Keywords
Chionoecetes opilio, Chionoecetes japonicus, Chionoecetes, hybrid, mitogenome
This article is included in the Genomics and Genetics gateway.
Chionoecetes opilio, Chionoecetes japonicus, Chionoecetes, hybrid, mitogenome
The snow crab, Chionoecetes opilio Fabricius, 1788 and red snow crab, C. japonicus Rathbun, 1932 are important fishery resources in the Republic of Korea. As their commercial value increases, resource management is very important. Therefore, it is essential to obtain molecular genetic data to support their resource management (Waples et al. 2008).
Hybridization is an interesting phenomenon that plays an important evolutionary role in speciation (Barton 2001). Natural hybridization between female C. japonicus and male C. opilio has been reported (Kim et al. 2012; Yamamoto et al. 2018), but the reciprocal cross has not yet been reported. We identified a hybrid between a female C. opilio and male C. japonicus based on the maternally inherited mitochondrial genome and internal transcribed spacer (ITS) gene of the nuclear DNA (Yun 2023), where recombination between parental species occurs (Figure 1). Characterizing the mitochondrial genome of this hybrid snow crab will aid evolutionary and phylogenetic studies of the genus Chionoecetes.
The sample used for this study was a snow crab and as per the animal experimental ethics of the Republic of Korea (Standard operating guideline; IACUC - Institutional Animal Care and Use Committee, Book no. 11-1543061-000457-01, effective from December 2020) we did not need any approval from an ethics committee. Also, because the sample is a snow crab, there was no need to obtain permission to collect the sample.
A hybrid between a C. opilio female and C. japonicus male was collected offshore of Ganggu (36°28′52.08″N, 129°59′09.36″E, the East Sea, Republic of Korea) on 1 June 2020, and deposited in the specimen storage facility of Soonchunhyang University (Voucher no. SUC26327; the person in charge of the collection is I.-C. Bang: [email protected]). Genomic DNA (gDNA) was extracted from walking leg muscle using a HiGene™ Genomic DNA Prep Kit (BIOFACT, Daejeon, Republic of Korea; Cat. No. GD264-060) according to the manufacturer's protocol.
In order to clearly identify a hybrid snow crab, forward and reverse primers [crabITSw_F (5′- TCGAGCTGACGGAAAGATGT -3′) and crabITSw_R (5′- GCAAGTCTCCCTCTCGTCTT -3′)] were newly designed to amplify the nuclear ITS gene in this study (Yun 2023). A PCR run was conducted with a 20 μL reaction volume using the AccuPower PCR Premix Kit (Bioneer, Daejeon, Republic of Korea; Cat. No. K-2016) containing 0.2 μM of the forward and reverse primers and 1 μL of gDNA (100 ng μL-1). PCR cycling conditions were 94°C/5 min, [94°C/30 s, 60°C/30 s, 72°C/30 s × 35 cycles], 72°C/7 min. PCR product was purified using the AccuPrep PCR Purification Kit (Bioneer, Daejeon, Republic of Korea; Cat. No. K-3038) and directly sequenced on the Applied Biosystems 3730XL DNA Analyzer (Thermo Fisher Scientific Inc., Waltham, USA).
A genomic library for next-generation sequencing (NGS) was constructed from the extracted gDNA using an MGIeasy DNA Library Prep Kit (MGI Tech, Shenzhen, China; Cat. No. 1000006985). After producing NGS raw data using an MGISEQ-2000 (MGI Tech, Shenzhen, China), the entire mitochondrial DNA sequence of the 16,065 bp circular molecule was assembled using Geneious R11 (RRID:SCR_010519) (Kearse et al. 2012), and the final assembled sequence was further annotated using MITOS web server (Bernt et al. 2013), a web-based automatic annotation server.
For the phylogenetic analysis, 13 protein-coding genes (PCGs) for species in the superfamily Majoidea were obtained from NCBI, and their sequences were aligned with Clustal W2 (RRID:SCR_002909) (Thompson et al. 1994). The aligned sequences were used to reconstruct a maximum-likelihood (ML) tree consisting of 1000 bootstrap replications using raxmlGUI 2.0.9 (RRID:SCR_006086) (Edler et al. 2021) and a Bayesian inference (BI) tree running for 1,000,000 generations using MrBayes 3.2.7 (RRID:SCR_012067) (Ronquist et al. 2012). The substitution model was selected according to the corrected Akaike information criterion (AICc) using jModelTest 2.1.10 (RRID:SCR_015244) (Darriba et al. 2012), and the best model (GTR+I+G) was applied for ML and BI tree reconstructions. Scylla paramamosain in the superfamily Portunoidea was used as the outgroup (Figure 2).

Bootstrap values (left) > 60% in the maximum likelihood (ML) tree and posterior probabilities (right) > 0.60 for the Bayesian inference (BI) tree are indicated at each node. GenBank accession numbers for each species are given, along with the scientific name.
The complete mitochondrial genome of the hybrid between a female C. opilio and male C. japonicus (GenBank acc. no. OP787103) was circular, 16,065 bp in length, and contained 13 PCGs, 22 transfer RNA (tRNA) genes, two ribosomal RNA (rRNA) genes, and a control region. Of the 13 PCGs, nine (atp6, atp8, co1, co2, co3, cytb, nd2, nd3, and nd6) were encoded on the H-strand while four (nd1, nd4, nd4L, and nd5) were encoded on the L-strand. All PCGs had ATN start codons (ATG, n = 8; ATT, n = 3; ATA and ATC, both n = 1). There were five incomplete stop codons (co1, co2, co3, cytb, and nd2) and eight complete stop codons (TAA or TAG). The 16S and 12S rRNA genes were 1,312 and 815 bp long, respectively. The 22 tRNA genes ranged in length from 61 bp (tRNA-Arg) to 73 bp (tRNA-Val, Gln). The overall base composition was 34.61% A, 17.40% C, 10.99% G, and 37.00% T, indicating a strong AT bias, as in other Crustacea (Kim et al. 2020; An et al. 2021). In addition, the size, composition, and gene arrangement of the complete mitochondrial genome were very similar to that reported for the maternal species, C. opilio (Jeong et al. 2020).
In the phylogenetic tree, the hybrid snow crab between a C. opilio female and C. japonicus male was more closely related to the maternal species, C. opilio. In addition, C. opilio and C. japonicus form a sister clade, supporting previous studies (Azuma et al. 2011; Kim et al. 2020). This study provides important basic genetic data for resource management of C. opilio and C. japonicus, and will aid evolutionary and phylogenetic studies of both species.
Mendeley Data: Underlying data for ‘The complete mitochondrial genome of the hybrid snow crab Chionoecetes opilio (♀) × C. japonicus (♂) (Crustacea: Decapoda: Majoidea) and its phylogenetic analysis’. http://dx.doi.org/10.17632/cp5x8fbpsw.3 (Yun 2023).
This project contains the following underlying data:
• Data file 1: Chionoecetes opilio × C. japonicus mitogenome.fasta (Sequence information)
• Data file 2: Chromatogram files and sequence files.zip (Sanger sequencing data)
• Data file 3: PCR gel photograph.jpg (ITS gene, about 1,485 bp)
• Data file 4: PCR and sequencing method.doc (Information relating to primers, reagents and kits, cycling conditions, and sequencing)
Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0)
NCBI Gene: Chionoecetes opilio × Chionoecetes japonicus mitochondrial DNA, complete genome. Accession number OP787103; https://www.ncbi.nlm.nih.gov/nuccore/OP787103
BioProject: Chionoecetes opilio × Chionoecetes japonicus. Accession number PRJNA867912; https://identifiers.org/NCBI/bioproject:PRJNA867912
SRA: Chionoecetes opilio × Chionoecetes japonicus. Accession number SRR20997454; https://identifiers.org/insdc.sra:SRR20997454
BioSample: Invertebrate sample from Chionoecetes opilio × Chionoecetes japonicus. Accession number SAMN30221420; https://identifiers.org/biosample:SAMN30221420
NCBI Gene: Chionoecetes opilio mitochondrion, complete genome. Accession number MT335860; https://www.ncbi.nlm.nih.gov/nuccore/MT335860
NCBI Gene: Chionoecetes japonicus mitochondrion, complete genome. Accession number MT750295; https://www.ncbi.nlm.nih.gov/nuccore/MT750295
NCBI Gene: Chionoecetes japonicus pacificus mitochondrial DNA, complete genome. Accession number AB735678; https://www.ncbi.nlm.nih.gov/nuccore/AB735678
NCBI Gene: Maja squinado mitochondrion, complete genome. Accession number KY650652; https://www.ncbi.nlm.nih.gov/nuccore/KY650652
NCBI Gene: Maja crispata mitochondrion, complete genome. Accession number KY650651; https://www.ncbi.nlm.nih.gov/nuccore/KY650651
NCBI Gene: Damithrax spinosissimus mitochondrion, complete genome. Accession number KM405516.1; https://www.ncbi.nlm.nih.gov/nuccore/KM405516
NCBI Gene: Scyra compressipes mitochondrion, complete genome. Accession number MW451225; https://www.ncbi.nlm.nih.gov/nuccore/MW451225
NCBI Gene: Scylla paramamosain mitochondrion, complete genome. Accession number MG197997; https://www.ncbi.nlm.nih.gov/nuccore/MG197997
| Views | Downloads | |
|---|---|---|
| F1000Research | - | - |
|
PubMed Central
Data from PMC are received and updated monthly.
|
- | - |
Are the rationale for sequencing the genome and the species significance clearly described?
Partly
Are the protocols appropriate and is the work technically sound?
Partly
Are sufficient details of the sequencing and extraction, software used, and materials provided to allow replication by others?
Partly
Are the datasets clearly presented in a usable and accessible format, and the assembly and annotation available in an appropriate subject-specific repository?
Yes
Competing Interests: No competing interests were disclosed.
Reviewer Expertise: Crustacean mitogenomics
Are the rationale for sequencing the genome and the species significance clearly described?
Yes
Are the protocols appropriate and is the work technically sound?
Yes
Are sufficient details of the sequencing and extraction, software used, and materials provided to allow replication by others?
Yes
Are the datasets clearly presented in a usable and accessible format, and the assembly and annotation available in an appropriate subject-specific repository?
Yes
Competing Interests: No competing interests were disclosed.
Reviewer Expertise: Invertebrate taxonomy
Alongside their report, reviewers assign a status to the article:
| Invited Reviewers | ||
|---|---|---|
| 1 | 2 | |
|
Version 1 20 Feb 23 |
read | read |
Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list:
Sign up for content alerts and receive a weekly or monthly email with all newly published articles
Already registered? Sign in
The email address should be the one you originally registered with F1000.
You registered with F1000 via Google, so we cannot reset your password.
To sign in, please click here.
If you still need help with your Google account password, please click here.
You registered with F1000 via Facebook, so we cannot reset your password.
To sign in, please click here.
If you still need help with your Facebook account password, please click here.
If your email address is registered with us, we will email you instructions to reset your password.
If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance.
Comments on this article Comments (0)