ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Data Note
Revised

Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence

[version 3; peer review: 2 approved]
* Equal contributors
PUBLISHED 11 Jun 2024
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the YCharOS (Antibody Characterization through Open Science) gateway.

Abstract

Tyrosine-protein kinase SYK, encoded by the SYK gene, is a non-receptor type protein kinase which mediates immune signal transduction through immunoreceptors. Tyrosine-protein kinase SYK expression has been associated with the development of various inflammatory diseases, cancer and neurodegenerative conditions. The reproducibility of tyrosine-protein kinase SYK research would help elucidate the mechanism in which it causes neuroinflammation as well as its potential as a novel target to treat Alzheimer’s disease. This would be facilitated with the availability of high-quality tyrosine-protein kinase SYK. In this study, we characterized thirteen tyrosine-protein kinase SYK commercial antibodies for Western Blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs.

Keywords

Uniprot ID P43405, SYK, tyrosine-protein kinase SYK, spleen tyrosine kinase, antibody characterization, antibody validation, Western Blot, immunoprecipitation

Revised Amendments from Version 2

In the latest version of this article, we have clarified the selection process antibodies were selected for Western Blots assessment of antibody performance in the immunoprecipitation experiments. Additionally, we have included the method used to determine protein concentration of the lysates.

See the authors' detailed response to the review by Araujo Nelson A

Introduction

Tyrosine-protein kinase SYK, also known as spleen tyrosine kinase (SYK), is a non-receptor type of protein-tyrosine kinase (PTK) predominantly recognized for its role in amplifying immune responses.1 Unique to other families of PTKs, SYK has tandem N-terminal Src homology 2 (SH2) domains as well as a tyrosine kinase domain at its C-terminal region. Binding of the SH2 domains to di-phosphorylated immunoreceptor tyrosine-based activating motif (ITAM) activates SYK, triggering downstream inflammatory signalling cascades.13

Functioning as a vital mediator of cellular inflammatory responses, SYK is primarily known to contribute to allergies,4 autoimmune diseases5,6 and B-cell malignancies.7 Emerging research has suggested SYK may be implicated in the development in neuroinflammatory symptoms that are characteristic of Alzheimer’s disease (AD).8,9 As such, studies have demonstrated that inhibition or down-regulation of SYK increases amyloid-beta (Aβ) clearance and decreases Tau hyperphosphorylation, highlighting it’s potential as a therapeutic target to treat AD.911 Further investigation is required to elucidate the mechanism in which SYK influences Tau pathology and Aβ deposition.8

Mechanistic studies would be greatly facilitated with the availability of high-quality antibodies. Here, we compared the performance of a range of commercially available antibodies for tyrosine-protein kinase SYK and validated several antibodies for Western Blot, immunoprecipitation and immunofluorescence, enabling biochemical and cellular assessment of tyrosine-protein kinase SYK properties and function.

Results and discussion

Our standard protocol involves comparing readouts from wild-type and knockout cells.1222 To identify a cell line that expresses adequate levels of tyrosine-protein kinase SYK protein expression to provide sufficient signal to noise, we examined public proteomics databases, namely PaxDB23 and DepMap.24 THP-1 was identified as a suitable cell line and thus THP-1 was modified with CRISPR/Cas9 to knockout the corresponding SYK gene (Table 1).

Table 1. Summary of the cell lines used.

InstitutionCatalog numberRRID (Cellosaurus)Cell lineGenotype
Abcamab271147CVCL_0006THP-1WT
Abcamab288700-THP-1SYK KO

For Western Blot experiments, we resolved proteins from WT and SYK KO cell extracts and probed them side-by-side with all antibodies in parallel1322 (Figure 1).

78b4de7e-5d1f-407a-87cb-8045a79ea185_figure1.gif

Figure 1. Tyrosine-protein kinase SYK antibody screening by Western Blot.

Lysates of THP-1 (WT and SYK KO) were prepared, and 30 μg of protein were processed for Western Blot with the indicated tyrosine-protein kinase SYK antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. An exception was given for antibody GTX633910*, which was titrated to 1/250 as the signal was too weak when following the supplier’s recommendations. Antibody dilutions used: MA1-19332* at 1/1000, 13198** at 1/1000, 80460* at 1/1000, 12358** at 1/1000, GTX633910* at 1/250, MAB7166* at 1/250, NBP1-03250* at 1/500, 66721-1-lg* at 1/2000, AFFN-SYK-5A10* at 1/200, ab3993* at 1/500, ab40781** at 1/1000, ab244701** at 1/1000, ab244968** at 1/1000. Predicted band size: 72 kDa. *Monoclonal antibody, **Recombinant antibody.

For immunoprecipitation experiments, we used the antibodies to immunopurify tyrosine-protein kinase SYK from THP-1 cell extracts. The performance of each antibody was first evaluated by detecting whether they could immunocapture tyrosine-protein kinase SYK. Antibodies that successfully captured the protein were further evaluated by immunoprecipitation1322 (Figure 2). To detect tyrosine-protein kinase SYK, Western Blots were performed with antibodies previously KO-validated under the conditions tested in Figure 1.

78b4de7e-5d1f-407a-87cb-8045a79ea185_figure2.gif

Figure 2. Tyrosine-protein kinase SYK antibody screening by immunoprecipitation.

THP-1 lysates were prepared, and immunoprecipitation was performed using 2.0 μg of the indicated tyrosine-protein kinase SYK antibodies pre-coupled to Dynabeads protein G or protein A. A) Ability of the antibodies to immunocapture tyrosine-protein kinase SYK was first assessed by comparing the level of protein available in the starting material to the level remaining in the unbound fractions. B) The immunoprecipitates for antibodies which would immunocapture tyrosine-protein kinase SYK in (A) are shown. For Western Blot, 80460* and ab244968** were used at 1/3000. The Ponceau stained transfers of each blot are shown. SM = 10% starting material; UB = 10% unbound fraction; IP = immunoprecipitated. *Monoclonal antibody, **Recombinant antibody.

For immunofluorescence, as described previously, antibodies were screened using a mosaic strategy.25 In brief, we plated WT and SYK KO cells together in the same well and imaged both cell types in the same field of view to reduce staining, imaging and image analysis bias (Figure 3).

78b4de7e-5d1f-407a-87cb-8045a79ea185_figure3.gif

Figure 3. Tyrosine-protein kinase SYK antibody screening by immunofluorescence.

THP-1 WT and SYK KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated tyrosine-protein kinase SYK antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody including DAPI. Acquisition of the blue (nucleus-DAPI), green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of the merged blue and red (grayscale) channels are shown. WT and KO cells are outlined with yellow and magenta dashed line, respectively. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies GTX633910* and 66721-1-lg*, which were titrated to 1/2000 and 1/1000, respectively, as the signals were too weak when following the supplier’s recommendations. When the concentration was not indicated by the supplier, which was the case for antibodies ab3993*, ab244701**, and ab244968**, we tested antibodies at 1/1000. At this concentration, the signal from each antibody was in the range of detection of the microscope used. Antibody dilution used: MA1-19332* at 1/1000, 13198** at 1/400, 80460* at 1/400, 12358** at 1/400, GTX633910* at 1/2000, MAB7166* at 1/500, NBP1-03250* at 1/500, 66721-1-lg* at 1/1000, AFFN-SYK-5A10* at 1/60, ab3993* at 1/1000, ab40781** at 1/700, ab244701** at 1/1000, ab244968** at 1/1000. Bars = 10 μm. *Monoclonal antibody, **Recombinant antibody.

In conclusion, we have screened tyrosine-protein kinase SYK commercial antibodies by Western Blot, immunoprecipitation and immunofluorescence and identified several high-quality antibodies under our standardized experimental conditions. Under our standardized experimental conditions, several high-quality antibodies were identified, however, the authors do not engage in result analysis or offer explicit antibody recommendations. A limitation of this study is the use of universal protocols - any conclusions remain relevant within the confines of the experimental setup and cell line used in this study. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. The underlying data supporting this study is found on Zenodo, an open access repository.26,27

Methods

Antibodies

All tyrosine-protein kinase SYK antibodies are listed in Table 2, together with their corresponding Research Resource Identifiers, or RRID, to ensure the antibodies are cited properly.28 Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-rabbit and anti-mouse secondary antibodies are from Thermo Fisher Scientific (cat. number A21429 and A21424). The AFFN-SYK-5A10* antibody was deposited to the Developmental Studies Hybridoma Bank (DSHB) by EU Program Affinomics (DSHB Hybridoma Product AFFN-SYK-5A10).

Table 2. Summary of the Tyrosine-protein kinase SYK antibodies tested.

CompanyCatalog numberLot numberRRID (Antibody Registry)ClonalityClone IDHostConcentration (μg/μL)Vendors recommended applications
Thermo Fisher ScientificMA1-19332*Wb3186395AB_2197214monoclonalSYK-01mouse1.00Wb, IP, IF
Cell Signaling Technology13198**9AB_2687924recombinant-monoD3Z1Erabbitnot providedWb, IP
Cell Signaling Technology80460*1AB_2799953monoclonal4D10mousenot providedWb, IP, IF
Cell Signaling Technology12358**1AB_2687923recombinant-monoD1l5Qrabbitnot providedWb, IP
GeneTexGTX633910*43314AB_2888388monoclonalGT351mouse2.83Wb, IF
Bio-TechneMAB7166*CFUQ0117021AB_10972948monoclonal720402mouse0.50Wb
Bio-TechneNBP1-03250*199549AB_1522471monoclonalSYK-01mouse0.50Wb, IP
Proteintech66721-1-lg*10006710AB_2882072monoclonal4C4A12mouse1.00Wb, IF
Developmental Studies Hybridoma BankAFFN-SYK-5A10*4/28/2016AB_2617957monoclonalAFFN-SYK-5A10mouse0.062other
Abcamab3993*GR3203808-21AB_304217monoclonalSYK-01mouse1.00Wb, IF
Abcamab40781**GR3273231-3AB_778196recombinant-monoEP573Yrabbit0.71Wb, IF
Abcamab244701**GR3273514-3AB_29102441recombinant-monoEPR19414-176rabbit1.01other
Abcamab244968**GR3273515-3AB_29102451recombinant-monoEPR573-69rabbit0.99other

* Monoclonal antibody.

** Recombinant antibody.

1 Refers to RRID that were recently created (July 2023) and will be added to the Antibody Registry in the coming weeks.

CRISPR/Cas9 genome editing

Cell lines used are listed in Table 1. THP-1 SYK KO clone was generated with low passage cells using an open-access protocol available on Zenodo.org: https://zenodo.org/record/3875777#.ZA-Rxi-96Rv. Two guide RNAs were used to knockout SYK in THP-1 using the CRISPR-Cas9 technology (sequence guide 1: TTTCGGCAACATCACCCGGG, sequence guide 2: GCTCCCGCTCGATGGTGTAG).

Cell culture

Both THP-1 WT and SYK KO cell lines used are listed in Table 1, together with their corresponding RRID, to ensure the cell lines are cited properly.29 Cells were cultured in DMEM high-glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065, 100 IU penicillin and 100 μg/mL streptomycin (Wisent cat. number 450201).

Antibody screening by Western Blot

Western Blots were performed as described in our standard operating procedure.30 Protein concentration of the lysates was measured using a BCA protein assay kit. The resulting protein concentrations was adjusted to ensure equal amounts of protein in the WT and KO lysates were loaded in each lane.

THP-1 WT and SYK KO were collected in RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) (Thermo Fisher Scientific, cat. number 89901) supplemented with protease inhibitor. Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 × g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western Blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used.

Western Blots were performed with large 5–16% gradient polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the Blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual Western Blots. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4°C with 5% bovine serum albumin (BSA) (Wisent, cat. number 800-095) in TBS with 0.1% Tween 20 (TBST) (Cell Signalling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/mL in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) prior to detection with the HyBlot CL autoradiography films (Denville, cat. number 1159T41).

Antibody screening by immunoprecipitation

Immunoprecipitation was performed as described in our standard operating procedure.31 Antibody-bead conjugates were prepared by adding 2 μg or 10 μL of antibody at an unknown concentration to 500 μL of Pierce IP Lysis Buffer (Thermo Fisher Scientific, cat. number 87788) in a 1.5 mL microcentrifuge tube, together with 30 μL of Dynabeads protein A - (for rabbit antibodies) or protein G - (for mouse antibodies) (Thermo Fisher Scientific, cat. number 10002D and 10004D). Tubes were rocked for ~ 2 hrs at 4°C followed by several washes to remove unbound antibodies.

THP-1 WT were collected in Pierce IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) supplemented with protease inhibitor. Lysates were rocked 30 min at 4°C and spun at 110,000 × g for 15 min at 4°C. One mL aliquots at 1.0 mg/mL of lysate were incubated with an antibody-bead conjugate for ~2 hrs at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of IP lysis buffer and processed for SDS-PAGE and Western Blot on 5–16% gradient polyacrylamide gels.

Antibody screening by immunofluorescence

Immunofluorescence was performed as described in our standard operating procedure.1322,25 THP-1 WT and SYK KO were labelled with a green and a far-red fluorescence dye, respectively (Thermo Fisher Scientific, cat. number C2925 and C34565). The nuclei were labelled with DAPI (Thermo Fisher Scientific, cat. number D3571) fluorescent stain. WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37oC, 5% CO2. Cells were fixed in 4% paraformaldehyde (PFA) (Beantown chemical, cat. number 140770-10 ml) in phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL). Cells were permeabilized in PBS with 0,1% Triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary tyrosine-protein kinase SYK antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/mL for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).

Imaging was performed using a Zeiss LSM 700 laser scanning confocal microscope equipped with a Plan-Apo 20x air objective (NA = 0.8). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.1.2) to adjust contrast then assembled with Adobe Illustrator (version 27.3.1).

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 27 Sep 2023
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Alshafie W, Fotouhi M, Ayoubi R et al. Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence [version 3; peer review: 2 approved]. F1000Research 2024, 12:1222 (https://doi.org/10.12688/f1000research.140456.3)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 3
VERSION 3
PUBLISHED 11 Jun 2024
Revised
Views
10
Cite
Reviewer Report 28 Jun 2024
Araujo Nelson A, Universidad de O'Higgins, Rancagua, O'Higgins Region, Chile 
Approved
VIEWS 10
The answers to the questions ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Nelson A A. Reviewer Report For: Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence [version 3; peer review: 2 approved]. F1000Research 2024, 12:1222 (https://doi.org/10.5256/f1000research.167657.r289607)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 2
VERSION 2
PUBLISHED 09 Oct 2023
Revised
Views
21
Cite
Reviewer Report 16 Feb 2024
Araujo Nelson A, Universidad de O'Higgins, Rancagua, O'Higgins Region, Chile 
Approved with Reservations
VIEWS 21
Full Report.
  • The data note entitled "Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation, and immunofluorescence" compares thirteen commercial antibodies against tyrosine-protein kinase SYK using three different immunodetection techniques to provide
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Nelson A A. Reviewer Report For: Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence [version 3; peer review: 2 approved]. F1000Research 2024, 12:1222 (https://doi.org/10.5256/f1000research.157120.r235832)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 20 Jun 2024
    Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada
    20 Jun 2024
    Author Response
    Thank you Araujo Nelson A. for your comprehensive reviewer report for our article. Please see below our responses to your specific comments and concerns.
    • The data note entitled
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 20 Jun 2024
    Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada
    20 Jun 2024
    Author Response
    Thank you Araujo Nelson A. for your comprehensive reviewer report for our article. Please see below our responses to your specific comments and concerns.
    • The data note entitled
    ... Continue reading
Views
17
Cite
Reviewer Report 03 Jan 2024
Kiyonao Sada, University of Fukui, Fukui, Japan 
Approved
VIEWS 17
The importance of the protein-tyrosine kinase Syk has been highlighted in new research areas for studying the pathogenesis and developing treatments of neurological diseases. In this study, the authors compare the usefulness of anti-Syk antibody-based approaches using wild-type and ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Sada K. Reviewer Report For: Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence [version 3; peer review: 2 approved]. F1000Research 2024, 12:1222 (https://doi.org/10.5256/f1000research.157120.r228375)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 27 Sep 2023
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.