Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan

Mosab Adam; Hongwei Shen; Khalid-A Enan; Hao Wang; Azza B. Musa Musa; Abdel R. El Hussein; Isam M. Khidir; Xuejun Ma

doi:10.12688/f1000research.123652.1

Home Browse Molecular survey of certain protozoan agents that cause diarrhea in...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan

[version 1; peer review: 2 approved with reservations, 1 not approved]

Mosab Adam ^1,2, Hongwei Shen^1,3, Khalid-A Enan², [...] Hao Wang¹, Azza B. Musa Musa², Abdel R. El Hussein², Isam M. Khidir^2,4, Xuejun Ma¹

Mosab Adam ^1,2, Hongwei Shen^1,3, [...] Khalid-A Enan², Hao Wang¹, Azza B. Musa Musa², Abdel R. El Hussein², Isam M. Khidir^2,4, Xuejun Ma¹

PUBLISHED 29 Nov 2022

Author details Author details

¹ National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
² Department of Virology, Ministry of Higher Education and Scientific Research, Khartoum, Sudan,, khartoum, Sudan
³ Futian District Center for Disease Control and Prevention, Shenzhen, China., Shenzhen, China
⁴ Department of Microbiology and Parasitology,, Faculty of Medicine, University of Khartoum, Khartoum, Sudan, khartoum, Sudan

Mosab Adam
Roles: Investigation, Methodology, Writing – Original Draft Preparation, Writing – Review & Editing

Hongwei Shen
Roles: Investigation, Methodology, Writing – Original Draft Preparation, Writing – Review & Editing

Khalid-A Enan
Roles: Methodology, Supervision, Writing – Review & Editing

Hao Wang
Roles: Methodology

Azza B. Musa Musa
Roles: Formal Analysis

Abdel R. El Hussein
Roles: Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing

Isam M. Khidir
Roles: Investigation, Methodology, Project Administration, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing

Xuejun Ma
Roles: Investigation, Methodology, Project Administration, Supervision, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

Abstract

Introduction
Diarrhea is a significant health problem in third world countries; identification of causative agents of diarrhea is essential to apply measures to prevent and control this disease. In addition, scant data are available regarding childhood diarrhea in Sudan. Our research aimed to determine the incidence of specific protozoan pathogens (Entameobia histolytica, Cryptosporidium spp., and Gardia lambelia) among the young (aged less than five years) in Khartoum, Sudan.
Methods
We conducted a parasitological cross-sectional survey, and stool samples from 437 patients were examined for E. histolytica, C. parvum, and G. lambelia using a multiplex real-time PCR method.
Results
Of the 437 stool samples tested, infection with intestinal parasite was found in 155 (35.5%) cases, and co-infection was identified in 16 (3.7%) cases. G. lambelia (18.8%) and C. parvum (15.8 %) were the most frequently identified parasites, followed by E. histolytica (0.5%). The highest and lowest rates of parasitic infections were seen in the less than two years age group (32.7%), and in the 2–4-year-old group (2.7%), the male children showed higher rates of infections (23.7%) compared to females (11.7%). The incidence of protozoan infection was higher (37.7%) in the rainy season (August to December) (32.7%) in contrast with that (2.7%) in the dry season (April to June).
Discussion
Our present study demonstrated the high prevalence of G. lambelia and C. parvum in children with diarrhea in Khartoum State and the multiplex real-time technique's usefulness in disclosing pathogenic protozoal agents. Our result highlighted the necessity of developing intervention measurement and control strategies to deal with childhood parasitic diarrhea in this region.

Keywords

Diarrhea, Detection, Parasitic, Protozoan, Pathogens, Childhood

Corresponding author: Mosab Adam

Competing interests: No competing interests were disclosed.

Grant information: This work was supported, until 2021, by grants from the National key research and development plan of China (2016TFC1202700, 2016YFC1200900, and 2017YFC1200503) and the China Mega-Project for Infectious Disease (2017ZX10302301-00401-0101-0101 and 2010).

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2022 Adam M et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Adam M, Shen H, Enan KA et al. Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 1; peer review: 2 approved with reservations, 1 not approved]. F1000Research 2022, 11:1401 (https://doi.org/10.12688/f1000research.123652.1) First published: 29 Nov 2022, 11:1401 (https://doi.org/10.12688/f1000research.123652.1) Latest published: 23 Oct 2024, 11:1401 (https://doi.org/10.12688/f1000research.123652.4)

Introduction

Diarrhea is defined as passing soft, loose, or watery feces three times or more in 24 hours; it is usually a result of the consumption of pathogen-contaminated water or food.¹^,² Diarrhea remains a major cause of mortality and morbidity in children in third-world countries.¹^,³^–⁵ More than 1 billion episodes of diarrhea occur annually, resulting in approximately 2.5 million deaths in children aged less than 5 years in developing countries.¹^,²^,⁵^,⁶ Where diarrhea is considered the third most common cause for young children to visit health centers, some of the underlying conditions found in the community of most developing countries, including malnutrition and poor hygiene, may increase the risk of experiencing diarrheal disease.² In developed countries, the availability of modern technologies and suitable water supply has led to a decline in global death due to diarrhea; however, despite the substantial effort to supply modern technology and management practices, diarrhea in Africa is still unacceptably ranked as the second cause of death among young children.¹^,⁷^–⁹ Despite the high morbidity of childhood diarrhea in Sudan, the knowledge of the parasitic causative agents is scant. Parasitic protozoans that infect the intestinal tract in developing countries include Cryptosporidium spp., G. lambelia, and E. histolytica the agents that cause cryptospordiasis, giardiasis, and amoebiasis respectively, which are considered prime for diarrheal diseases in children under 5 years old.¹⁵ The limited specificity and sensitivity of the microscopic method commonly used in most laboratories in Sudan decreased the detection rate of parasitic infections. As a result, there is little information about the precise incidence of diarrhea and causative protozoan agents.

This study aimed to explore the incidence of some protozoan organisms (Cryptosordium parvum, Giardia lambelia, Giardia lambelia, and Entameobia histolytica) that produce acute diarrheal illness among young children using molecular techniques.

Methods

This cross-sectional study was co-conducted at the Central Laboratory, Ministry of Higher Education and Research, Sudan, and the National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, China (CDC), Beijing, China. A total of 437 fecal samples (one per patient) comprising 276 boys and 161 girls, who mostly live in a rural area, were collected in a dry, clean plastic container during two different seasons (the hot, dry season from April to June, and the rainy season from August to December) in the year 2014 at Khartoum teaching hospitals. The stool specimens were kept at −20°C until tested at the beginning of 2015. The frozen samples were then transported on dry ice to the China CDC, Beijing, China. Children admitted to hospitals had been clinically diagnosed with acute diarrhea ranging from 1 to 4 days before the sample collection. The participants were aged ≤2 years (403, 92.2%); >2–≤4 years (32, 7.3%), and >4–˂5 years (2, 0.5%). Patient data were collected through a structured questionnaire, including age, gender, and season. The study was approved by the ethical committee of the Sudan Academy of Sciences (Approval number (2367) and informed written permission was obtained from the parents or guardians of the enrolled children.

Nucleic acid extraction

Parasite DNA was extracted from 200 μL of 10% fecal suspension prepared in phosphate buffer saline using QIAamp^® Fast DNA Stool Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The extracts were eluted in 60 μL of DNase-free water, immediately aliquoted in 20 μL, and kept at −80°C.

PCR amplification and parasite detection

Primers and probes of multiplex real-time PCR

A total of three primer pairs and three probes for the simultaneous detection of E. histolytica, C. parvum, and G. lamblia were used.¹⁰ Table 1 shows the oligonucleotides sequence of the primers, probes and target genes, and amplicon sizes.

Table 1.

The nucleotide primers and probes for multiplex real-time PCR used in this study

Organism	Target gene^a	Primer sequence (5′-3′)^b	Probe (5′-3′)
E. histolytica⁵	SSU rRNA	F: ATTGTCGTGGCATCCTAACTCA R: GCGGACGGCTCATTATAACA	VIC-TCATTGAATGAATTGGCCATTT¹⁹
G. lamblia⁵	SSU rRNA	F: GACGGCTCAGGACAACGGTT R: TTGCCAGCGGTGTCCG	FAM-CCCGCGGCGGTCCCTGCTAG¹⁹
C. parvum⁵	DNA-like	F: CGCTTCTCTAGCCTTTCATGA R: CTTCACGTGTGTTTGCCAAT	Texas Red-CCAATCACAGAATCA¹⁹ TCAGAATCGACTGGTATC¹⁶

a SSU rRNA, small subunit ribosomal RNA.

b F, forward; R, revers.

Multiplex real-time PCR

Real-time PCR was performed with a Multiplex PCR kit (Qiagen, Hilden, Germany) in a 20 μL volume containing 6.25 pmol of each E. histolytica-specific primers, 6.25 pmol of each G. lamblia-specific primers, 25 pmol of each C. parvum-specific primers, 1.75 pmol of E. histolytica-specific VIC-TaqMan probe, 2.5 pmol of G. lamblia-specific FAM-TaqMan probe, 8.75 pmol of C. parvum-specific Texas Red-TaqMan probe. Amplification consisted of 15 min at 95°C, 40 cycles of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C. The iCycler real-time detection system (Bio-Rad) performed amplification, detection, and data analysis.

Result

A potential protozoal parasite was diagnosed in 155/437 (35.5%) cases, among which the highest prevalence was G. lamblia (82/437, 18.8%), followed by Cryptosporidium spp. (69/437, 15.8%), and E. histolytica (4/437, 0.5%) (Figure 1). The highest rate of parasitic infection was seen in the ≤2 years group (32.7%) and much lower in the >2–≤4 years old group (2.7%) (Table 2). In contrast, the protozoal parasite was not detected in the age group of >4–˂5 years. Among children with parasitic infections, 23.7% were male, while 11.7% were female (Table 3). As much more samples were collected from boys (276) than from girls (161) in the age group ≤2 years (403, 92.2%), the comparisons between these variables were not relevant. The incidence of protozoan parasitic infection was higher in the rainy season (August to December) than in the dry season (April to June) (32.7% and 2.7%, respectively) (Table 4).

Figure 1. Overview of protozoal parasite infections.

Table 2. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the age.

	Age in years			P-value
	0-2	2-4	4-5	P-value
*G. lambelia*	17.2%	1.6%	0%	0.715
Cryptosporidium spp.	14.6%	1.1%	0%	0.828
*E. histolytica*	0.9%	0%	0%	0.843
Total	32.7%	2.7%	0%

Table 3. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the gender.

	Gender		P-value
	M	F	P-value
*G. lambelia*	14.2%	4.6%	0.010
Cryptosporidium spp.	9.4%	6.4%	0.483
*E. histolytica*	0.2%	0.7%	0.112
Total	23.8%	11.7%

Table 4. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the Seasons.

	Season		P-value
	Autumn	Summer	P-value
*G. lambelia*	16.9%	1.8%	0.391
Cryptosporidium spp.	14.9%	0.9%	0.064
*E. histolytica*	0.9%	0%	0.446
Total	32.7%	2.7%

Infection with one type of parasite was found in 139 cases (31.8%), while parasite co-infection was detected in 16 patients (3.7%), which involved E. histolytica and G. lambelia in two cases, and G. lamblia and Cryptosporidium spp. in 14 cases (Table 5).

Table 5. Frequency of samples with co-infections.

Pathogen	No. of co-infections (%)
G. lamblia and C. parvum	14 (3.2%)
E. histolytica and G. lambelia	2 (0.5%)
Total	16 (3.7%)

Discussion

Gastrointestinal protozoan parasites are still posing common health problems, mainly in children aged less than 5 years worldwide. The rapid and accurate identification of protozoan parasites is a big challenge in many developing countries. The real-time multiplex PCR technique that provides concurrent detection of all protozoal parasites used herein was an exceedingly powerful laboratory system, enabling rapid, sensitive, precise, and inexpensive parasite detection.

This study was conducted during two seasons (autumn and summer), from April to December 2014, in Khartoum State, Sudan. The present study aimed to determine the prevalence of certain protozoan parasites linked with acute gastroenteritis in stool samples from children less than 5 years old using a multiplex real-time PCR assay developed in a previous study.¹⁰

Among the 437 fecal specimens examined, 276 were collected from male children and 161 from females, amounting to a male-to-female ratio of 1:1.7. Most of the samples were from less than ≤2 years old (403, 92.2%), followed by >2–≤4 years (32, 7.3%) and >4–˂5 years (2, 0.5%).

As they showed in Table 2, the gender distribution among the G. lambelia-positive samples was 14.2% in males and 4.6 % in females (P<0.01), indicating a statistically significant difference among the gender group that supports the statement of Khwam H.¹¹

The most significant number of samples were from the age group ≤2 years (403, 92.2%), followed by >2–≤4 years (32, 7.3%) and >4–˂5 years (2, 0.5%). The result of our study indicates the highest prevalence of protozoal diarrhea (32.7%) was detected in the age group of ≤2 years flowed by >2–≤4 years (2.7%), and no protozoan pathogen was found in the age group of >4–˂5 years; however, these results could be explained by the fact that most of our samples were collected from the age group ≤2 years in which the decline of the maternal immunity with an age risk factor of diarrhea infection.⁴^,¹² The highest number of positivity was detected in the samples of boys less than two years old. The reason for the bias in the numbers of children with diarrhea (boys of ≤2 years) admitted to hospitals is not clear and needs to be further investigated to determine whether or not it is the pattern of childhood diarrhea in Sudan. The contaminated hands and bad hygiene may contribute to the transmission of food borne infection in these children, which was in agreement with the investigation in Nepal, where the highest prevalence of parasitic diarrhea was found in the age group of fewer than two years.¹³ But our result differed from another study in Khartoum¹³ in which the major group of infections was in >4–˂5 years old children, and this may again be due to statistical bias because most of our samples were collected from the age group of ≤2 years; This should be avoided in future studies by equalizing the age group of the study or by using a larger sample size.

The result revealed a higher prevalence (35.5%) of protozoan diarrhea disease compared with other studies conducted in Khartoum state (16%).¹⁴ and in other developing countries, including Nepal and Ethiopia (0.7%, 15.6%, respectively).¹³^,¹⁵ In comparison, the incidence was lower than that in Tanzania and South Africa (55.6%, 68%, respectively)⁵^,¹⁶ and close to that reported in the Gaza strip (39%).¹⁷ To our knowledge, our study is the first to demonstrate a high prevalence of Cryptosporidium (15.8%) in Sudan. The diagnosis of Cryptosporidium used to depend on the Ziehl−Neelsen stain, and it was neglected mainly by our laboratories until we used a sensitive molecular assay that increased the detection rate of these agents.

The most prevalent protozoan detected in the present investigation was G. lamblia, with a prevalence of 18.8%, which is higher than in the study conducted in Khartoum State (15.8%).¹⁴ Its prevalence was followed by Cryptosporidium spp. (15.8%) and E. histolytica (0.9%). This result was consistent with previous findings in developing countries, including India, Gaza and Nigeria⁴^,¹⁷^,¹⁸ Infection with a single protozoan parasite was found in 139 cases (31.8%) cases; co-infection was found in 16 cases (3.7%). The study of co-infection on clinical severity was not studied in these patients. However, it has been reported that no significant variation was reported in the clinical symptoms of patients with co-infections compared with those with single infections.¹⁹ Our study showed that the incidence of a protozoan parasite is higher in autumn (wet) than that in summer (dry), which was in accordance with the study conducted in Khartoum state.¹⁴ It should be noted that no protozoan pathogen was detected in 282 stool samples (64.6%) which were likely due to infections with other pathogens like viruses and bacteria and also may be due to noninfectious reasons like hypersensitivity to certain food ingredients and weaning diarrhea that result of the inability of an underdeveloped child intestine to metabolize the food. Poor hygiene and sanitation and lack of proper toilets may facilitate these infections.

The present study furnished some crucial insights into the protozoan cause of child diarrhea in Khartoum State. Findings of this study will certainly help us understand the importance of parasitic diarrhea in younger than five years of children, and these findings are valuable in developing measures to improve the health condition of the young children. Furthermore, this study calls for the establishment of sensitive and specific molecular techniques, such as multiplex PCR, for the detection of the protozoan pathogen in a clinical setting.

Authors contributions

Mosab, Isam, and Xuejun designed the experiment; Mosab and Hong-do the lab experiment; Azza analyzed the data; Mosab, Khalid, and Abdel collected the samples. Mosab Hong and Abdel wrote the article.

Data availability

Underlying data

Figshare: Underlying data for “Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan”, https://doi.org/10.6084/m9.figshare.21201676.v3.²⁰

This project contains the following underlying data:

• Data information.xlsx

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

References

1. Khalil I, Colombara D, Forouzanfar M, et al.: Burden of Diarrhea in the Eastern Mediterranean Region, 1990 2013: Findings from the Global Burden of Disease Study 2013. Am. J. Trop. Med. Hyg. 2016; 6(95): 1132–1319.
2. Vargas M, Gascon J, Casals C, et al.: Etiology of diarrhea in children less than five years of age in Ifakara, Tanzania. Am. J. Trop. Med. Hyg. 2004; 70(5): 536–539. PubMed Abstract | Publisher Full Text
3. Dean TJFR, Makgoba MW, Bos ER, et al.: Disease and mortality in sub-Saharan Africa.2nd ed.2006.
4. Gupta DA: Study of the prevalence of diarrhea in children under the age of five years: its association with wasting. Indian J. Sci. Res. 2014; 7(1): 1315–1318.
5. Ngosso BEN, Namkinga G: Identification of Pathogenic Intestinal Parasitic Protozoa Associated with Diarrhea among Under-fives Children in Dar Es Salaam, Tanzania. Int. J. Med. Med. Sci. 2015; 2(4): 49–55.
6. Chen J, Tang J, Liu J, et al.: Development and evaluation of a multiplex PCR for simultaneous detection of five foodborne pathogens. J. Appl. Microbiol. 2012; 112(4): 823–830. PubMed Abstract | Publisher Full Text
7. Quin A: Diarrhea likelihood in Ghanaian children: A Study of the Association between Diarrhea and Water and Sanitation Infrastructure. Master thesis of Public Policy in the Georgetown Institute.2009; p. 74.
8. Michael HMM, Cleveland C: Water pollution. Encyclopedia of Earth, National Council for Science and the Environment.2010.
9. Organization WH: The world health report 2005—Make every mother and child count. Geneva, Switzerland:WHO Press;2013.
10. Verweij JJ, Blange RA, Templeton K, et al.: Simultaneous detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in fecal samples by using multiplex real-time PCR. J. Clin. Microbiol. 2004; 42(3): 1220–1223. PubMed Abstract | Publisher Full Text | Free Full Text
11. Khwam H, Hayat D, Abdul M: Parasitic infections causing diarrhoea among children less than six years at Al-Nasiriya province. J. Uni. Thi-Qar. 2016; 4(11): 134–142.
12. Sherchand B, Yokoo M, Sherchand O, et al.: Burden of Enteropathogens Associated Diarrheal Diseases in Children Hospital, Nepal. Sci. World. 2010; 7(7): 71–75. Publisher Full Text
13. Shamshul A, Keshab P, Bharat Mani P, et al.: Pattern of Acute Parasitic Diarrhea in Children Under Five Years of Age in Kathmandu, Nepal. Open J. Med. Microbiol. 2012; 02: 95–100. Publisher Full Text
14. Saeed A, Abd H, Sandstrom G: Microbial etiology of acute diarrhea in children under five years of age in Khartoum, Sudan. J. Med. Microbil. 2015; 64(4): 432–437. PubMed Abstract | Publisher Full Text
15. Firdu T, Abunna F, Girma M: Intestinal Protozoal Parasites in Diarrheal Children and Associated Risk Factors at Yirgalem Hospital, Ethiopia: A Case-Control Study. Int. Sch. Res. Notices. 2014; 2014: 1–8. Publisher Full Text
16. Samie A, Guerrant RL, Barrett L, et al.: Prevalence of intestinal parasitic and bacterial pathogens in diarrhoeal and non-diarrhoeal human stools from Vhembe district, South Africa. J. Health Popul. Nutr. 2009; 27(6): 739–745. PubMed Abstract
17. Mezeid N, Shaldoum F, Al-Hindi AI, et al.: Prevalence of intestinal parasites among the population of the Gaza Strip, Palestine. Ann. Parasitol. 2014; 60(4): 281–289. PubMed Abstract
18. C.M.U1 A, OAN, CUN: Etiology of Acute Diarrhoea Among Children In Owerri, Imo State Nigeria. App. Sci. Rep. 2015; 10(3): 128–132.
19. Saikruang W, Khamrin P, Suantai B, et al.: Detection of diarrheal viruses circulating in adult patients in Thailand. Arch. Virol. 2014; 159(12): 3371–3375. PubMed Abstract | Publisher Full Text
20. Adam M, Du H, Enan KA, et al.: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan. figshare.2022. Publisher Full Text

Comments on this article Comments (0)

Version 4

VERSION 4 PUBLISHED 29 Nov 2022

Author details Author details

Mosab Adam
Roles: Investigation, Methodology, Writing – Original Draft Preparation, Writing – Review & Editing

Hongwei Shen
Roles: Investigation, Methodology, Writing – Original Draft Preparation, Writing – Review & Editing

Khalid-A Enan
Roles: Methodology, Supervision, Writing – Review & Editing

Hao Wang
Roles: Methodology

Azza B. Musa Musa
Roles: Formal Analysis

Abdel R. El Hussein
Roles: Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing

Isam M. Khidir
Roles: Investigation, Methodology, Project Administration, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing

Xuejun Ma
Roles: Investigation, Methodology, Project Administration, Supervision, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

This work was supported, until 2021, by grants from the National key research and development plan of China (2016TFC1202700, 2016YFC1200900, and 2017YFC1200503) and the China Mega-Project for Infectious Disease (2017ZX10302301-00401-0101-0101 and 2010).

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (4)

version 4

Revised

Published: 23 Oct 2024, 11:1401

https://doi.org/10.12688/f1000research.123652.4

version 3

Revised

Published: 14 Jun 2024, 11:1401

https://doi.org/10.12688/f1000research.123652.3

version 2

Revised

Published: 28 Feb 2024, 11:1401

https://doi.org/10.12688/f1000research.123652.2

version 1

Published: 29 Nov 2022, 11:1401

https://doi.org/10.12688/f1000research.123652.1

© 2022 Adam M et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Adam M, Shen H, Enan KA et al. Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 1; peer review: 2 approved with reservations, 1 not approved]. F1000Research 2022, 11:1401 (https://doi.org/10.12688/f1000research.123652.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?

Key to Reviewer Statuses VIEW HIDE

ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions

Version 1

VERSION 1

PUBLISHED 29 Nov 2022

Views

Reviewer Report 01 Aug 2023

Jean Bernard Lekana-Douki, University of Health Sciences, Owendo, Gabon; Université Des Sciences de La Santé, Libreville, Gabon

Approved with Reservations

https://doi.org/10.5256/f1000research.135782.r179577

The article titled ‘Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan” by Mosab Adam et al. described the identification of three main intestinal protozoan parasite (Cyptosprodium parvum, Giardia lamblia and Entamoeba histolytica) in Sudan. While the paper has merit, there are a few major challenges with the paper in the current format:

Page 1 (of the pdf version of the article):
Abstract
Introduction: Changed ‘’aged less than five years” by ‘’children”. Changed “Cryptosporidium spp.” by “Cryptosporidium parvum” and “Giardia lambelia” by “Giardia lamblia”.

Methods: This section isn’t sufficiently clear and precise. Please make the necessary changes. For example, you might say: “We conducted a cross-sectional survey among children under five years of age hospitalized with acute diarrhea between April to December 2014. Diarrheal stool samples were collected and examined for E. histolytica, C. parvum and G. lamblia using a multiplex real-time PCR method”.
The number of children included in the study must appear in the results section.

Results: Please make the necessary changes. For example, you might say: “A total of the 434 acute diarrheal children were included in this study”, following by average mean ± Standard deviation, median age and sex-ratio of this children, before presented global prevalence of parasitic infections, frequency of co-infection and more…

Discussion? I think the made a mistake in the title section of the abstract. Please write “conclusion” instead of “discussion”.

Page 3:
Introduction
Sentence 1: The two references cited are old and inappropriate. I recommend citing the WHO online document (Diarrhoeal disease: key facts, May 2, 2017) which is recent and, in my opinion, suitable for this affirmation.

Sentence 2: You say that diarrhea remains a major problem in terms of morbidity and mortality in children, which is true, but the references cited are not appropriate for this affirmation. I therefore recommend that you replace them with the following articles:

Estimates of the global, regional, and national morbidity, mortality, and aetiologies of diarrhoea in 195 countries: a systematic analysis for the Global Burden of Disease Study 2016 (Christopher Troeger et al., 2018);
Mapping geographical inequalities in childhood diarrhoeal morbidity and mortality in low-income and middle-income countries, 2000-17: analysis for the Global Burden of Disease Study 2017. Lancet. 2020 Jun 6;395(10239):1779-1801. doi: 10.1016/S0140-6736(20)30114-8.
GBD 2017 Causes of Death Collaborators. Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018 Nov 10;392(10159):1736-1788. doi: 10.1016/S0140-6736(18)32203-7.

Sentence 3: You claim: “More than 1 billion episodes occur […] than 5 years in developing countries”. This assertion is out of date, because thanks to advances in vaccination (e.g., the extension of rotavirus vaccination) and treatment (e.g., ORS), the burden of diarrheal disease has fallen considerably. Studies show that, over the last three decades, children under 5 years of age have accounted for the majority of deaths from diarrhoeal diseases, with around 1.7 million children in this age group dying in 1990. Your figure of 2.5 million deaths among children under 5 in developing countries is incorrect. Today, interesting data on mortality linked to diarrheal diseases in children are shown by:

WHO, title: Diarrheal diseases: highlights, posted online May 2, 2017.

This online document shows that there are around 1.7 billion cases of childhood diarrhea each year worldwide, and that diarrhea kills 525,000 children under the age of 5 each year).

Bernadeta Dadonaite, Hannah Ritchie and Max Roser (2018) - "Diarrheal diseases". Published online at OurWorldInData.org. Retrieved from: 'https://ourworldindata.org/diarrheal-diseases' [Online Resource].

According to this article available online, diarrhea killed 500,667 children under 5 worldwide in 2019.

Alternatively, you could say: “There are around 1.7 billion cases of childhood diarrhea each year, and diarrhea is estimated to have killed 500,667 children under the age of 5 worldwide in 2019”. (In this case, you'll need to cite the two online articles above).

I recommend that you modify sentence 3 according to one of the three choices I've indicated above.

Sentence 7: There's an error in the reference numbering; instead of reference number 10, you've written reference number 15. Please correct this error.

Overall, the introductory section needs to be revised, focusing on the most relevant references related to the topic and the most recent, preferably less than 5 years old, as I demonstrated above.

Methods
For greater clarity, please organize the following additional sections:

Ethical considerations ;
Design, area and period of study
Participants (inclusion and exclusion criteria), sample collection and storage
Nucleic acid extraction (already present)
PCR amplification and parasite detection (already present)
Statistical analysis (this is currently missing entirely).

Data on the total number of samples collected, as well as frequencies of hospitalized diarrheic children can be presented in the "results" section (below) in a section entitled "demographic data on the study population".

Section “PCR amplification and parasite detection”:
In the last sentence, the authors state that "Table 1 shows the sequences of the primers, probes and targeted genes, as well as the expected sizes", which is partially true as the expected sizes are not shown in Table 1. Please make the necessary corrections.

Table 1 also contains several references, both for organisms (reference number 5) and probes (reference numbers 16 and 19). I think this is a mistake! If not, please formulate appropriate sentences citing these references in the text before putting them in Table 1.

Results
There is some confusion between Cryptosporidium spp and Cryptosporidium parvum in this section. Cryptosporidium spp. refers to the genus Cryptosporidium, which includes over 30 species identified in mammals (C. parvum and C. hominis followed by C. mealegridis are the main species identified in humans), while C. parvum refers to a species of the genus Cryptoporidium, which is a so-called zoonotic species, unlike C. hominis, which is anthroponotic. I think you mean C. parvum, since according to the Verweij et al article first quoted in the methods section, the Cryptosporidium primers used were specific to C. parvum. Modifications therefore need to be made to this part of the work, in particular to the text and Tables 3, 4 and 5, as well as to the discussion.

For greater clarity, please organize the following additional sections:

Demographic data
Prevalence of parasitic infections (modify figure 1 into diagram)
Parasitic mono- and co-infections (modify table 5)
Distribution of mono- and co-infections by sex, age and seasonality.

Discussion
Paragraph 5: the last quotation (reference number 13) does not correspond to the penultimate sentence (But our result differed [...] from the age of the group by ≤ 2 years;).

Overall, the research results are not sufficiently valued. Limitations or weaknesses are not sufficiently highlighted.

Is the work clearly and accurately presented and does it cite the current literature?
No. Some of the bibliographical references cited are not appropriate to the assertion or argument put forward. In addition, there is an error in the numbering of the references cited by the authors.

Is the study design appropriate and is the work technically sound?
Partly. Although the work may have academic value, the study design is a little confusing, as some of the results on the demographic characteristics of the children included in the study are mixed with information on the study design. Inclusion and exclusion criteria for hospitalized children are not clearly presented. The study design needs to be properly reformulated.

Are sufficient details of methods and analysis provided to allow replication by others?
Partly.

If applicable, is the statistical analysis and its interpretation appropriate?
No. The statistical analyses carried out have not been set out in the "Methods" section, making interpretation of the results inappropriate. Furthermore, when percentages are mentioned, it is preferable to provide the figures used to calculate the prevalence or percentage, enabling the reader to interpret and evaluate the results more clearly.

Are all the source data underlying the results available to ensure full reproducibility?
Partly.

Are the conclusions drawn adequately supported by the results?
Partly.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

References

1. WHO: Diarrhoeal disease: key facts. May 2, 2017. Reference Source
2. Troeger C, Blacker B, Khalil I, Rao P, et al.: Estimates of the global, regional, and national morbidity, mortality, and aetiologies of diarrhoea in 195 countries: a systematic analysis for the Global Burden of Disease Study 2016. The Lancet Infectious Diseases. 2018; 18 (11): 1211-1228 Publisher Full Text
3. Reiner R, Wiens K, Deshpande A, Baumann M, et al.: Mapping geographical inequalities in childhood diarrhoeal morbidity and mortality in low-income and middle-income countries, 2000–17: analysis for the Global Burden of Disease Study 2017. The Lancet. 2020; 395 (10239): 1779-1801 Publisher Full Text
4. Roth G, Abate D, Abate K, Abay S, et al.: Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980–2017: a systematic analysis for the Global Burden of Disease Study 2017. The Lancet. 2018; 392 (10159): 1736-1788 Publisher Full Text
5. Dattani S, Spooner F, Ritchie H, Roser M: "Diarrheal Diseases". Published online at OurWorldInData.org. 2023. Reference Source

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Epidemiology of Infectious diseases

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 22 Mar 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

22 Mar 2024

Author Response

Thanks for these informative comments. I found it precise and increased the quality of our manuscript.
We took all reviewer comments, made corrections throughout the paper, and updated this version.
... Continue reading Thanks for these informative comments. I found it precise and increased the quality of our manuscript.
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments
Thanks for these informative comments. I found it precise and increased the quality of our manuscript.
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments
Competing Interests: No competing interests were disclosed. Close
Report a concern
Author Response 20 Jun 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

20 Jun 2024

Author Response

Thanks for your valuable comments
I corrected that point you mentioned as I changed gender to sex, then rewrote the sentence in a clear way and corrected the sentence in ... Continue reading Thanks for your valuable comments
I corrected that point you mentioned as I changed gender to sex, then rewrote the sentence in a clear way and corrected the sentence in the text that you commented on it
Thanks for your valuable comments
I corrected that point you mentioned as I changed gender to sex, then rewrote the sentence in a clear way and corrected the sentence in the text that you commented on it
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 22 Mar 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

22 Mar 2024

Author Response

Thanks for these informative comments. I found it precise and increased the quality of our manuscript.
We took all reviewer comments, made corrections throughout the paper, and updated this version.
... Continue reading Thanks for these informative comments. I found it precise and increased the quality of our manuscript.
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments
Thanks for these informative comments. I found it precise and increased the quality of our manuscript.
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments
Competing Interests: No competing interests were disclosed. Close
Report a concern
Author Response 20 Jun 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

20 Jun 2024

Author Response

Thanks for your valuable comments
I corrected that point you mentioned as I changed gender to sex, then rewrote the sentence in a clear way and corrected the sentence in ... Continue reading Thanks for your valuable comments
I corrected that point you mentioned as I changed gender to sex, then rewrote the sentence in a clear way and corrected the sentence in the text that you commented on it
Thanks for your valuable comments
I corrected that point you mentioned as I changed gender to sex, then rewrote the sentence in a clear way and corrected the sentence in the text that you commented on it
Competing Interests: No competing interests were disclosed. Close
Report a concern

Views

Reviewer Report 26 Jul 2023

Monira Sarmin, International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh

Approved with Reservations

https://doi.org/10.5256/f1000research.135782.r179572

This is an important study,

Write up needs a lot of improvement. Introduction is well written. However other sections need care especially the discussion, results were repeated many a times.

I am adding my ... Continue reading

Duration of the study?
How the sample size 437 were fixed? Did you calculate the sample size?
What was the sampling methods?
Did you enroll all children? Please add a study flow diagram.
What were the eligibility criteria?
Description of the study site might help the reader to gasp the scenario.
Is Jan- March winter season? Why excluded?
Methods section also need a description of the statistical analysis. Which analytical tools were used for data analysis?
Needs discussion with a statistician.

Results:

Usually a pie chart consists of 100%, though there is a label of 18.8, visually it is >50%, So, the figure 1 needs to corrected. You can build a pie of pie or bar of pie instead.
Table 4 indicates season as Autumn and summer, there is no elaboration in the method. Rather, it was labelled as dry and rainy seasons. Do they differ?
Did you collect only data on age, sex, season?
Their nutritional status, socio-economic condition, vaccination, housing, water supply Presence/absence of comorbidities, other laboratory analysis, outcome of this admission also needs to be incorporated.
Patient data were collected through a structured questionnaire, including age, gender, and season. This statement needs modification. We collect data on biological sex, not on gender. There is difference between sex and gender.
As much more samples were collected from boys (276) than from girls (161) in the age group ≤2 years (403, 92.2%), the comparisons between these variables were not relevant.—This statement is not correct, proportion is the most important indicator. And in the result section, we should only present the results. We have discussion section to accept or refute the results.
Did your facility receive more male child, or you have included more male children? What is the national proportion?
Table 2,3,4 could be merged to a single table- column containing the name of parasite and rows containing the distribution of age, sex, season and etc.

Discussion:

The highest rate of parasitic infection was seen in the ≤2 years group (32.7%) and much lower in the >2–≤4 years old group (2.7%) (Table 2). In contrast, the protozoal parasite was not detected in the age group of >4–<5. Why it happened? What is your explanation?
This study was conducted during two seasons (autumn and summer), from April to December 2014, however, in methods, July was not included.
male-to-female ratio of 1:1.7, this result first appeared in the discussion section, but it should be come in the result section first.
If maternal immunity is an important factor against parasitic infection, then it is assumed that older children had more parasitic infection than younger children, but this study did not find that.
A limitation section should be added.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

CITE

Report a concern

Author Response 22 Mar 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

22 Mar 2024

Author Response

Thanks for these informative comments ts really raise up our manuscript
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section ... Continue reading Thanks for these informative comments ts really raise up our manuscript
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments
Thanks for these informative comments ts really raise up our manuscript
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 22 Mar 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

22 Mar 2024

Author Response

Thanks for these informative comments ts really raise up our manuscript
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section ... Continue reading Thanks for these informative comments ts really raise up our manuscript
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments
Thanks for these informative comments ts really raise up our manuscript
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments
Competing Interests: No competing interests were disclosed. Close
Report a concern

Views

Reviewer Report 15 Feb 2023

Luther A Bartelt, Division of Infectious Diseases, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA

Renay Ngobeni, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA

Not Approved

https://doi.org/10.5256/f1000research.135782.r160656

The investigators report on the findings of 3 protozoans in children under 5 that were hospitalized for acute diarrhea. It is always helpful to have surveillance data for difficult to detect pathogens using molecular methods from a wide range of global sites. The report is therefore helpful in contributing data to improved understanding of local patterns of these globally distributed parasites.

The limitations, which the authors need to better explain, include a limited number of demographics variables (resulting in an inability to control for possible confounders that lead to a finding of a difference between M vs F Giardia status for example), the lack of reporting of statistical methods, the lack of reporting of PCR validation steps and whether any biomass or molecular method was used to standardize the DNA extraction, and the lack of a comparator of conventional-based diagnostics that would greatly enhance the differential sensitivity of the molecular methods (as it is one cannot discern if the difference in Cryptosporidium spp. reported in this study compared with others in Sudan as raised in the discussion is due to difference in diagnostic tools or difference in study population).

Also, the title is misleading. The study population appears to be children who were hospitalized for acute diarrhea. This population is different from a population consisting of diarrhea of any severity. We recommend the title be modified to better reflect the population studied: Molecular prevalence of three intestinal protozoa in young children hospitalized for acute diarrhea in rural Sudan. If this is a population of children with moderate-to-severe diarrhea (was there any tool to assess diarrhea severity other than hospitalization?), then the discussion should address and cite other studies specific to this acutely ill population.

General:

Spelling and grammar need to be reviewed throughout. For example, "lambelia" and Entameobia are wrong. For example, in the results section, should 'the comparisons between these variables were not relevant' read 'the comparisons...were not statistically significant'? It is not accurate to claim a comparison is irrelevant. Please clarify, or change all references to specific Cryptosporidium species to Cryptosporidium spp. (or show specific sequencing results that were used to determine the specific species).

Abstract:

Please provide consistent reporting in the results section. The N (%) notation as in the first sentence should be reported for all.

Methods:

Please include validation methods for the triple-plex PCR (eg. were there positive controls)? Is there conventional diagnostic data to accompany the PCR results? How did the team decide to dilute all fecal specimens into 10% saline? Was anything done to normalize the amount of fecal material at baseline (some diarrheal samples may already me more 'dilute' than others). QIAmp DNA stool extraction kits may be suboptimal for DNA extraction. Were any steps taken to enrich DNA from parasite (oo)cysts (for example, freeze-thaw and/or bead beating)?

For improved clarity, please organize with the following additional sections:

Ethical consideration
Study area and participants
Sample collection and storage
Nucleic acid extraction (already present)
PCR amplification and parasite detection (already present).
Statistical analysis (this is currently missing entirely)

Results:

Please provide a table with the demographics data for all variables recorded from the questionnaire. As in the abstract, please include N (%) notations for all reported results for consistency. Please apply consistent use of a) gender-specific terms (male and female rather than flipping to 'boys and girls'), b) seasonality (hot-dry vs rainy rather than flipping to summer vs autumn in the discussion). The PCR reported does not appear to be specific for Cryptosporidium parvum (as claimed in the abstract). Please clarify what "1" and "2" mean in the source data and why some columns are incomplete and why some text is red and other text is black.

Discussion:

Please expand on the importance of the finding of M vs F differences in G lamblia positivity, and in context with other published literature. Only one citation is used here, and little is articulated about the statement of "Kwam H." Important questions here would relate to exposure risks versus some other reason why male and female children would have different susceptibilities to infection. Please clarify this statement: "due to noninfectious reasons like hypersensitivity to certain food ingredients and weaning diarrhea that result of the inability of an underdeveloped child intestine to metabolize the food". What are the clinical/treatment implications of finding 35% prevalence of these 3 protozoa in children hospitalized in rural Sudan?

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: Funding from the NIH, Authorships with UpToDate and Elsevier.

Reviewer Expertise: Infectious diseases, intestinal protozoa epidemiology and pathogenesis, malnutrition, microbiota

We confirm that we have read this submission and believe that we have an appropriate level of expertise to state that we do not consider it to be of an acceptable scientific standard, for reasons outlined above.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 4

VERSION 4 PUBLISHED 29 Nov 2022

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2	3	4	5	6
Version 4 (revision) 23 Oct 24					read
Version 3 (revision) 14 Jun 24		read		read	read
Version 2 (revision) 28 Feb 24		read		read	read	read
Version 1 29 Nov 22	read	read	read

Luther A Bartelt, University of North Carolina at Chapel Hill, Chapel Hill, USA

Renay Ngobeni, University of North Carolina at Chapel Hill, Chapel Hill, USA
Monira Sarmin, International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh
Jean Bernard Lekana-Douki, University of Health Sciences, Owendo, Gabon; Université Des Sciences de La Santé, Libreville, Gabon
Francisco Ponce-Gordo, Complutense University of Madrid, Madrid, Spain
Lawrence R. Schiller, Baylor Scott & White Health, Dallas, USA
Sonia Boughattas, Qatar University, Doha, Qatar

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

5 Views

04 Nov 2024 | for Version 4

Lawrence R. Schiller, Baylor Scott & White Health, Dallas, Texas, USA

5 Views Cite this report Responses(0)

Approved

This observational study has limited generalizability or interest beyond the geographic region involved.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Diarrheal disease

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

12 Views

09 Sep 2024 | for Version 3

Francisco Ponce-Gordo, Complutense University of Madrid, Madrid, Spain

12 Views Cite this report Responses(1)

Not Approved

The authors have improved the article, however there are some points that should be corrected. The new consideration as "not approved" is based on the errors in the calculation of the percentage values for statistical analyses.
1. Presentation. There are typographical and or grammar errors in the text. To mention only a few, in abstract: in introduction, please write "parvum" in italics; in methods, "spp. were examined" should not be in italics; in results, in the first line, place a space in "diarrheawere", write 'Prevalence' in lower case, correct "age less than ≤ 2 years" to "age less than 2 years" or "age ≤ 2 years", correct the number (403,92.2%) or indicate what is each number, ...
In other cases, expressions are incorrect or have no sense; i.e., in discusion, paragraph #6: "infection with mono protozoan parasite was found ...", In this case, "single protozoan infections" would best be used.
There are many small corrections to do.
2. Content.
In abstract-results, "the incidence of protozoan infection ...". Change to "the number of positive cases ...". Incidence is the number of new cases in the population, and prevalence the number of infected persons in the population. In both cases, the population should be known (the total population, not the total number of symptomatic patients included in the study).
In methods-participants (inclusion and excllusion criteria): say only the conditions for inclusion/exclusion; the number of patients accepted will be provided in results. Also, "mostly lived" is not a criterion for inclusion/exclusion (the criterion for acceptance/rejection should be 'lived' or 'not lived' in a rural area)
In methods - table 1: what is target gene: DNA-like? "DNA-like" is not a gene.
Methods-statistical analysis: please indicate which variables were included in the analysis. As proportions were in some cases incorrectly calculated (see below), please revise the analysis and re-do.
In results-distribution of parastic infections by age, sex and seasonality: in order to keep consistency with the data provided in the previous subsection, please use the same format for each group: positive number/total number of samples (%)
In this same section, the fourth sentence ("Diarrhea remains ..." has no sense.The samples were collected from symptomatic patients, so all of them were diarrheic or, at least, the patients had diarrhea in the previous days. It cannot be said that "diarrhea remains the leading cause of illness in children", the data presented do not support this. This might be a comment for the discusion section, if adequate references are provided.
In diagram 1: "no pathogen" is not correct, please use "no protozoa". In those patients, diarrhea could have been caused by other pathogens as viruses or bacteria.
In tables 2-4: the percentages seem to be incorrectly calculated. For each category (i.e., for 0-2 years, 2-4 years, 4-5 years; for male and for females; and for autumn and summer), the percentage should be calculated as the number of positive cases/total number of cases in THE CATEGORY, not in the total. That is, for example in Giardia and the values in the 0-2 years category: 75 positive samples (in that category) respect to 403 samples (the number of 0-2 years samples analyzed), is 18.6% (not 48.4%, which has been calculated as the percentage of positive samples at that category, respect to the total number of positive samples for all categories and all parasites). All the percentages are incorrect, and the statistical results are also incorrect, this affecting the results and the discusion sections. Please provide the number of total cases for each category, and re-calculate the percentages accordingly.
In statistical analysis: it should be re-done. In the revised version, please indicate the results for all protozoa, not only one of them (as in the present case, only for Giardia). The sentence that it is now in the text is also incorrect, it should be something like "the occurrence of Giardia respect to sex is statistically signifcant, being greater in males than in females" or as "the occurrence of Giardia in male children was higher and statistically significant than in females".
In discusion, ending of the first paragraph, "sensitive": what about false negatives? Please provide references to support the statements.
Also in discusion: avoid paragraphs consisting on single sentences. Place the second paragraph at the end of the first one.
Discusion should be redone according to the new results from the statistical analysis. The geneal structure of the section followed now can be kept. Avoid repeating results (i.e., in the third paragraph, "As shown in table 2, ..." ); also, this paragraph would be best moved and included with the text dealing with Giardia.
In discusion, paragraph #6, "It should be noted that no protozoan pathogen was detected in stool samples". If this sentence applies to the reference just cited in the previous sentence (a study conducted in Khartoum state), please clearly state it. In the present study, some positive protozoan infections were detected in summer samples.

In conclusion: "the current investigation provided some vital information ...". The information provided in the manuscript is not of vital importance, please moderate the tone. The study focuses on the parasites that cause diarrhea, and these parasites are well-known pathogens. If the data were on the source of the infections (water or food), it would be very important as it will allow adopting preventive measures to avoid further infections.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Parasitology - Protozoology - molecular taxonomy

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

Respond to this report

Responses (1)

Author Response

23 Oct 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

We appreciate the insightful feedback provided, which has significantly enhanced the quality of our manuscript. In this revised version, we have incorporated your comments and suggestions. The key modifications include:
- Corrections made throughout the manuscript, including adjustments to the table and figure, as indicated by track changes.
- Updates to the percentages in all tables to reflect the appropriate categories.
- Revisions to the figure in accordance with the reviewers' recommendations.
- A thorough review for typographical and grammatical errors.
-We revise the reference position in the manuscript and update the related references accordingly.
In response to your comments, we have addressed the concerns raised and reanalyzed the statistical results accordingly.

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

8 Views

14 Aug 2024 | for Version 3

Monira Sarmin, International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh

8 Views Cite this report Responses(0)

Approved

The authors did the necessary revision. This version is more acceptable. Statistical section under methodology needs more elaboration.

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

5 Views

02 Jul 2024 | for Version 3

Lawrence R. Schiller, Baylor Scott & White Health, Dallas, Texas, USA

5 Views Cite this report Responses(0)

Not Approved

This paper reviews data collected 10 years ago. The patient sample was a convenience sample--patients admitted to hospital with acute diarrhea. This sample may not reflect prevalence of protozoal diarrhea in the larger population in Sudan. It only reflects the findings in patients so sick as to require hospitalization because of volume depletion or other complications of diarrhea. The discussion needs to be modified to mention this; the prevalence of protozoal diseases as a proportion of all diarrheal diseases may be impacted by the occurrence of outbreaks of other diarrheal diseases. Were there any concurrent outbreaks (e.g., cholera, E.coli, etc.) in 2014?
If the authors want to assess the prevalence of protozoal diarrhea in children in Sudan as the title indicates, the background carriage in asymptomatic children and the prevalence in children with diarrhea who are not hospitalized should be checked.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Diarrheal disease

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

31 Views

06 Jun 2024 | for Version 2

Sonia Boughattas, Qatar University, Doha, Doha, Qatar

31 Views Cite this report Responses(1)

Approved With Reservations

This work is of interest in the field with clear workflow and understandable impact.
However, several points need to be taken in consideration
-Language editing is required especially for the abstract and introduction parts
-G. lamblia name is no longer frequently used, please replace by G. intestinalis
-Within the Results section, different points need to be addressed:
i) I don’t believe the mention of “undiagnosed cases” is right. Same with the statement “No protozoan pathogen was detected in 282 (64.5%) diarrheal cases (Diagram 1).”
These cases can be due to other protozoan pathogens not screened in the current study as Blastocystis sp. Dientamoeba fragilis or even other Cryptosporidium and Entamoeba species.
I would suggest removing Diagram 1 and report only to the targeted protozoa prevalence.
ii) The statically significant p-value should be mentioned in Bold in the tables
-The discussion part lacks some sections: the difference in prevalence between genders within Giardia is statistically significant so this factor needs further comparisons and discussion.
Same for the season factor, an explanation should be provided according to t the literature on why high prevalences of protozoa are observed within the Wet season compared to the Dry season.
Once the different points are amended, the manuscript quality will be improved and thus be indexed.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Molecular epidemiologu, Protozoa, Zoonosis

Respond to this report

Responses (1)

Author Response

20 Jun 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

Thanks for the valuable comments. That will surely increase the quality of our manuscript, so for now, I have submitted version 3, which is being processed with a typesetter and will be available online soon. Fortunately, in this version, we addressed most of the points you mentioned( G.lamblia, “undiagnosed cases statement.) Which was also recommended by a past reviewer. Later, we will change the others. I wish to recheck it when it becomes available online
Best regards
Mosab adam

View more View less

Competing Interests

I disclose that no competing interests might be construed to influence your judgment of the article's or peer review report's validity or importance.

Back to all reports

Reviewer Report

11 Views

10 May 2024 | for Version 2

Lawrence R. Schiller, Baylor Scott & White Health, Dallas, Texas, USA

11 Views Cite this report Responses(0)

Not Approved

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Diarrheal disease

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

11 Views

07 May 2024 | for Version 2

Monira Sarmin, International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh

11 Views Cite this report Responses(1)

Approved With Reservations

The manuscript needs a few corrections.

The following things should be addressed before finalization.
1.Abstract: Results section needs revision:
1st line- 437 acute children were included, what does acute children mean?

2.The parasite infection rate was highest and lowest in the under 2-year-old group (32.7%), and in the 2–4-year-old group (2.7%), the infection rate was higher was higher in boys (23.7%) than in girls (11.7%). The incidence of protozoan infection was higher (37.7%) in the rainy season (August to December) (32.7%), corresponding with that in the dry Season (April to June). (2.7%).
This section needs revision, difficult to apprehend it.

3.Data collection: Patient data including age, biological gender, and Season, were collected through a structured questionnaire.
Actually, we record sex of the child not the gender.

4.Results: Table 3- probably the authors assessed sex not the gender.

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (1)

Back to all reports

Reviewer Report

24 Views

10 Apr 2024 | for Version 2

Francisco Ponce-Gordo, Complutense University of Madrid, Madrid, Spain

24 Views Cite this report Responses(1)

Approved With Reservations

General comments
Please correct the names of parasite species throughout the text. For the amoeba, it should be Entamoeba (not Entameobia). While the name Giardia lamblia is commonly used in medical literature, it is a synonym of either Giardia duodenalis, Giardia intestinalis, or Giardia enterica. Please refer to the taxonomic revision made by Wielinga et al. (2023)[Ref 1]. Even in the GenBank database, the entries identified as G. lamblia by different authors are identified in the source organism field as G. intestinalis.

In this study, the methodology (multiplex real-time PCR)
is based on a previous paper in which the human species were identified as monotypic, as G. intestinalis (= G. lamblia) and C. parvum; however, now these species have been separated into G. duodenalis/G. intestinalis/G. enterica and C. parvum/C. hominis, and all of which can infect humans; Since precise identification ...". What I want to say is that only G. intestinalis and C. parvum were considered in the study where the multiplex PCR was described because at that time these species were the only ones accepted.Most likely, if the study were carried out now, the authors would have said Giardia spp. and Cryptosporidium spp., because the methodology they developed does not allow to differentiate between G. duodenalis-
G. intestinalis-G. enterica, or between C. parvum-
C. hominis; all these species are now accepted as different but are morphologically indistinguishable.

When first mentioned, the species name should be indicated in full. As the abstract and the main text are usually considered different texts, please mention the species' full name in the main text when first mentioned, even if the species have been mentioned in the abstract.

Sometimes, the text is hard to understand. Please revise typographical errors (words, parentheses, spaces, punctuation signs), and grammar errors (e.g., the use of prepositions). A sentence should not start with an abbreviation or with a number in digits; in such cases, the number should be written in text. For example, in the Abstract-results section, it should start: "Four hundred and thirty-seven children with acute diarrhea ...". In the same paragraph, there is a sentence that should not start as "G. lamblia" but as "Giardia spp. (18.8%) and ...".

Comments on each section:

In keywords, I suggest including at least the genus names of the parasites: Giardia, Cryptosporidium, Entamoeba (or Giardia spp., Cryptosporidium spp., Entamoeba histolytica).

In the Introduction, it sounds strange to indicate "diarrhea is estimated to have killed 500,667 children". Such a level of precision seems to be not an estimation but a precise count. As there are probably cases that are not reported, I suggest rounding the number to "more than 500,000 children".

In the methods, please rewrite the paragraph about participants; it is hardly understandable.

In the results, in the "prevalence of parasitic infections" section, the genetic analysis is supposed to unambiguously diagnose E. histolytica, Giardia spp., and Cryptosporidium spp.; then, "A potential protozoal parasite was diagnosed ..." would be incorrect; it would be better to say "Protozoa were diagnosed in 166/437 (35.5%) cases, among which ... . None of them were detected in 282 (64.5%) diarrheal cases".

In the "Distribution of parasitic infection by age, sex, and seasonality" subsection, please add the number of positive/total samples where appropriate, to keep uniformity and clarify if the percentages were calculated as positive/total cases within each age range, or as positive/total number of cases. For example, if there were 143 positive cases in the <2 yo group, and 12 in the 2-4 yo group, the correct percentages would not be 143/437 (32.7%) and 12/437 (2.7%), but 143/155 (92.2%) and 12/32 (37.5%). Also, add the numbers to tables 2-5.

In this same subsection, the sentence "Diarrhea remains the leading cause and illness in children <2 years" is not a valid statement, as all samples considered were from symptomatic (diarrheic) patients, but no info is provided about the total number of persons (symptomatic and asymptomatic) in each age group in the population from which this group of patients was investigated.

In the results, nothing is said about the results of the statistical analysis (apart from the sentence "the comparisons between these variables were not relevant"). It seems that there are clear differences at least between the age groups. There are some comments in discussion (paragraph #4), but the data should be given in results.

In the discussion, please avoid repetition of data already provided. For example, paragraph #2 says the same thing already mentioned in the introduction and methods sections; paragraph #3 is a repetition of results. In paragraph #5, it is not necessary to repeat the numbers of samples and percentages; they are already given in results. There are texts that can be reduced in extension and/or removed.

In the paragraph starting "The result revealed a higher prevalence ...", please modify it to something like "... revealed a higher prevalence (35.5%) of protozoa capable of causing diarrhea disease in children under 5 years old".

In the paragraph before the last one, the sentence "It should be noted that no protozoan pathogen was detected in stool samples, ..." is it supposed to refer to the study (16) carried out in Khartoum state?

Expanding comments on the review form.

1. The literature is correct, however the text is sometimes hard to read and confuse. Results should be better presented. The name of the organisms should be revised and corrected.

2. The results of the statistical analysis should be provided in the text of the results section, or in a table. The correct percentage values should be re-calculated.

3. There is not a specific conclusions section. About the comments In the last paragraph of discussion, the authors stated:

- "The present study furnished some crucial insights into the protozoan cause of child diarrhea in Khartoum State". What are those "crucial insights"?

- "Findings will help us understand the importance of parasitic diarrhea in children younger than five years". What are this importance? (please note that only about one third of the diarrheal samples were positive to protozoa; what about the other two thirds?).

- "This study calls for the establishment of sensitive and specific molecular techniques". There are no comparative data on parasite diagnosis using non-molecular methods. It would be of great help to support this statement, the availablity of data from microscopical observations in stained/unstained preparations of the same samples, to make comparisons and draw conclusions.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

References

1. Wielinga C, Williams A, Monis P, Thompson RCA: Proposed taxonomic revision of Giardia duodenalis.Infect Genet Evol. 2023; 111: 105430 PubMed Abstract | Publisher Full Text

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Parasitology - Protozoology - molecular taxonomy

Respond to this report

Responses (1)

Author Response

20 Jun 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

Thanks for the valuable comment, which raised the quality of the article. I revised your comment throughout the article as follows.
We made revisions throughout the text with a valuable comment throughout the article with a tracker change, as follows
- we revised the typographical errors and grammar throughout the article
- we made the change of name of the pathogen text (giardia lamblia to giardia spp and intestinalis as the reviewer suggested, which was precise; however, for C.parvum, I checked the primer that was used in the study through the BLAST technique, and we found that it was specific for C.parvum and not detect .C.hominis,
-The correct percentage values were re-calculated from a total of positives in the table and changed in all article section
we add a section on statistical analysis in the result, as also presented in the tables, and we add a subsection of total cases to each of Tables 2,3,4
- we revised the discussion by removing repeated sentences, and we removed the points you mention
-we add conclusion suction
-regarding the two-thirds of the samples were negative, I already mentioned in the discussion by proven
that infections with other pathogens like viruses and bacteria also may be due to noninfectious reasons like hypersensitivity to certain food ingredients; besides that, we conducted another study to detect other causes of viral and bacteria in Khartoum state in the flowing link (https://pubmed.ncbi.nlm.nih.gov/29487571/)
All our study samples were collected from symptomatic children with diarrhea admitted to the hospital for 1 to 4 days.
Unfortunately, we could not investigate using a non-molecular technique; hence, we collected it in Sudan and tested it in China. There, the laboratory has to use only facility-molecular techn

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

30 Views

01 Aug 2023 | for Version 1

Jean Bernard Lekana-Douki, University of Health Sciences, Owendo, Gabon; Université Des Sciences de La Santé, Libreville, Gabon

30 Views Cite this report Responses(2)

Approved With Reservations

Estimates of the global, regional, and national morbidity, mortality, and aetiologies of diarrhoea in 195 countries: a systematic analysis for the Global Burden of Disease Study 2016 (Christopher Troeger et al., 2018);
Mapping geographical inequalities in childhood diarrhoeal morbidity and mortality in low-income and middle-income countries, 2000-17: analysis for the Global Burden of Disease Study 2017. Lancet. 2020 Jun 6;395(10239):1779-1801. doi: 10.1016/S0140-6736(20)30114-8.
GBD 2017 Causes of Death Collaborators. Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018 Nov 10;392(10159):1736-1788. doi: 10.1016/S0140-6736(18)32203-7.

WHO, title: Diarrheal diseases: highlights, posted online May 2, 2017.

This online document shows that there are around 1.7 billion cases of childhood diarrhea each year worldwide, and that diarrhea kills 525,000 children under the age of 5 each year).

Bernadeta Dadonaite, Hannah Ritchie and Max Roser (2018) - "Diarrheal diseases". Published online at OurWorldInData.org. Retrieved from: 'https://ourworldindata.org/diarrheal-diseases' [Online Resource].

According to this article available online, diarrhea killed 500,667 children under 5 worldwide in 2019.

Alternatively, you could say: “There are around 1.7 billion cases of childhood diarrhea each year, and diarrhea is estimated to have killed 500,667 children under the age of 5 worldwide in 2019”. (In this case, you'll need to cite the two online articles above).

Ethical considerations ;
Design, area and period of study
Participants (inclusion and exclusion criteria), sample collection and storage
Nucleic acid extraction (already present)
PCR amplification and parasite detection (already present)
Statistical analysis (this is currently missing entirely).

Demographic data
Prevalence of parasitic infections (modify figure 1 into diagram)
Parasitic mono- and co-infections (modify table 5)
Distribution of mono- and co-infections by sex, age and seasonality.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

References

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Epidemiology of Infectious diseases

Respond to this report

Responses (2)

Author Response

22 Mar 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

Thanks for these informative comments. I found it precise and increased the quality of our manuscript.
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

39 Views

26 Jul 2023 | for Version 1

Monira Sarmin, International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh

39 Views Cite this report Responses(1)

Approved With Reservations

Duration of the study?
How the sample size 437 were fixed? Did you calculate the sample size?
What was the sampling methods?
Did you enroll all children? Please add a study flow diagram.
What were the eligibility criteria?
Description of the study site might help the reader to gasp the scenario.
Is Jan- March winter season? Why excluded?
Methods section also need a description of the statistical analysis. Which analytical tools were used for data analysis?
Needs discussion with a statistician.

Results:

Usually a pie chart consists of 100%, though there is a label of 18.8, visually it is >50%, So, the figure 1 needs to corrected. You can build a pie of pie or bar of pie instead.
Table 4 indicates season as Autumn and summer, there is no elaboration in the method. Rather, it was labelled as dry and rainy seasons. Do they differ?
Did you collect only data on age, sex, season?
Their nutritional status, socio-economic condition, vaccination, housing, water supply Presence/absence of comorbidities, other laboratory analysis, outcome of this admission also needs to be incorporated.
Patient data were collected through a structured questionnaire, including age, gender, and season. This statement needs modification. We collect data on biological sex, not on gender. There is difference between sex and gender.
As much more samples were collected from boys (276) than from girls (161) in the age group ≤2 years (403, 92.2%), the comparisons between these variables were not relevant.—This statement is not correct, proportion is the most important indicator. And in the result section, we should only present the results. We have discussion section to accept or refute the results.
Did your facility receive more male child, or you have included more male children? What is the national proportion?
Table 2,3,4 could be merged to a single table- column containing the name of parasite and rows containing the distribution of age, sex, season and etc.

Discussion:

The highest rate of parasitic infection was seen in the ≤2 years group (32.7%) and much lower in the >2–≤4 years old group (2.7%) (Table 2). In contrast, the protozoal parasite was not detected in the age group of >4–<5. Why it happened? What is your explanation?
This study was conducted during two seasons (autumn and summer), from April to December 2014, however, in methods, July was not included.
male-to-female ratio of 1:1.7, this result first appeared in the discussion section, but it should be come in the result section first.
If maternal immunity is an important factor against parasitic infection, then it is assumed that older children had more parasitic infection than younger children, but this study did not find that.
A limitation section should be added.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (1)

Author Response

22 Mar 2024

Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China

Thanks for these informative comments ts really raise up our manuscript
We took all reviewer comments, made corrections throughout the paper, and updated this version.
1. rewrote the abstract section and updated it according to the reviewer's suggesting
2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones
3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments
4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram
5. update the discussion section and address the reviewer's comments

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

32 Views

15 Feb 2023 | for Version 1

Luther A Bartelt, Division of Infectious Diseases, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA

Renay Ngobeni, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA

32 Views Cite this report Responses(0)

Not Approved

Ethical consideration
Study area and participants
Sample collection and storage
Nucleic acid extraction (already present)
PCR amplification and parasite detection (already present).
Statistical analysis (this is currently missing entirely)

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

Funding from the NIH, Authorships with UpToDate and Elsevier.

Reviewer Expertise

Infectious diseases, intestinal protozoa epidemiology and pathogenesis, malnutrition, microbiota

Respond to this report

Responses (0)

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Khalil I, Colombara D, Forouzanfar M, et al.: Burden of Diarrhea in the Eastern Mediterranean Region, 1990 2013: Findings from the Global Burden of Disease Study 2013. Am. J. Trop. Med. Hyg. 2016; 6(95): 1132–1319.

[2] 2. Vargas M, Gascon J, Casals C, et al.: Etiology of diarrhea in children less than five years of age in Ifakara, Tanzania. Am. J. Trop. Med. Hyg. 2004; 70(5): 536–539. PubMed Abstract | Publisher Full Text

[3] 3. Dean TJFR, Makgoba MW, Bos ER, et al.: Disease and mortality in sub-Saharan Africa.2nd ed.2006.

[4] 4. Gupta DA: Study of the prevalence of diarrhea in children under the age of five years: its association with wasting. Indian J. Sci. Res. 2014; 7(1): 1315–1318.

[5] 5. Ngosso BEN, Namkinga G: Identification of Pathogenic Intestinal Parasitic Protozoa Associated with Diarrhea among Under-fives Children in Dar Es Salaam, Tanzania. Int. J. Med. Med. Sci. 2015; 2(4): 49–55.

[6] 6. Chen J, Tang J, Liu J, et al.: Development and evaluation of a multiplex PCR for simultaneous detection of five foodborne pathogens. J. Appl. Microbiol. 2012; 112(4): 823–830. PubMed Abstract | Publisher Full Text

[7] 7. Quin A: Diarrhea likelihood in Ghanaian children: A Study of the Association between Diarrhea and Water and Sanitation Infrastructure. Master thesis of Public Policy in the Georgetown Institute.2009; p. 74.

[8] 8. Michael HMM, Cleveland C: Water pollution. Encyclopedia of Earth, National Council for Science and the Environment.2010.

[9] 9. Organization WH: The world health report 2005—Make every mother and child count. Geneva, Switzerland:WHO Press;2013.

[10] 10. Verweij JJ, Blange RA, Templeton K, et al.: Simultaneous detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in fecal samples by using multiplex real-time PCR. J. Clin. Microbiol. 2004; 42(3): 1220–1223. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. Khwam H, Hayat D, Abdul M: Parasitic infections causing diarrhoea among children less than six years at Al-Nasiriya province. J. Uni. Thi-Qar. 2016; 4(11): 134–142.

[12] 12. Sherchand B, Yokoo M, Sherchand O, et al.: Burden of Enteropathogens Associated Diarrheal Diseases in Children Hospital, Nepal. Sci. World. 2010; 7(7): 71–75. Publisher Full Text

[13] 13. Shamshul A, Keshab P, Bharat Mani P, et al.: Pattern of Acute Parasitic Diarrhea in Children Under Five Years of Age in Kathmandu, Nepal. Open J. Med. Microbiol. 2012; 02: 95–100. Publisher Full Text

[14] 14. Saeed A, Abd H, Sandstrom G: Microbial etiology of acute diarrhea in children under five years of age in Khartoum, Sudan. J. Med. Microbil. 2015; 64(4): 432–437. PubMed Abstract | Publisher Full Text

[15] 15. Firdu T, Abunna F, Girma M: Intestinal Protozoal Parasites in Diarrheal Children and Associated Risk Factors at Yirgalem Hospital, Ethiopia: A Case-Control Study. Int. Sch. Res. Notices. 2014; 2014: 1–8. Publisher Full Text

[16] 16. Samie A, Guerrant RL, Barrett L, et al.: Prevalence of intestinal parasitic and bacterial pathogens in diarrhoeal and non-diarrhoeal human stools from Vhembe district, South Africa. J. Health Popul. Nutr. 2009; 27(6): 739–745. PubMed Abstract

[17] 17. Mezeid N, Shaldoum F, Al-Hindi AI, et al.: Prevalence of intestinal parasites among the population of the Gaza Strip, Palestine. Ann. Parasitol. 2014; 60(4): 281–289. PubMed Abstract

[18] 18. C.M.U1 A, OAN, CUN: Etiology of Acute Diarrhoea Among Children In Owerri, Imo State Nigeria. App. Sci. Rep. 2015; 10(3): 128–132.

[19] 19. Saikruang W, Khamrin P, Suantai B, et al.: Detection of diarrheal viruses circulating in adult patients in Thailand. Arch. Virol. 2014; 159(12): 3371–3375. PubMed Abstract | Publisher Full Text

[20] 20. Adam M, Du H, Enan KA, et al.: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan. figshare.2022. Publisher Full Text

Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan

Abstract

Keywords

Introduction

Methods

Nucleic acid extraction

PCR amplification and parasite detection

Table 1.

Result

Figure 1. Overview of protozoal parasite infections.

Table 2. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the age.

Table 3. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the gender.

Table 4. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the Seasons.

Table 5. Frequency of samples with co-infections.

Discussion

Authors contributions

Data availability

Underlying data

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated