Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence

Walaa Alshafie; Maryam Fotouhi; Riham Ayoubi; Kathleen Southern; Carl Laflamme; NeuroSGC/YCharOS collaborative group

doi:10.12688/f1000research.140456.3

Home Browse Identification of high-performing antibodies for tyrosine-protein...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Data Note

Revised

Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence

[version 3; peer review: 2 approved]

Walaa Alshafie¹^*, Maryam Fotouhi¹^*, Riham Ayoubi¹, Kathleen Southern¹, Carl Laflamme ¹, NeuroSGC/YCharOS collaborative group

Walaa Alshafie¹^*, Maryam Fotouhi¹^*, [...] Riham Ayoubi¹, Kathleen Southern¹, Carl Laflamme ¹, NeuroSGC/YCharOS collaborative group

^* Equal contributors

PUBLISHED 11 Jun 2024

Author details Author details

¹ Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Québec, H3A 2B4, Canada

Walaa Alshafie
Roles: Investigation, Methodology, Writing – Review & Editing

Maryam Fotouhi
Roles: Investigation, Writing – Review & Editing

Riham Ayoubi
Roles: Methodology, Visualization, Writing – Review & Editing

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Carl Laflamme
Roles: Conceptualization, Funding Acquisition, Methodology, Supervision, Validation, Visualization, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the YCharOS (Antibody Characterization through Open Science) gateway.

Abstract

Tyrosine-protein kinase SYK, encoded by the SYK gene, is a non-receptor type protein kinase which mediates immune signal transduction through immunoreceptors. Tyrosine-protein kinase SYK expression has been associated with the development of various inflammatory diseases, cancer and neurodegenerative conditions. The reproducibility of tyrosine-protein kinase SYK research would help elucidate the mechanism in which it causes neuroinflammation as well as its potential as a novel target to treat Alzheimer’s disease. This would be facilitated with the availability of high-quality tyrosine-protein kinase SYK. In this study, we characterized thirteen tyrosine-protein kinase SYK commercial antibodies for Western Blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs.

Keywords

Uniprot ID P43405, SYK, tyrosine-protein kinase SYK, spleen tyrosine kinase, antibody characterization, antibody validation, Western Blot, immunoprecipitation

Corresponding author: Carl Laflamme

Competing interests: For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: Abcam; Aviva Systems Biology; Bio Techne; Cell Signalling Technology; Developmental Studies Hybridoma Bank; GeneTex; Horizon Discovery; Proteintech; Synaptic Systems; Thermo Fisher Scientific.

Grant information: This work was supported by a grant from the by the Emory-Sage-SGC TREAT-AD center established by the National Institute on Aging under award number U54AG065187. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). RA and WA were supported by a Mitacs fellowship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2024 Alshafie W et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Alshafie W, Fotouhi M, Ayoubi R et al. Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence [version 3; peer review: 2 approved]. F1000Research 2024, 12:1222 (https://doi.org/10.12688/f1000research.140456.3) First published: 27 Sep 2023, 12:1222 (https://doi.org/10.12688/f1000research.140456.1) Latest published: 11 Jun 2024, 12:1222 (https://doi.org/10.12688/f1000research.140456.3)

Revised Amendments from Version 2

In the latest version of this article, we have clarified the selection process antibodies were selected for Western Blots assessment of antibody performance in the immunoprecipitation experiments. Additionally, we have included the method used to determine protein concentration of the lysates.

See the authors' detailed response to the review by Araujo Nelson A

Introduction

Tyrosine-protein kinase SYK, also known as spleen tyrosine kinase (SYK), is a non-receptor type of protein-tyrosine kinase (PTK) predominantly recognized for its role in amplifying immune responses.¹ Unique to other families of PTKs, SYK has tandem N-terminal Src homology 2 (SH2) domains as well as a tyrosine kinase domain at its C-terminal region. Binding of the SH2 domains to di-phosphorylated immunoreceptor tyrosine-based activating motif (ITAM) activates SYK, triggering downstream inflammatory signalling cascades.¹^–³

Functioning as a vital mediator of cellular inflammatory responses, SYK is primarily known to contribute to allergies,⁴ autoimmune diseases⁵^,⁶ and B-cell malignancies.⁷ Emerging research has suggested SYK may be implicated in the development in neuroinflammatory symptoms that are characteristic of Alzheimer’s disease (AD).⁸^,⁹ As such, studies have demonstrated that inhibition or down-regulation of SYK increases amyloid-beta (Aβ) clearance and decreases Tau hyperphosphorylation, highlighting it’s potential as a therapeutic target to treat AD.⁹^–¹¹ Further investigation is required to elucidate the mechanism in which SYK influences Tau pathology and Aβ deposition.⁸

Mechanistic studies would be greatly facilitated with the availability of high-quality antibodies. Here, we compared the performance of a range of commercially available antibodies for tyrosine-protein kinase SYK and validated several antibodies for Western Blot, immunoprecipitation and immunofluorescence, enabling biochemical and cellular assessment of tyrosine-protein kinase SYK properties and function.

Results and discussion

Our standard protocol involves comparing readouts from wild-type and knockout cells.¹²^–²² To identify a cell line that expresses adequate levels of tyrosine-protein kinase SYK protein expression to provide sufficient signal to noise, we examined public proteomics databases, namely PaxDB²³ and DepMap.²⁴ THP-1 was identified as a suitable cell line and thus THP-1 was modified with CRISPR/Cas9 to knockout the corresponding SYK gene (Table 1).

Table 1. Summary of the cell lines used.

Institution	Catalog number	RRID (Cellosaurus)	Cell line	Genotype
Abcam	ab271147	CVCL_0006	THP-1	WT
Abcam	ab288700	-	THP-1	SYK KO

For Western Blot experiments, we resolved proteins from WT and SYK KO cell extracts and probed them side-by-side with all antibodies in parallel¹³^–²² (Figure 1).

Figure 1. Tyrosine-protein kinase SYK antibody screening by Western Blot.

Lysates of THP-1 (WT and SYK KO) were prepared, and 30 μg of protein were processed for Western Blot with the indicated tyrosine-protein kinase SYK antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. An exception was given for antibody GTX633910*, which was titrated to 1/250 as the signal was too weak when following the supplier’s recommendations. Antibody dilutions used: MA1-19332* at 1/1000, 13198** at 1/1000, 80460* at 1/1000, 12358** at 1/1000, GTX633910* at 1/250, MAB7166* at 1/250, NBP1-03250* at 1/500, 66721-1-lg* at 1/2000, AFFN-SYK-5A10* at 1/200, ab3993* at 1/500, ab40781** at 1/1000, ab244701** at 1/1000, ab244968** at 1/1000. Predicted band size: 72 kDa. *Monoclonal antibody, **Recombinant antibody.

For immunoprecipitation experiments, we used the antibodies to immunopurify tyrosine-protein kinase SYK from THP-1 cell extracts. The performance of each antibody was first evaluated by detecting whether they could immunocapture tyrosine-protein kinase SYK. Antibodies that successfully captured the protein were further evaluated by immunoprecipitation¹³^–²² (Figure 2). To detect tyrosine-protein kinase SYK, Western Blots were performed with antibodies previously KO-validated under the conditions tested in Figure 1.

Figure 2. Tyrosine-protein kinase SYK antibody screening by immunoprecipitation.

THP-1 lysates were prepared, and immunoprecipitation was performed using 2.0 μg of the indicated tyrosine-protein kinase SYK antibodies pre-coupled to Dynabeads protein G or protein A. A) Ability of the antibodies to immunocapture tyrosine-protein kinase SYK was first assessed by comparing the level of protein available in the starting material to the level remaining in the unbound fractions. B) The immunoprecipitates for antibodies which would immunocapture tyrosine-protein kinase SYK in (A) are shown. For Western Blot, 80460* and ab244968** were used at 1/3000. The Ponceau stained transfers of each blot are shown. SM = 10% starting material; UB = 10% unbound fraction; IP = immunoprecipitated. *Monoclonal antibody, **Recombinant antibody.

For immunofluorescence, as described previously, antibodies were screened using a mosaic strategy.²⁵ In brief, we plated WT and SYK KO cells together in the same well and imaged both cell types in the same field of view to reduce staining, imaging and image analysis bias (Figure 3).

Figure 3. Tyrosine-protein kinase SYK antibody screening by immunofluorescence.

THP-1 WT and SYK KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated tyrosine-protein kinase SYK antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody including DAPI. Acquisition of the blue (nucleus-DAPI), green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of the merged blue and red (grayscale) channels are shown. WT and KO cells are outlined with yellow and magenta dashed line, respectively. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies GTX633910* and 66721-1-lg*, which were titrated to 1/2000 and 1/1000, respectively, as the signals were too weak when following the supplier’s recommendations. When the concentration was not indicated by the supplier, which was the case for antibodies ab3993*, ab244701**, and ab244968**, we tested antibodies at 1/1000. At this concentration, the signal from each antibody was in the range of detection of the microscope used. Antibody dilution used: MA1-19332* at 1/1000, 13198** at 1/400, 80460* at 1/400, 12358** at 1/400, GTX633910* at 1/2000, MAB7166* at 1/500, NBP1-03250* at 1/500, 66721-1-lg* at 1/1000, AFFN-SYK-5A10* at 1/60, ab3993* at 1/1000, ab40781** at 1/700, ab244701** at 1/1000, ab244968** at 1/1000. Bars = 10 μm. *Monoclonal antibody, **Recombinant antibody.

In conclusion, we have screened tyrosine-protein kinase SYK commercial antibodies by Western Blot, immunoprecipitation and immunofluorescence and identified several high-quality antibodies under our standardized experimental conditions. Under our standardized experimental conditions, several high-quality antibodies were identified, however, the authors do not engage in result analysis or offer explicit antibody recommendations. A limitation of this study is the use of universal protocols - any conclusions remain relevant within the confines of the experimental setup and cell line used in this study. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. The underlying data supporting this study is found on Zenodo, an open access repository.²⁶^,²⁷

Methods

Antibodies

All tyrosine-protein kinase SYK antibodies are listed in Table 2, together with their corresponding Research Resource Identifiers, or RRID, to ensure the antibodies are cited properly.²⁸ Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-rabbit and anti-mouse secondary antibodies are from Thermo Fisher Scientific (cat. number A21429 and A21424). The AFFN-SYK-5A10* antibody was deposited to the Developmental Studies Hybridoma Bank (DSHB) by EU Program Affinomics (DSHB Hybridoma Product AFFN-SYK-5A10).

Table 2. Summary of the Tyrosine-protein kinase SYK antibodies tested.

Company	Catalog number	Lot number	RRID (Antibody Registry)	Clonality	Clone ID	Host	Concentration (μg/μL)	Vendors recommended applications
Thermo Fisher Scientific	MA1-19332*	Wb3186395	AB_2197214	monoclonal	SYK-01	mouse	1.00	Wb, IP, IF
Cell Signaling Technology	13198**	9	AB_2687924	recombinant-mono	D3Z1E	rabbit	not provided	Wb, IP
Cell Signaling Technology	80460*	1	AB_2799953	monoclonal	4D10	mouse	not provided	Wb, IP, IF
Cell Signaling Technology	12358**	1	AB_2687923	recombinant-mono	D1l5Q	rabbit	not provided	Wb, IP
GeneTex	GTX633910*	43314	AB_2888388	monoclonal	GT351	mouse	2.83	Wb, IF
Bio-Techne	MAB7166*	CFUQ0117021	AB_10972948	monoclonal	720402	mouse	0.50	Wb
Bio-Techne	NBP1-03250*	199549	AB_1522471	monoclonal	SYK-01	mouse	0.50	Wb, IP
Proteintech	66721-1-lg*	10006710	AB_2882072	monoclonal	4C4A12	mouse	1.00	Wb, IF
Developmental Studies Hybridoma Bank	AFFN-SYK-5A10*	4/28/2016	AB_2617957	monoclonal	AFFN-SYK-5A10	mouse	0.062	other
Abcam	ab3993*	GR3203808-21	AB_304217	monoclonal	SYK-01	mouse	1.00	Wb, IF
Abcam	ab40781**	GR3273231-3	AB_778196	recombinant-mono	EP573Y	rabbit	0.71	Wb, IF
Abcam	ab244701**	GR3273514-3	AB_2910244¹	recombinant-mono	EPR19414-176	rabbit	1.01	other
Abcam	ab244968**	GR3273515-3	AB_2910245¹	recombinant-mono	EPR573-69	rabbit	0.99	other

* Monoclonal antibody.

** Recombinant antibody.

1 Refers to RRID that were recently created (July 2023) and will be added to the Antibody Registry in the coming weeks.

CRISPR/Cas9 genome editing

Cell lines used are listed in Table 1. THP-1 SYK KO clone was generated with low passage cells using an open-access protocol available on Zenodo.org: https://zenodo.org/record/3875777#.ZA-Rxi-96Rv. Two guide RNAs were used to knockout SYK in THP-1 using the CRISPR-Cas9 technology (sequence guide 1: TTTCGGCAACATCACCCGGG, sequence guide 2: GCTCCCGCTCGATGGTGTAG).

Cell culture

Both THP-1 WT and SYK KO cell lines used are listed in Table 1, together with their corresponding RRID, to ensure the cell lines are cited properly.²⁹ Cells were cultured in DMEM high-glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065, 100 IU penicillin and 100 μg/mL streptomycin (Wisent cat. number 450201).

Antibody screening by Western Blot

Western Blots were performed as described in our standard operating procedure.³⁰ Protein concentration of the lysates was measured using a BCA protein assay kit. The resulting protein concentrations was adjusted to ensure equal amounts of protein in the WT and KO lysates were loaded in each lane.

THP-1 WT and SYK KO were collected in RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) (Thermo Fisher Scientific, cat. number 89901) supplemented with protease inhibitor. Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 × g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western Blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used.

Western Blots were performed with large 5–16% gradient polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the Blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual Western Blots. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4°C with 5% bovine serum albumin (BSA) (Wisent, cat. number 800-095) in TBS with 0.1% Tween 20 (TBST) (Cell Signalling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/mL in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) prior to detection with the HyBlot CL autoradiography films (Denville, cat. number 1159T41).

Antibody screening by immunoprecipitation

Immunoprecipitation was performed as described in our standard operating procedure.³¹ Antibody-bead conjugates were prepared by adding 2 μg or 10 μL of antibody at an unknown concentration to 500 μL of Pierce IP Lysis Buffer (Thermo Fisher Scientific, cat. number 87788) in a 1.5 mL microcentrifuge tube, together with 30 μL of Dynabeads protein A - (for rabbit antibodies) or protein G - (for mouse antibodies) (Thermo Fisher Scientific, cat. number 10002D and 10004D). Tubes were rocked for ~ 2 hrs at 4°C followed by several washes to remove unbound antibodies.

THP-1 WT were collected in Pierce IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) supplemented with protease inhibitor. Lysates were rocked 30 min at 4°C and spun at 110,000 × g for 15 min at 4°C. One mL aliquots at 1.0 mg/mL of lysate were incubated with an antibody-bead conjugate for ~2 hrs at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of IP lysis buffer and processed for SDS-PAGE and Western Blot on 5–16% gradient polyacrylamide gels.

Antibody screening by immunofluorescence

Immunofluorescence was performed as described in our standard operating procedure.¹³^–²²^,²⁵ THP-1 WT and SYK KO were labelled with a green and a far-red fluorescence dye, respectively (Thermo Fisher Scientific, cat. number C2925 and C34565). The nuclei were labelled with DAPI (Thermo Fisher Scientific, cat. number D3571) fluorescent stain. WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37^oC, 5% CO₂. Cells were fixed in 4% paraformaldehyde (PFA) (Beantown chemical, cat. number 140770-10 ml) in phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL). Cells were permeabilized in PBS with 0,1% Triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary tyrosine-protein kinase SYK antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/mL for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).

Imaging was performed using a Zeiss LSM 700 laser scanning confocal microscope equipped with a Plan-Apo 20x air objective (NA = 0.8). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.1.2) to adjust contrast then assembled with Adobe Illustrator (version 27.3.1).

Data availability

Underlying data

Zenodo: Antibody Characterization Report for tyrosine-protein kinase SYK, https://doi.org/10.5281/zenodo.6566940.²⁶

Zenodo: Dataset for the tyrosine-protein kinase SYK antibody screening study, https://doi.org/10.5281/zenodo.8164709.²⁷

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0)

Acknowledgments

We would like to thank the NeuroSGC/YCharOS collaborative group for their important contribution to the creation of an open scientific ecosystem of antibody manufacturers and knockout cell line suppliers, for the development of community-agreed protocols, and for their shared ideas, resources and collaboration. Members of the group can be found below.

NeuroSGC/YCharOS collaborative group: Aled M. Edwards, Peter S. McPherson and Chetan Raina.

Thank you to the Structural Genomics Consortium, a registered charity (no. 1097737), for your support on this project. The Structural Genomics Consortium receives funding from Bayer AG, Boehringer Ingelheim, Bristol-Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda.

An earlier version of this of this article can be found on Zenodo (doi: 10.5281/zenodo.6566940).

References

1. Sada K, Takano T, Yanagi S, et al.: Structure and function of Syk protein-tyrosine kinase. J. Biochem. 2001; 130(2): 177–186. Publisher Full Text
2. Liu D, Mamorska-Dyga A: Syk inhibitors in clinical development for hematological malignancies. J. Hematol. Oncol. 2017; 10(1): 145. PubMed Abstract | Publisher Full Text | Free Full Text
3. Mócsai A, Ruland J, Tybulewicz VL: The SYK tyrosine kinase: a crucial player in diverse biological functions. Nat. Rev. Immunol. 2010; 10(6): 387–402. PubMed Abstract | Publisher Full Text | Free Full Text
4. Meltzer EO, Berkowitz RB, Grossbard EB: An intranasal Syk-kinase inhibitor (R112) improves the symptoms of seasonal allergic rhinitis in a park environment. J. Allergy Clin. Immunol. 2005; 115(4): 791–796. PubMed Abstract | Publisher Full Text
5. Weinblatt ME, Kavanaugh A, Burgos-Vargas R, et al.: Treatment of rheumatoid arthritis with a Syk kinase inhibitor: a twelve-week, randomized, placebo-controlled trial. Arthritis Rheum. 2008; 58(11): 3309–3318. PubMed Abstract | Publisher Full Text
6. Podolanczuk A, Lazarus AH, Crow AR, et al.: Of mice and men: an open-label pilot study for treatment of immune thrombocytopenic purpura by an inhibitor of Syk. Blood. 2009; 113(14): 3154–3160. PubMed Abstract | Publisher Full Text
7. Friedberg JW, Sharman J, Sweetenham J, et al.: Inhibition of Syk with fostamatinib disodium has significant clinical activity in non-Hodgkin lymphoma and chronic lymphocytic leukemia. Blood. 2010; 115(13): 2578–2585. PubMed Abstract | Publisher Full Text | Free Full Text
8. Schweig JE, Yao H, Coppola K, et al.: Spleen tyrosine kinase (SYK) blocks autophagic Tau degradation in vitro and in vivo. J. Biol. Chem. 2019; 294(36): 13378–13395. PubMed Abstract | Publisher Full Text | Free Full Text
9. Schweig JE, Yao H, Beaulieu-Abdelahad D, et al.: Alzheimer's disease pathological lesions activate the spleen tyrosine kinase. Acta Neuropathol. Commun. 2017; 5(1): 69. PubMed Abstract | Publisher Full Text | Free Full Text
10. Combs CK, Johnson DE, Cannady SB, et al.: Identification of microglial signal transduction pathways mediating a neurotoxic response to amyloidogenic fragments of beta-amyloid and prion proteins. J. Neurosci. 1999; 19(3): 928–939. PubMed Abstract | Publisher Full Text | Free Full Text
11. Paris D, Ait-Ghezala G, Bachmeier C, et al.: The spleen tyrosine kinase (Syk) regulates Alzheimer amyloid-β production and Tau hyperphosphorylation. J. Biol. Chem. 2014; 289(49): 33927–33944. PubMed Abstract | Publisher Full Text | Free Full Text
12. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8: 8. Publisher Full Text
13. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text
14. Alshalfie W, Fotouhi M, Ayoubi R, et al.: The identification of high-performing antibodies for RNA-binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence. F1000Res. 2023; 12: 376. PubMed Abstract | Publisher Full Text | Free Full Text
15. Worrall D, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for TDP-43 for use in Western Blot, immunoprecipitation and immunofluorescence. F1000Res. 2023; 12: 277. PubMed Abstract | Publisher Full Text | Free Full Text
16. McDowell I, Ayoubi R, Fotouhi M, et al.: The identification of high-preforming antibodies for Ubiquilin-2 for use in Western Blot, immunoprecipitation, and immunofluorescence. F1000Res. 2023; 12: 355. PubMed Abstract | Publisher Full Text | Free Full Text
17. Ayoubi R, Fotouhi M, Southern K, et al.: The identification of high-performing antibodies for Vacuolar protein sorting-associated protein 35 (hVPS35) for use in Western Blot, immunoprecipitation and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 452. Publisher Full Text
18. Ayoubi R, Alshafie W, Southern K, et al.: The identification of high-performing antibodies for Coiled-coil-helix-coiled-coil-helix domain containing protein 10 (CHCHD10) for use in Western Blot, immunoprecipitation and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 403. Publisher Full Text
19. Ayoubi R, Alshafie W, You Z, et al.: The identification of high-performing antibodies for Superoxide dismutase [Cu-Zn] 1 (SOD1) for use in Western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 391. Publisher Full Text
20. Ayoubi R, McDowell I, Fotouhi M, et al.: The identification of high-performing antibodies for Profilin-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 348. Publisher Full Text
21. Ayoubi R, Alshafie W, Shlaifer I, et al.: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 324. Publisher Full Text
22. Alshafie W, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for Moesin for use in Western Blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 172.
23. Wang M, Herrmann CJ, Simonovic M, et al.: Version 4.0 of PaxDb: Protein abundance data, integrated across model organisms, tissues, and cell-lines. Proteomics. 2015; 15(18): 3163–3168. PubMed Abstract | Publisher Full Text | Free Full Text
24. DepMap, Broad: DepMap 19Q3 Public ed2019.
25. Alshafie W, McPherson P, Laflamme C: Antibody screening by Immunofluorescence.2021.
26. Alshafie W, Fotouhi M, Ayoubi R, et al.: Antibody Characterization Report for tyrosine-protein kinase SYK. Zenodo. 2022. Publisher Full Text
27. Southern K: Dataset for the tyrosine-protein kinase SYK antibody screening study. [Data set]. Zenodo. 2023. Publisher Full Text
28. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text
29. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text
30. Ayoubi R, McPherson PS, Laflamme C: Antibody Screening by Immunoblot.2021.
31. Ayoubi R, Fotouhi M, McPherson P, et al.: Antibody screening by Immunoprecitation.2021.

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 27 Sep 2023

Author details Author details

¹ Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Québec, H3A 2B4, Canada

Walaa Alshafie
Roles: Investigation, Methodology, Writing – Review & Editing

Maryam Fotouhi
Roles: Investigation, Writing – Review & Editing

Riham Ayoubi
Roles: Methodology, Visualization, Writing – Review & Editing

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Carl Laflamme
Roles: Conceptualization, Funding Acquisition, Methodology, Supervision, Validation, Visualization, Writing – Review & Editing

Competing interests

For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: Abcam; Aviva Systems Biology; Bio Techne; Cell Signalling Technology; Developmental Studies Hybridoma Bank; GeneTex; Horizon Discovery; Proteintech; Synaptic Systems; Thermo Fisher Scientific.

Grant information

This work was supported by a grant from the by the Emory-Sage-SGC TREAT-AD center established by the National Institute on Aging under award number U54AG065187. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). RA and WA were supported by a Mitacs fellowship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (3)

version 3

Revised

Published: 11 Jun 2024, 12:1222

https://doi.org/10.12688/f1000research.140456.3

version 2

Revised

Published: 09 Oct 2023, 12:1222

https://doi.org/10.12688/f1000research.140456.2

version 1

Published: 27 Sep 2023, 12:1222

https://doi.org/10.12688/f1000research.140456.1

© 2024 Alshafie W et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Alshafie W, Fotouhi M, Ayoubi R et al. Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence [version 3; peer review: 2 approved]. F1000Research 2024, 12:1222 (https://doi.org/10.12688/f1000research.140456.3)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 3

VERSION 3

PUBLISHED 11 Jun 2024

Revised

Views

Reviewer Report 28 Jun 2024

Araujo Nelson A, Universidad de O'Higgins, Rancagua, O'Higgins Region, Chile

Approved

https://doi.org/10.5256/f1000research.167657.r289607

The answers to the questions ... Continue reading

CITE

Report a concern

Respond or Comment

Version 2

VERSION 2

PUBLISHED 09 Oct 2023

Revised

Views

Reviewer Report 16 Feb 2024

Araujo Nelson A, Universidad de O'Higgins, Rancagua, O'Higgins Region, Chile

Approved with Reservations

https://doi.org/10.5256/f1000research.157120.r235832

Full Report.

The data note entitled "Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation, and immunofluorescence" compares thirteen commercial antibodies against tyrosine-protein kinase SYK using three different immunodetection techniques to provide

Full Report.

The data note entitled "Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation, and immunofluorescence" compares thirteen commercial antibodies against tyrosine-protein kinase SYK using three different immunodetection techniques to provide relevant data regarding the sensitivity and specificity of these antibodies for SYK protein tyrosine kinase.
My main criticism is that the results and discussion section is little developed; for example, are not briefly described the most relevant results of any of the three experiments and are not discussed the results that were different, for example, why the GTX633910 antibody detects a polypeptide band above 75 kDa while the 72 kDa band corresponding to the Tyrosine-protein kinase SYK is very poorly detected; why is not detected with the AFFN-SYK-5A10 antibody the Tyrosine-protein kinase SYK; why in immunoprecipitation the 80460 and ab244968 antibodies were used to immunodetect the unbound fraction and not other antibodies. The authors should provide answers in the text to these questions.
In immunofluorescence results, place the white light micrograph of the cells next to the fluorescence image to observe the cell outline is recommended and can then be followed by the colored segmented lines in the fluorescence image.
Write in the protocol how the total protein concentration in the supernatant was determined and how many the volume in microliters used to obtain 30 mg of protein from WT cells as from SYK KO cells in each lane to do better reproducible the experiment.
Also the conclusion is observed underdeveloped. I recommend the authors to conclude by offering their own recommendations on bioanalytical applications of the antibodies analyzed and compare with the vendor-recommended applications read in Table 2.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Structure and function of protein kinases A

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 20 Jun 2024

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

20 Jun 2024

Author Response
Thank you Araujo Nelson A. for your comprehensive reviewer report for our article. Please see below our responses to your specific comments and concerns.
- The data note entitled
... Continue reading
Thank you Araujo Nelson A. for your comprehensive reviewer report for our article. Please see below our responses to your specific comments and concerns.

The data note entitled "Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation, and immunofluorescence" compares thirteen commercial antibodies against tyrosine-protein kinase SYK using three different immunodetection techniques to provide relevant data regarding the sensitivity and specificity of these antibodies for SYK protein tyrosine kinase.

My main criticism is that the results and discussion section is little developed; for example, are not briefly described the most relevant results of any of the three experiments and are not discussed the results that were different, for example, why the GTX633910 antibody detects a polypeptide band above 75 kDa while the 72 kDa band corresponding to the Tyrosine-protein kinase SYK is very poorly detected; why is not detected with the AFFN-SYK-5A10 antibody the Tyrosine-protein kinase SYK; why in immunoprecipitation the 80460 and ab244968 antibodies were used to immunodetect the unbound fraction and not other antibodies. The authors should provide answers in the text to these questions.

While the authors understand your concern regarding the lack of result analysis, we must re-iterate, that the authors do not engage in result analysis nor offer explicit antibody recommendations. The format of this article is a Data Note, with the goal being to provide brief descriptions of research data for potential reuse or to benefit for the scientific community without providing any analyses or conclusions, as explained in their article guidelines (https://f1000research.com/for-authors/article-guidelines/data-notes).
The GTX633910 antibody detecting bands above the 75 kDa molecular marker in both the wild-type (WT) and the knockout (KO) could indicate that this antibody is non-selective, binding to epitopes other than the intended target. The Western blot assessment of antibodies in the unbound fraction as well as the immunoprecipitation are carried out with antibodies previously KO-validated by Western blot (Figure 1), which is why antibodies 8060 and ab244968 were selected. We understand that this last point was not made clear in the text. In the newly submitted version of this article we have included a statement in the results and discussion section to clarify this part of the protocol.

In immunofluorescence results, place the white light micrograph of the cells next to the fluorescence image to observe the cell outline is recommended and can then be followed by the colored segmented lines in the fluorescence image.

With our immunofluorescence protocol described in the methods section of this article, the goal is not to define the cellular location of the target protein but rather to determine where or not ratio of signal between the WT and KO cells is significantly different. This is why we outline of the cell is not as significant compared to the signal produced by the cells themselves.

Write in the protocol how the total protein concentration in the supernatant was determined and how many the volume in microliters used to obtain 30 mg of protein from WT cells as from SYK KO cells in each lane to do better reproducible the experiment.

The protocol describing how the total protein concentration was determined as well as the method to obtain 30 mg of protein has been included in the Methods section describing Antibody screening by Western blot.

Also the conclusion is observed underdeveloped. I recommend the authors to conclude by offering their own recommendations on bioanalytical applications of the antibodies analyzed and compare with the vendor-recommended applications read in Table 2.

The authors to not offer their own recommendations nor compare the antibody performance in each application to the vendors recommended application. The reason being that the antibodies are tested under one specific set of conditions, therefore summarizing the performance of the antibodies would only be valid under these precise experimental set-up and cell lines used. The goal of the YCharOS initiative is to present antibody characterization data to the scientific community, using a standardized protocol that allows researchers to select high-performing antibodies. This enables researchers who specialize in the target of interest, in this case Tyrosine -protein kinase SYK, to conduct further studies. This intention is clearly defined in the concluding paragraph of the results and discussion section.

We hope that with our clarifications, responses to your concerns, and the statements included in the latest version of the article, you no longer have reservations about the status of this article. The presented antibody characterization data will be highly beneficial for researchers aiming to enhance their studies on tyrosine-protein kinase SYK.
Thank you Araujo Nelson A. for your comprehensive reviewer report for our article. Please see below our responses to your specific comments and concerns.

The data note entitled "Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation, and immunofluorescence" compares thirteen commercial antibodies against tyrosine-protein kinase SYK using three different immunodetection techniques to provide relevant data regarding the sensitivity and specificity of these antibodies for SYK protein tyrosine kinase.

My main criticism is that the results and discussion section is little developed; for example, are not briefly described the most relevant results of any of the three experiments and are not discussed the results that were different, for example, why the GTX633910 antibody detects a polypeptide band above 75 kDa while the 72 kDa band corresponding to the Tyrosine-protein kinase SYK is very poorly detected; why is not detected with the AFFN-SYK-5A10 antibody the Tyrosine-protein kinase SYK; why in immunoprecipitation the 80460 and ab244968 antibodies were used to immunodetect the unbound fraction and not other antibodies. The authors should provide answers in the text to these questions.

While the authors understand your concern regarding the lack of result analysis, we must re-iterate, that the authors do not engage in result analysis nor offer explicit antibody recommendations. The format of this article is a Data Note, with the goal being to provide brief descriptions of research data for potential reuse or to benefit for the scientific community without providing any analyses or conclusions, as explained in their article guidelines (https://f1000research.com/for-authors/article-guidelines/data-notes).
The GTX633910 antibody detecting bands above the 75 kDa molecular marker in both the wild-type (WT) and the knockout (KO) could indicate that this antibody is non-selective, binding to epitopes other than the intended target. The Western blot assessment of antibodies in the unbound fraction as well as the immunoprecipitation are carried out with antibodies previously KO-validated by Western blot (Figure 1), which is why antibodies 8060 and ab244968 were selected. We understand that this last point was not made clear in the text. In the newly submitted version of this article we have included a statement in the results and discussion section to clarify this part of the protocol.

In immunofluorescence results, place the white light micrograph of the cells next to the fluorescence image to observe the cell outline is recommended and can then be followed by the colored segmented lines in the fluorescence image.

With our immunofluorescence protocol described in the methods section of this article, the goal is not to define the cellular location of the target protein but rather to determine where or not ratio of signal between the WT and KO cells is significantly different. This is why we outline of the cell is not as significant compared to the signal produced by the cells themselves.

Write in the protocol how the total protein concentration in the supernatant was determined and how many the volume in microliters used to obtain 30 mg of protein from WT cells as from SYK KO cells in each lane to do better reproducible the experiment.

The protocol describing how the total protein concentration was determined as well as the method to obtain 30 mg of protein has been included in the Methods section describing Antibody screening by Western blot.

Also the conclusion is observed underdeveloped. I recommend the authors to conclude by offering their own recommendations on bioanalytical applications of the antibodies analyzed and compare with the vendor-recommended applications read in Table 2.

The authors to not offer their own recommendations nor compare the antibody performance in each application to the vendors recommended application. The reason being that the antibodies are tested under one specific set of conditions, therefore summarizing the performance of the antibodies would only be valid under these precise experimental set-up and cell lines used. The goal of the YCharOS initiative is to present antibody characterization data to the scientific community, using a standardized protocol that allows researchers to select high-performing antibodies. This enables researchers who specialize in the target of interest, in this case Tyrosine -protein kinase SYK, to conduct further studies. This intention is clearly defined in the concluding paragraph of the results and discussion section.

We hope that with our clarifications, responses to your concerns, and the statements included in the latest version of the article, you no longer have reservations about the status of this article. The presented antibody characterization data will be highly beneficial for researchers aiming to enhance their studies on tyrosine-protein kinase SYK.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 20 Jun 2024

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

20 Jun 2024

Author Response
Thank you Araujo Nelson A. for your comprehensive reviewer report for our article. Please see below our responses to your specific comments and concerns.
- The data note entitled
... Continue reading
Thank you Araujo Nelson A. for your comprehensive reviewer report for our article. Please see below our responses to your specific comments and concerns.

The data note entitled "Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation, and immunofluorescence" compares thirteen commercial antibodies against tyrosine-protein kinase SYK using three different immunodetection techniques to provide relevant data regarding the sensitivity and specificity of these antibodies for SYK protein tyrosine kinase.

My main criticism is that the results and discussion section is little developed; for example, are not briefly described the most relevant results of any of the three experiments and are not discussed the results that were different, for example, why the GTX633910 antibody detects a polypeptide band above 75 kDa while the 72 kDa band corresponding to the Tyrosine-protein kinase SYK is very poorly detected; why is not detected with the AFFN-SYK-5A10 antibody the Tyrosine-protein kinase SYK; why in immunoprecipitation the 80460 and ab244968 antibodies were used to immunodetect the unbound fraction and not other antibodies. The authors should provide answers in the text to these questions.

While the authors understand your concern regarding the lack of result analysis, we must re-iterate, that the authors do not engage in result analysis nor offer explicit antibody recommendations. The format of this article is a Data Note, with the goal being to provide brief descriptions of research data for potential reuse or to benefit for the scientific community without providing any analyses or conclusions, as explained in their article guidelines (https://f1000research.com/for-authors/article-guidelines/data-notes).
The GTX633910 antibody detecting bands above the 75 kDa molecular marker in both the wild-type (WT) and the knockout (KO) could indicate that this antibody is non-selective, binding to epitopes other than the intended target. The Western blot assessment of antibodies in the unbound fraction as well as the immunoprecipitation are carried out with antibodies previously KO-validated by Western blot (Figure 1), which is why antibodies 8060 and ab244968 were selected. We understand that this last point was not made clear in the text. In the newly submitted version of this article we have included a statement in the results and discussion section to clarify this part of the protocol.

In immunofluorescence results, place the white light micrograph of the cells next to the fluorescence image to observe the cell outline is recommended and can then be followed by the colored segmented lines in the fluorescence image.

With our immunofluorescence protocol described in the methods section of this article, the goal is not to define the cellular location of the target protein but rather to determine where or not ratio of signal between the WT and KO cells is significantly different. This is why we outline of the cell is not as significant compared to the signal produced by the cells themselves.

Write in the protocol how the total protein concentration in the supernatant was determined and how many the volume in microliters used to obtain 30 mg of protein from WT cells as from SYK KO cells in each lane to do better reproducible the experiment.

The protocol describing how the total protein concentration was determined as well as the method to obtain 30 mg of protein has been included in the Methods section describing Antibody screening by Western blot.

Also the conclusion is observed underdeveloped. I recommend the authors to conclude by offering their own recommendations on bioanalytical applications of the antibodies analyzed and compare with the vendor-recommended applications read in Table 2.

The authors to not offer their own recommendations nor compare the antibody performance in each application to the vendors recommended application. The reason being that the antibodies are tested under one specific set of conditions, therefore summarizing the performance of the antibodies would only be valid under these precise experimental set-up and cell lines used. The goal of the YCharOS initiative is to present antibody characterization data to the scientific community, using a standardized protocol that allows researchers to select high-performing antibodies. This enables researchers who specialize in the target of interest, in this case Tyrosine -protein kinase SYK, to conduct further studies. This intention is clearly defined in the concluding paragraph of the results and discussion section.

We hope that with our clarifications, responses to your concerns, and the statements included in the latest version of the article, you no longer have reservations about the status of this article. The presented antibody characterization data will be highly beneficial for researchers aiming to enhance their studies on tyrosine-protein kinase SYK.
Thank you Araujo Nelson A. for your comprehensive reviewer report for our article. Please see below our responses to your specific comments and concerns.

The data note entitled "Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation, and immunofluorescence" compares thirteen commercial antibodies against tyrosine-protein kinase SYK using three different immunodetection techniques to provide relevant data regarding the sensitivity and specificity of these antibodies for SYK protein tyrosine kinase.

My main criticism is that the results and discussion section is little developed; for example, are not briefly described the most relevant results of any of the three experiments and are not discussed the results that were different, for example, why the GTX633910 antibody detects a polypeptide band above 75 kDa while the 72 kDa band corresponding to the Tyrosine-protein kinase SYK is very poorly detected; why is not detected with the AFFN-SYK-5A10 antibody the Tyrosine-protein kinase SYK; why in immunoprecipitation the 80460 and ab244968 antibodies were used to immunodetect the unbound fraction and not other antibodies. The authors should provide answers in the text to these questions.

While the authors understand your concern regarding the lack of result analysis, we must re-iterate, that the authors do not engage in result analysis nor offer explicit antibody recommendations. The format of this article is a Data Note, with the goal being to provide brief descriptions of research data for potential reuse or to benefit for the scientific community without providing any analyses or conclusions, as explained in their article guidelines (https://f1000research.com/for-authors/article-guidelines/data-notes).
The GTX633910 antibody detecting bands above the 75 kDa molecular marker in both the wild-type (WT) and the knockout (KO) could indicate that this antibody is non-selective, binding to epitopes other than the intended target. The Western blot assessment of antibodies in the unbound fraction as well as the immunoprecipitation are carried out with antibodies previously KO-validated by Western blot (Figure 1), which is why antibodies 8060 and ab244968 were selected. We understand that this last point was not made clear in the text. In the newly submitted version of this article we have included a statement in the results and discussion section to clarify this part of the protocol.

In immunofluorescence results, place the white light micrograph of the cells next to the fluorescence image to observe the cell outline is recommended and can then be followed by the colored segmented lines in the fluorescence image.

With our immunofluorescence protocol described in the methods section of this article, the goal is not to define the cellular location of the target protein but rather to determine where or not ratio of signal between the WT and KO cells is significantly different. This is why we outline of the cell is not as significant compared to the signal produced by the cells themselves.

Write in the protocol how the total protein concentration in the supernatant was determined and how many the volume in microliters used to obtain 30 mg of protein from WT cells as from SYK KO cells in each lane to do better reproducible the experiment.

The protocol describing how the total protein concentration was determined as well as the method to obtain 30 mg of protein has been included in the Methods section describing Antibody screening by Western blot.

Also the conclusion is observed underdeveloped. I recommend the authors to conclude by offering their own recommendations on bioanalytical applications of the antibodies analyzed and compare with the vendor-recommended applications read in Table 2.

The authors to not offer their own recommendations nor compare the antibody performance in each application to the vendors recommended application. The reason being that the antibodies are tested under one specific set of conditions, therefore summarizing the performance of the antibodies would only be valid under these precise experimental set-up and cell lines used. The goal of the YCharOS initiative is to present antibody characterization data to the scientific community, using a standardized protocol that allows researchers to select high-performing antibodies. This enables researchers who specialize in the target of interest, in this case Tyrosine -protein kinase SYK, to conduct further studies. This intention is clearly defined in the concluding paragraph of the results and discussion section.

We hope that with our clarifications, responses to your concerns, and the statements included in the latest version of the article, you no longer have reservations about the status of this article. The presented antibody characterization data will be highly beneficial for researchers aiming to enhance their studies on tyrosine-protein kinase SYK.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Views

Reviewer Report 03 Jan 2024

Kiyonao Sada, University of Fukui, Fukui, Japan

Approved

https://doi.org/10.5256/f1000research.157120.r228375

The importance of the protein-tyrosine kinase Syk has been highlighted in new research areas for studying the pathogenesis and developing treatments of neurological diseases. In this study, the authors compare the usefulness of anti-Syk antibody-based approaches using wild-type and Syk-deficient THP-1 cells, established by genome editing.

It is very important to know which antibodies commercially available are useful for a particular protein, not just Syk. This paper does not indicate which antibodies are recommended, but allows experts reading this paper to make their own interpretations. The experimental conditions are based on the recommended dilution factors, and in practice, further investigation by the researcher is required. However, it is not practical for many researchers to purchase and compare all antibodies, so the Syk results provide very important information.

Western blot results were relatively uniform, but differences in the usefulness of each antibody were observed in immunoprecipitation and immunofluorescence. In particular, the reader is provided with the information that some antibodies could detect Syk effectively despite the lack of company recommendations for immunofluorescence.

Regarding Table 2, in discussing the experimental results, it is also necessary to present information about the antigens of these antibodies. This is because it is assumed that when immunoprecipitation is performed, the antibodies mask the antigenic sites, making it difficult to detect proteins that associate with the same sites.

Overall, I can conclude that this is a very useful paper for researchers who are pioneering new studies on Syk.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Signal transduction

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 27 Sep 2023

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 3 (revision) 11 Jun 24		read
Version 2 (revision) 09 Oct 23	read	read
Version 1 27 Sep 23

Kiyonao Sada, University of Fukui, Fukui, Japan
Araujo Nelson A, Universidad de O'Higgins, Rancagua, Chile

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

6 Views

28 Jun 2024 | for Version 3

Araujo Nelson A, Universidad de O'Higgins, Rancagua, O'Higgins Region, Chile

6 Views Cite this report Responses(0)

Approved

The answers to the questions presented by the authors were satisfactory.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Chemistry of Proteins and Peptides

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

17 Views

16 Feb 2024 | for Version 2

Araujo Nelson A, Universidad de O'Higgins, Rancagua, O'Higgins Region, Chile

17 Views Cite this report Responses(1)

Approved With Reservations

Full Report.

The data note entitled "Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation, and immunofluorescence" compares thirteen commercial antibodies against tyrosine-protein kinase SYK using three different immunodetection techniques to provide relevant data regarding the sensitivity and specificity of these antibodies for SYK protein tyrosine kinase.
My main criticism is that the results and discussion section is little developed; for example, are not briefly described the most relevant results of any of the three experiments and are not discussed the results that were different, for example, why the GTX633910 antibody detects a polypeptide band above 75 kDa while the 72 kDa band corresponding to the Tyrosine-protein kinase SYK is very poorly detected; why is not detected with the AFFN-SYK-5A10 antibody the Tyrosine-protein kinase SYK; why in immunoprecipitation the 80460 and ab244968 antibodies were used to immunodetect the unbound fraction and not other antibodies. The authors should provide answers in the text to these questions.
In immunofluorescence results, place the white light micrograph of the cells next to the fluorescence image to observe the cell outline is recommended and can then be followed by the colored segmented lines in the fluorescence image.
Write in the protocol how the total protein concentration in the supernatant was determined and how many the volume in microliters used to obtain 30 mg of protein from WT cells as from SYK KO cells in each lane to do better reproducible the experiment.
Also the conclusion is observed underdeveloped. I recommend the authors to conclude by offering their own recommendations on bioanalytical applications of the antibodies analyzed and compare with the vendor-recommended applications read in Table 2.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Structure and function of protein kinases A

Respond to this report

Responses (1)

Author Response

20 Jun 2024

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

Thank you Araujo Nelson A. for your comprehensive reviewer report for our article. Please see below our responses to your specific comments and concerns.

The data note entitled "Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation, and immunofluorescence" compares thirteen commercial antibodies against tyrosine-protein kinase SYK using three different immunodetection techniques to provide relevant data regarding the sensitivity and specificity of these antibodies for SYK protein tyrosine kinase.
My main criticism is that the results and discussion section is little developed; for example, are not briefly described the most relevant results of any of the three experiments and are not discussed the results that were different, for example, why the GTX633910 antibody detects a polypeptide band above 75 kDa while the 72 kDa band corresponding to the Tyrosine-protein kinase SYK is very poorly detected; why is not detected with the AFFN-SYK-5A10 antibody the Tyrosine-protein kinase SYK; why in immunoprecipitation the 80460 and ab244968 antibodies were used to immunodetect the unbound fraction and not other antibodies. The authors should provide answers in the text to these questions.

While the authors understand your concern regarding the lack of result analysis, we must re-iterate, that the authors do not engage in result analysis nor offer explicit antibody recommendations. The format of this article is a Data Note, with the goal being to provide brief descriptions of research data for potential reuse or to benefit for the scientific community without providing any analyses or conclusions, as explained in their article guidelines (https://f1000research.com/for-authors/article-guidelines/data-notes).
The GTX633910 antibody detecting bands above the 75 kDa molecular marker in both the wild-type (WT) and the knockout (KO) could indicate that this antibody is non-selective, binding to epitopes other than the intended target. The Western blot assessment of antibodies in the unbound fraction as well as the immunoprecipitation are carried out with antibodies previously KO-validated by Western blot (Figure 1), which is why antibodies 8060 and ab244968 were selected. We understand that this last point was not made clear in the text. In the newly submitted version of this article we have included a statement in the results and discussion section to clarify this part of the protocol.

In immunofluorescence results, place the white light micrograph of the cells next to the fluorescence image to observe the cell outline is recommended and can then be followed by the colored segmented lines in the fluorescence image.

With our immunofluorescence protocol described in the methods section of this article, the goal is not to define the cellular location of the target protein but rather to determine where or not ratio of signal between the WT and KO cells is significantly different. This is why we outline of the cell is not as significant compared to the signal produced by the cells themselves.

Write in the protocol how the total protein concentration in the supernatant was determined and how many the volume in microliters used to obtain 30 mg of protein from WT cells as from SYK KO cells in each lane to do better reproducible the experiment.

The protocol describing how the total protein concentration was determined as well as the method to obtain 30 mg of protein has been included in the Methods section describing Antibody screening by Western blot.

Also the conclusion is observed underdeveloped. I recommend the authors to conclude by offering their own recommendations on bioanalytical applications of the antibodies analyzed and compare with the vendor-recommended applications read in Table 2.

The authors to not offer their own recommendations nor compare the antibody performance in each application to the vendors recommended application. The reason being that the antibodies are tested under one specific set of conditions, therefore summarizing the performance of the antibodies would only be valid under these precise experimental set-up and cell lines used. The goal of the YCharOS initiative is to present antibody characterization data to the scientific community, using a standardized protocol that allows researchers to select high-performing antibodies. This enables researchers who specialize in the target of interest, in this case Tyrosine -protein kinase SYK, to conduct further studies. This intention is clearly defined in the concluding paragraph of the results and discussion section.

We hope that with our clarifications, responses to your concerns, and the statements included in the latest version of the article, you no longer have reservations about the status of this article. The presented antibody characterization data will be highly beneficial for researchers aiming to enhance their studies on tyrosine-protein kinase SYK.

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

14 Views

03 Jan 2024 | for Version 2

Kiyonao Sada, University of Fukui, Fukui, Japan

14 Views Cite this report Responses(0)

Approved

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Signal transduction

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Sada K, Takano T, Yanagi S, et al.: Structure and function of Syk protein-tyrosine kinase. J. Biochem. 2001; 130(2): 177–186. Publisher Full Text

[2] 2. Liu D, Mamorska-Dyga A: Syk inhibitors in clinical development for hematological malignancies. J. Hematol. Oncol. 2017; 10(1): 145. PubMed Abstract | Publisher Full Text | Free Full Text

[3] 3. Mócsai A, Ruland J, Tybulewicz VL: The SYK tyrosine kinase: a crucial player in diverse biological functions. Nat. Rev. Immunol. 2010; 10(6): 387–402. PubMed Abstract | Publisher Full Text | Free Full Text

[4] 4. Meltzer EO, Berkowitz RB, Grossbard EB: An intranasal Syk-kinase inhibitor (R112) improves the symptoms of seasonal allergic rhinitis in a park environment. J. Allergy Clin. Immunol. 2005; 115(4): 791–796. PubMed Abstract | Publisher Full Text

[5] 5. Weinblatt ME, Kavanaugh A, Burgos-Vargas R, et al.: Treatment of rheumatoid arthritis with a Syk kinase inhibitor: a twelve-week, randomized, placebo-controlled trial. Arthritis Rheum. 2008; 58(11): 3309–3318. PubMed Abstract | Publisher Full Text

[6] 6. Podolanczuk A, Lazarus AH, Crow AR, et al.: Of mice and men: an open-label pilot study for treatment of immune thrombocytopenic purpura by an inhibitor of Syk. Blood. 2009; 113(14): 3154–3160. PubMed Abstract | Publisher Full Text

[7] 7. Friedberg JW, Sharman J, Sweetenham J, et al.: Inhibition of Syk with fostamatinib disodium has significant clinical activity in non-Hodgkin lymphoma and chronic lymphocytic leukemia. Blood. 2010; 115(13): 2578–2585. PubMed Abstract | Publisher Full Text | Free Full Text

[8] 8. Schweig JE, Yao H, Coppola K, et al.: Spleen tyrosine kinase (SYK) blocks autophagic Tau degradation in vitro and in vivo. J. Biol. Chem. 2019; 294(36): 13378–13395. PubMed Abstract | Publisher Full Text | Free Full Text

[9] 9. Schweig JE, Yao H, Beaulieu-Abdelahad D, et al.: Alzheimer's disease pathological lesions activate the spleen tyrosine kinase. Acta Neuropathol. Commun. 2017; 5(1): 69. PubMed Abstract | Publisher Full Text | Free Full Text

[10] 10. Combs CK, Johnson DE, Cannady SB, et al.: Identification of microglial signal transduction pathways mediating a neurotoxic response to amyloidogenic fragments of beta-amyloid and prion proteins. J. Neurosci. 1999; 19(3): 928–939. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. Paris D, Ait-Ghezala G, Bachmeier C, et al.: The spleen tyrosine kinase (Syk) regulates Alzheimer amyloid-β production and Tau hyperphosphorylation. J. Biol. Chem. 2014; 289(49): 33927–33944. PubMed Abstract | Publisher Full Text | Free Full Text

[12] 12. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8: 8. Publisher Full Text

[13] 13. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text

[14] 14. Alshalfie W, Fotouhi M, Ayoubi R, et al.: The identification of high-performing antibodies for RNA-binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence. F1000Res. 2023; 12: 376. PubMed Abstract | Publisher Full Text | Free Full Text

[15] 15. Worrall D, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for TDP-43 for use in Western Blot, immunoprecipitation and immunofluorescence. F1000Res. 2023; 12: 277. PubMed Abstract | Publisher Full Text | Free Full Text

[16] 16. McDowell I, Ayoubi R, Fotouhi M, et al.: The identification of high-preforming antibodies for Ubiquilin-2 for use in Western Blot, immunoprecipitation, and immunofluorescence. F1000Res. 2023; 12: 355. PubMed Abstract | Publisher Full Text | Free Full Text

[17] 17. Ayoubi R, Fotouhi M, Southern K, et al.: The identification of high-performing antibodies for Vacuolar protein sorting-associated protein 35 (hVPS35) for use in Western Blot, immunoprecipitation and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 452. Publisher Full Text

[18] 18. Ayoubi R, Alshafie W, Southern K, et al.: The identification of high-performing antibodies for Coiled-coil-helix-coiled-coil-helix domain containing protein 10 (CHCHD10) for use in Western Blot, immunoprecipitation and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 403. Publisher Full Text

[19] 19. Ayoubi R, Alshafie W, You Z, et al.: The identification of high-performing antibodies for Superoxide dismutase [Cu-Zn] 1 (SOD1) for use in Western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 391. Publisher Full Text

[20] 20. Ayoubi R, McDowell I, Fotouhi M, et al.: The identification of high-performing antibodies for Profilin-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 348. Publisher Full Text

[21] 21. Ayoubi R, Alshafie W, Shlaifer I, et al.: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 324. Publisher Full Text

[22] 22. Alshafie W, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for Moesin for use in Western Blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 172.

[23] 23. Wang M, Herrmann CJ, Simonovic M, et al.: Version 4.0 of PaxDb: Protein abundance data, integrated across model organisms, tissues, and cell-lines. Proteomics. 2015; 15(18): 3163–3168. PubMed Abstract | Publisher Full Text | Free Full Text

[24] 24. DepMap, Broad: DepMap 19Q3 Public ed2019.

[25] 25. Alshafie W, McPherson P, Laflamme C: Antibody screening by Immunofluorescence.2021.

[26] 26. Alshafie W, Fotouhi M, Ayoubi R, et al.: Antibody Characterization Report for tyrosine-protein kinase SYK. Zenodo. 2022. Publisher Full Text

[27] 27. Southern K: Dataset for the tyrosine-protein kinase SYK antibody screening study. [Data set]. Zenodo. 2023. Publisher Full Text

[28] 28. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text

[29] 29. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text

[30] 30. Ayoubi R, McPherson PS, Laflamme C: Antibody Screening by Immunoblot.2021.

[31] 31. Ayoubi R, Fotouhi M, McPherson P, et al.: Antibody screening by Immunoprecitation.2021.

Identification of high-performing antibodies for tyrosine-protein kinase SYK for use in Western Blot, immunoprecipitation and immunofluorescence

Abstract

Keywords

Revised Amendments from Version 2

Introduction

Results and discussion

Table 1. Summary of the cell lines used.

Figure 1. Tyrosine-protein kinase SYK antibody screening by Western Blot.

Figure 2. Tyrosine-protein kinase SYK antibody screening by immunoprecipitation.

Figure 3. Tyrosine-protein kinase SYK antibody screening by immunofluorescence.

Methods

Antibodies

Table 2. Summary of the Tyrosine-protein kinase SYK antibodies tested.

CRISPR/Cas9 genome editing

Cell culture

Antibody screening by Western Blot

Antibody screening by immunoprecipitation

Antibody screening by immunofluorescence

Data availability

Underlying data

Acknowledgments

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated