The complete mitochondrial genome of the hybrid snow crab Chionoecetes opilio (♀) × C. japonicus (♂) (Crustacea: Decapoda: Majoidea) and its phylogenetic analysis

Ethical approval

The sample used for this study was a snow crab and as per the animal experimental ethics of the Republic of Korea (Standard operating guideline; IACUC - Institutional Animal Care and Use Committee, Book no. 11-1543061-000457-01, effective from December 2020) we did not need any approval from an ethics committee. Also, because the sample is a snow crab, there was no need to obtain permission to collect the sample.

A hybrid between a C. opilio female and C. japonicus male was collected offshore of Ganggu (36°28′52.08″N, 129°59′09.36″E, the East Sea, Republic of Korea) on 1 June 2020, and deposited in the specimen storage facility of Soonchunhyang University (Voucher no. SUC26327; the person in charge of the collection is I.-C. Bang: incbang@gmail.com). Genomic DNA (gDNA) was extracted from walking leg muscle using a HiGene™ Genomic DNA Prep Kit (BIOFACT, Daejeon, Republic of Korea; Cat. No. GD264-060) according to the manufacturer's protocol.

In order to clearly identify a hybrid snow crab, forward and reverse primers [crabITSw_F (5′- TCGAGCTGACGGAAAGATGT -3′) and crabITSw_R (5′- GCAAGTCTCCCTCTCGTCTT -3′)] were newly designed to amplify the nuclear ITS gene in this study (Yun 2023). A PCR run was conducted with a 20 μL reaction volume using the AccuPower PCR Premix Kit (Bioneer, Daejeon, Republic of Korea; Cat. No. K-2016) containing 0.2 μM of the forward and reverse primers and 1 μL of gDNA (100 ng μL^-1). PCR cycling conditions were 94°C/5 min, [94°C/30 s, 60°C/30 s, 72°C/30 s × 35 cycles], 72°C/7 min. PCR product was purified using the AccuPrep PCR Purification Kit (Bioneer, Daejeon, Republic of Korea; Cat. No. K-3038) and directly sequenced on the Applied Biosystems 3730XL DNA Analyzer (Thermo Fisher Scientific Inc., Waltham, USA).

A genomic library for next-generation sequencing (NGS) was constructed from the extracted gDNA using an MGIeasy DNA Library Prep Kit (MGI Tech, Shenzhen, China; Cat. No. 1000006985). After producing NGS raw data using an MGISEQ-2000 (MGI Tech, Shenzhen, China), the entire mitochondrial DNA sequence of the 16,065 bp circular molecule was assembled using Geneious R11 (RRID:SCR_010519) (Kearse et al. 2012), and the final assembled sequence was further annotated using MITOS web server (Bernt et al. 2013), a web-based automatic annotation server.

For the phylogenetic analysis, 13 protein-coding genes (PCGs) for species in the superfamily Majoidea were obtained from NCBI, and their sequences were aligned with Clustal W2 (RRID:SCR_002909) (Thompson et al. 1994). The aligned sequences were used to reconstruct a maximum-likelihood (ML) tree consisting of 1000 bootstrap replications using raxmlGUI 2.0.9 (RRID:SCR_006086) (Edler et al. 2021) and a Bayesian inference (BI) tree running for 1,000,000 generations using MrBayes 3.2.7 (RRID:SCR_012067) (Ronquist et al. 2012). The substitution model was selected according to the corrected Akaike information criterion (AICc) using jModelTest 2.1.10 (RRID:SCR_015244) (Darriba et al. 2012), and the best model (GTR+I+G) was applied for ML and BI tree reconstructions. Scylla paramamosain in the superfamily Portunoidea was used as the outgroup (Figure 2).

Figure 2. The phylogenetic tree of the superfamily Majoidea.

Bootstrap values (left) > 60% in the maximum likelihood (ML) tree and posterior probabilities (right) > 0.60 for the Bayesian inference (BI) tree are indicated at each node. GenBank accession numbers for each species are given, along with the scientific name.