adverse variants accounted for approximately one-third (23/74) of all pathogenic or likely pathogenic variants (Table 2). Compared with the frequency of de novo variants in total being only 0.34%, the frequency of de novo adverse variants in all de novo variants reached above 16% (23/143) which is surprisingly high. The 23 de novo adverse variants were distributed in 19 different genetic areas, including 12 known genetic regions, two unclassified gene zones (LOC100509263 and LOC81691) and five other chromosome domains without defined roles (Table 2). Except for the de novo GJB2 c.262G>C variant, the other adverse variants have not yet been reported to be NSHL-causing.

Notably, eight copy number variations (CNVs) - nearly half of the infant’s 17 total adverse CNVs - were de novo. The de novo pathogenic CNVs accounted for 42% (8/19) of the total de novo adverse mutated genes (Table 2); however, the minor allele frequencies of these CNVs were below 0.05 in the Human Gene Mutation Database and our in-house database (Joy Oriental Co., Table 2). Of these CNVs, six lacked the relevant information about their function, except the exon deletion in Rho Guanine Nucleotide Exchange Factor 5 (ARHGEF5, exon 2-12, 13,006 bp) and Opsin 1, Medium Wave Sensitive 2 (OPN1MW2, exon 1-6, 13,365 bp). The ARHGEF5 and OPN1MW2 gene products are crucial proteins that transduce external environmental cues into cellular signals across the cell membrane. Indeed, most CNVs do not encode important genes related to development and are thought to be subjected to adaptation to different environments14. Here, these recurrent de novo pathogenic CNVs in the patient remind us about the environmental influence on genetic components.

In total, four missense, four frameshift, three noncoding, two splice-site, one in-frame deletion and one stop gain variant which were predicted to be pathogenic/likely pathogenic, were de novo (Table 2). Interestingly two heterozygous pathogenic variants in mitogen-activated protein kinase 8 interacting kinases 1 and 2 (MNK1 and MNK2) were de novo: one MNK1 noncoding variant c.679 C>T in chromosome 11 (exon 12, MAF=0.000046) and the other MNK2 missense variant c.1816 G>A in chromosome 22 (exon 6, MAF unknown). Both MNK1 and MNK2 are serine/threonine kinases from the Ca2+/calmodulin-dependent kinase family and take part in initiating mRNA translation in response to MAPK signaling, accordingly playing important roles concerning environmental stress and cytokines15. Also, four de novo pathogenic variants, including one homozygous missense variant c.11801C>T (MAF=0.016), accumulated in the cell surface-associated Mucin 4 gene (MUC4). Mucins are integral membrane glycoproteins on the cell surface. As the major constituents of mucus, mucins protect epithelial cells from outward stimuli. Additionally, two de novo heterozygous pathogenic variants c.1162-4(IVS9) insG (MAF unknown) and c.1162-5(IVS9) A>T (MAF=0.000008) were detected in the Rad1-like checkpoint DNA exonuclease gene (RAD21). The RAD21 gene encodes the major cohesion subunit, known as the component of a heterotrimeric cell cycle checkpoint complex, regulating the segregation of sister chromatids in cell cycle progression and connecting inducible gene expression in response to diverse stimuli16. It is assumed that the proband’s genes with de novo pathogenic variants, including the disease-causing GJB2 c.262G>C (p.A88P), were the key participants immediately linking the external stimuli and cellular signals. Therefore, we think that the causes of all these de novo adverse variants in the affected infant might.be directly linked to the fetal/maternal environmental factors.

Discussion

This study examined the clinical/cytological characteristics and the compound heterozygous GJB2 variants at c.79G>A, c.341A>G and c.262G>C in a Chinese family with a rare sporadic case of NSHL. In a previous cell-based functional assay, Zhang et al. demonstrated that the c.262G>T variant affected the intercellular exchange of larger molecules but left the ionic permeability intact, thus altering the kinetics of gap junction-mediated intercellular signaling and disrupting normal cochlear function17. Our study showed that the c.262G>T variant was expressed weakly and failed to regularly locate in the cell membrane, consequently reducing the formation of cell gap junctions. The GJB2 p.[V27I; E114G] variant may also additively impair GJB2 function, as the channel activities of homozygous p.[V27I; E114G] CX26 gap junctions has been previously shown to be reduced11. Thus, it seems reasonable that carriers of the simple heterozygous c.262G>C could be asymptomatic3, while carriers of c.262G>C in compound heterozygosity along with any other deafness-related variants such as c.235delC, p.V27I, etc. could experience HL, like in our study and a previous NSHL case3. Hence, the pathogenic effects of these GJB2 variants could be additive.

It should be noted that the penetrance of the GJB2 c.262G>T seemed to be undetermined in the two previous NSHL cases: the heterozygous p.A88S in the Austrian patient with NSHL and his asymptomatic mother carrier2; and the heterozygous p.A88V in the Japanese girl with severe keratitis-ichthyosis-deafness syndrome and her healthy parents6. Both studies reported no other GJB2 variants except the heterozygous c.262G. In fact, only the candidate GJB2 genetic region was sequenced in their studies, so any other genetic disease-causing variants in the patients’ genome are still unknown. Therefore, for an accurate variant interpretation and improved clinical care, we propose that more comprehensive details about the related variants, such as variant domain, effect, and reciprocal interaction, should be investigated.

In the current study, it is intriguing that there was a very high frequency of de novo adverse variants in the proband’s exome and that most de novo variants are in the genetic regions characterized as environment-sensitive. Several notable results were found. First, the gene in which the de novo NSHL-causing GJB2 c.262G>C is located is immediately responsive to the surrounding changes. The gene product GJB2 is essential for gap channels, which allows the exchange of small substances including nutrients, metabolites, ions and second messengers, and regulates signaling pathways in intracellular communication1,17. Second, variants in MNK1 and MNK2 - two downstream MAPK signaling effectors located in different chromosomes - were also de novo. Both MNKs are involved in guiding cellular responses to a diverse array of stimuli, such as mitogens, osmotic stress, heat shock and proinflammation15,18. Third, the de novo pathogenic variants were aggregated in the MUC4 gene region. Mucins are integral membrane glycoproteins on the cell surface, covering epithelial surfaces such as those in the trachea, colon and cervix, and exert anti-adhesive effects on cell-cell and cell-extracellular matrix interactions19. Fourth, there were two de novo pathogenic variants in the RAD21 gene. RAD21 participates in repairing DNA double-strand breaks and chromatid cohesion and can be affected by various agents, including ionizing radiation, topoisomerase inhibitors, cycloheximide, proteasome inhibitors, cytokines agents and inflammatory stimuli16,20. Finally, there was a very high incidence of de novo pathogenic CNVs which have quite low MAFs. CNVs are often enriched in genes related to sensory perception of the external environment (e.g., smell, sight, and taste), neurodevelopmental processes, and response to chemical stimuli, immunity and other processes14. Therefore, we wonder whether there might have been any direct external stimuli to trigger the fetal adaptive responses for the occurrence of such a considerable amount of de novo pathogenic variants, which thus led to the disease.

It should be noted that the sporadic congenital NSHL in the family that we studied here was rare and limited; more research in similar birth defect cases is needed to confirm the role of environmental factors in transformation of genetic variants in the fetus/offspring.

In summary, by whole-exome sequencing, we examined overall genetic variants, especially the compound heterozygous GJB2 variants and the high frequency of de novo pathogenic variants in a Chinese family with a rare sporadic case of NSHL. Though the reported case here is limited, we think the detailed full picture of genetic variants could improve our interpretation of the HL-associated genetic variants. In order to further advance our understanding of disease biology in birth defects, further research on environmental causes for de novo pathogenic variants may be needed.

Data availability

Underlying data

Open Science Framework: Whole-exome sequencing of de novo genetic variants in a Chinese family with a sporadic case of congenital nonsyndromic hearing loss. https://doi.org/10.17605/OSF.IO/DS7TW21

This project contains the following underlying data:

  • The immunoblotting of the p.A88P Cx26 mutants in cells. (mut*.tif)

  • The immunoblotting of the wild type Cx26 in cells. (WT*.tif)

  • The data comparison of the exome DNA sequences of the family members. (*.xlsx)

NCBI Gene: Exome sequencing of a Chinese family with a sporadic congenital NSHL. Accession number PRJNA688744.

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Ethical approval

The data were de-identified as sufficiently as possible and data sharing was approved by the Research Ethics Committee of Sichuan Provincial People’s Hospital, School of Medicine, UESTC (approval number 2019-065).

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 02 Feb 2021
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Hu S, Zhang H, Liu Y et al. Whole-exome sequencing of de novo genetic variants in a Chinese family with a sporadic case of congenital nonsyndromic hearing loss [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2021, 10:61 (https://doi.org/10.12688/f1000research.27739.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 02 Feb 2021
Views
15
Cite
Reviewer Report 15 Apr 2021
Yuande Tan, Institute of Personalized Medicine, PENN State University, Hershey College of Medicine, Hershey, PA, USA 
Approved with Reservations
VIEWS 15
This paper displays a variant profile of a Chinese family with a case of congenital nonsyndromic hearing loss using the whole-exome sequencing data. Authors attempted to utilize heterozygote of a de nova variant (c.262G>C) in gene GJB2 to explain case ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Tan Y. Reviewer Report For: Whole-exome sequencing of de novo genetic variants in a Chinese family with a sporadic case of congenital nonsyndromic hearing loss [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2021, 10:61 (https://doi.org/10.5256/f1000research.30672.r82018)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 24 Aug 2021
    Sonia Liao, Diabetes Center & Institute of Organ Transplantation, Sichuan Provincial People’s Hospital, University of Electronic Science and Technology of China, Chengdu, 610072, China
    24 Aug 2021
    Author Response
    1.    The results show among the total~47,000 variants, 143 were de novo occurring in the patient. According to definition of de nova from Wikipedia, a de nova variant is a ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 24 Aug 2021
    Sonia Liao, Diabetes Center & Institute of Organ Transplantation, Sichuan Provincial People’s Hospital, University of Electronic Science and Technology of China, Chengdu, 610072, China
    24 Aug 2021
    Author Response
    1.    The results show among the total~47,000 variants, 143 were de novo occurring in the patient. According to definition of de nova from Wikipedia, a de nova variant is a ... Continue reading
Views
16
Cite
Reviewer Report 08 Apr 2021
Kun Zhang, Department of Genetics, School of Bioscience and Technology, Chengdu Medical College, Chengdu, China 
Approved
VIEWS 16
The authors report an interesting observation describing a patient with non-syndromic hearing loss caused by a de novo heterozygous variant of GJB2 c.262G>C. The authors identified the variant by whole exome sequencing and provided biological evidence of the variant by in vitro analysis.

Here, several concerns were raised:

The number of de novo variants (23) seemed very high. De ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Zhang K. Reviewer Report For: Whole-exome sequencing of de novo genetic variants in a Chinese family with a sporadic case of congenital nonsyndromic hearing loss [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2021, 10:61 (https://doi.org/10.5256/f1000research.30672.r82648)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 26 May 2021
    Sonia Liao, Diabetes Center & Institute of Organ Transplantation, Sichuan Provincial People’s Hospital, University of Electronic Science and Technology of China, Chengdu, 610072, China
    26 May 2021
    Author Response
    Thanks a lot. We presented the suggested reference in the new version, please see the 4th paragraph of the discussion section..
    Competing Interests: No competing interests were disclosed.
COMMENTS ON THIS REPORT
  • Author Response 26 May 2021
    Sonia Liao, Diabetes Center & Institute of Organ Transplantation, Sichuan Provincial People’s Hospital, University of Electronic Science and Technology of China, Chengdu, 610072, China
    26 May 2021
    Author Response
    Thanks a lot. We presented the suggested reference in the new version, please see the 4th paragraph of the discussion section..
    Competing Interests: No competing interests were disclosed.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 02 Feb 2021
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.