ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a Sample of Iraqi Patients

[version 2; peer review: 2 approved, 1 approved with reservations]
PUBLISHED 14 May 2026
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Fallujah Multidisciplinary Science and Innovation gateway.

Abstract

Background

Ankylosing spondylitis (AS) is a chronic inflammatory illness mainly influencing the axial skeleton. It is a multifactorial illness in which environmental and genetic parameters contribute to its cause, one of which is interleukins, including interleukin-18 (IL-18). Therefore, this study aimed to investigate the association between single nucleotide polymorphism (SNP) rs549908 and serum levels of IL-18 in Iraqi patients with AS.

Methods

During the period of November 2024 and January 2025, a total of 100 individuals were enrolled in the present work, including 50 patients with AS and 50 healthy controls (HC), were obtained from Baghdad Teaching Hospital. Using enzyme-linked immunosorbent assay (ELISA) and TaqMan real-time polymerase chain reaction (PCR), serum levels and rs549908 genotyping of IL-18 were estimated.

Results

Significantly, levels of IL-18 in serum were raised in patients with AS compared to HC (235.7060 vs. 151.10 pg/mL, p < 0.001). Genetically, T allele frequency (69.0% vs. 49.0%, p = 0.006) and TT genotype frequency (53.1% vs. 23.5%, p = 0.004) were significantly greater in patients with AS compared to HC. Analysis under the model of dominant (TG + GG vs. TT) demonstrated significant association between status of illness and genotype (OR = 0.29, p = 0.007).

Conclusions

These outcomes suggest rs549908 SNP and serum levels of IL-18, are related with increased susceptibility to AS in the Iraqi population.

Keywords

Keywords: Ankylosing spondylitis, Interleukin-18, rs549908 Polymorphism, IL-18 serum levels, Genetic Susceptibilities.

Revised Amendments from Version 1

In this second version, the manuscript has been revised to improve linguistic clarity and technical accuracy. Key updates include correcting the English terminology (e.g., 'disease activity' instead of 'illness activity'), clarifying the Hardy–Weinberg Equilibrium (HWE) statistical reporting, and enhancing the ROC curve analysis with additional diagnostic metrics (sensitivity, specificity, and cut-off points). The discussion section has also been expanded to incorporate recent relevant literature.

See the authors' detailed response to the review by Duygu Kırkık
See the authors' detailed response to the review by Raghad Hassan Hussein
See the authors' detailed response to the review by Sahar m Hussein

Introduction

Ankylosing spondylitis (AS) is a chronic, inflammatory illness that largely impacts the axial joints, like the peripheral joints, sacroiliac joints, entheses and spine.1 In AS, ankylosis, or the growth of new bone, causes long-term impairment, decreased mobility and spinal fusion.2 It's still unclear what exactly causes AS. It has been proposed that the interplay among genetic and environmental factors serves a vital purpose.3,4 Proinflammatory cytokines such as TNF-alpha and other interleukins mediate a variety of inflammatory illnesses and are important modulators of inflammatory processes in the setting of AS.5 Adaptive and innate immune responses are regulated by the pleiotropic, pro-inflammatory cytokine interleukin-18.6 Interleukin-18 is primarily produced by neutrophils, dendritic cells, chondrocytes, keratinocytes, osteoblasts, and macrophages. It is a member of the interleukin 1 (IL-1) family. Through the caspase-1 proteolytic enzyme actions, the 23 kDa protein is transformed into the 18 kDa protein.7 Depending on the inflammatory setting, IL-18 have an effective function in both Th1 and Th2 immune responses. Together with IL-12, IL-18 induces the formation of interferon-gamma, which strengthens the Th1-mediated immune response. When IL-12 is absent, IL-18 activates Th2 immune responses.8 IL-18, as a pleiotropic and pro-inflammatory cytokine, can be generated in substantial amounts following infection and involved in innate and acquired immunity, inflammatory responses, and tumorigenesis.9 Dysregulation of IL-18 has the potential to precipitate inflammatory or autoimmune pathologies that pertain to host defense mechanisms, oncogenesis, allergic reactions, immune responses, and arthritic conditions, among others.10 Furthermore, IL-18 may serve as a pivotal relation among systemic inflammation and aberrant bone remodeling in arthritic conditions, by promoting osteoclast production and accelerating bone resorption.11 It may have an effective function in the initiation of AS. With the advancement of molecular biological methodologies, single nucleotide polymorphisms (SNPs) within genes have increasingly become prevalent method for investigating illness susceptibilities.12 Production of IL-18 protein is controlled via the IL-18 gene.13 The human IL-18 gene, carried on chromosome 11q22.2–q22.3, comprises six exons and contains various single nucleotide polymorphisms (SNPs). Among these, the rs549908 polymorphism is the focus of the current study.14 Several IL-18 gene polymorphisms have been demonstrated to be related to raised IL-18 levels in immune-mediated disorders.15 This study aimed to investigate the association between IL-18 rs549908 and the concentrations of IL-18 in the Iraqi patients with AS, and to assess their potential functions as genetic and inflammatory indicators in this population.

Methods

Subjects

In the work, 50 patients diagnosed with AS and 50 HC were chosen and obtained from Baghdad Teaching Hospital, Medical City, Baghdad, Iraq, between November 2024 and January 2025. Information on lifestyles, particularly smoking habits, clinical diagnoses, and histories of administered therapy, was obtained from patients with AS. The AS diagnosis was confirmed in accordance with the criteria of spondylarthritis International Society (ASAS) 2009 classification for axial spondylarthritis.16 Patients with AS measured their activity of illness through the Bath AS Disease activity index (BASDAI).17

Included criteria

The range of age of patients with AS was 20 to 63 years. The HC were age- and sex-matched to the cases, with no previous history of autoimmune or inflammatory disorders.

Excluded criteria

Individuals younger than 20 years or older than 63 years were excluded. Patients or controls with comorbidities, as well as those with autoimmune or inflammatory diseases such as inflammatory bowel disease, psoriasis, or rheumatoid arthritis, were also excluded.

Collection of blood samples

A volume of 3 mL of peripheral blood was obtained from each participant into 5 mL EDTA tubes for extraction of DNA. In addition, 3 mL of blood was collected into gel tubes and placed in centrifuge for 15 minutes at 3000 rpm. The resultant serum were aliquoted and preserved at −20°C till the time of immunological analysis.

Immunological assay

Serum levels of IL-18 were measured using ELISA kit (FineTest, Wuhan Fine Biotech Co., Ltd., China; Cat. No. EH0011), in accordance with the manufacturer's instructions. Optical density was assessed at 450 nm with a microplate reader (HumaReader HS, Human GmbH, Germany).

Genotyping determination

DNA extraction

From peripheral blood, genomic DNA was isolated and collected in EDTA-containing tubes utilizing the EasyPureBlood Genomic DNA Kit (TransGen Biotech, Beijing, China; Cat. No. EE121), depending to the manufacturer's guidelines. The purified DNA was eluted in 50 μL of elution buffer and stored at −20 °C until further analysis.

SNP genotyping

To amplify IL-18 SNPs (rs549908), TaqMan real-time polymerase chain reaction (RT-PCR) was utilised. Single reverse and single forward primers in addition to couple of probes were utilised and listed in Table 1. The primers and probes were custom-synthesized by Synbio Technologies (China). PCR mix (total volume: 20 μL) consisted of 5 μL nuclease-free water, 6 μL SuperMix, 1.5 μL forward primer, 1 μL of each probe, 4 μL DNA, and 1.5 μL reverse primer. The mix was transferred to a PCR program (TransGen Biotech SuperMix/China). Amplification was performed under standard conditions: an initial denaturation cycle 95°C for 2 min, followed by 30 cycles of of denaturation 95°C for 30 sec, annealing 58°C for 1 min and extension 72°C for 30 sec. Amplification products were additionally verified by 1.5% agarose gel electrophoresis.

Table 1. Primer and probe sequences used for genotyping IL-18 gene rs549908 SNP.

NameSequence (5′→3′)Length (base) Dye
Forward PrimerCTTATGACTGATAATTTAGATTCAAG26-
Reverse PrimerATTGTAGCTACTTCTGGAACAG23-
Probe 1TTGCCAAAGTAATCTGATTCCAGGTTTTCT30FAM
Probe 2TTGCCAAAGTAATCGGATTCCAGGTTTTCT30HEX

Statistical analysis

Statistical analyses were carried out utilising SPSS software, version 20.0 (IBM Corp., Armonk, NY, USA). Descriptive statistics, including median, standard deviation, mean, percentage, and frequency, were used to describe clinical and demographic data. The Shapiro-Wilk test was utilised for the distribution of continuous variables. Normally distributed variables were analyzed using the independent samples t-test, while non-normally distributed variables were analyzed using the Mann-Whitney U test. Categorical variables, including genotype and allele frequencies, were analyzed using the chi-square test. Hardy-Weinberg equilibrium was assessed using chi-square analysis. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using WinPepi software. Values p < 0.05 were regarded as statistically significant.

Results

Based on the results in Table 2, the mean age of patients with AS was greater (39.9000 ± 11.23815 years) than that of the control group (31.0600 ± 10.46356 years), though the variation did not reach statistical significance (p = 0.059). Similarly, there was no significant variation in body mass index (BMI) among the AS group (28.2360 ± 5.18683 kg/m2) and HC (26.7920 ± 3.80541 kg/m2; p = 0.060). Sex distribution revealed a greater proportion of males among patients with AS (72%) compared to controls (60%), which was statistically significant (p < 0.001). A notable finding was the presence of a family history of AS in 22% of patients, while none of the controls reported a positive family history (p < 0.001), indicating a potential genetic predisposition in the patient group. Regarding inflammatory markers, erythrocyte sedimentation rate (ESR) was significantly elevated in patients with AS (18.62 ± 16.52937 mm/hr) compared to controls (8.28 ± 5.05092 mm/hr; p < 0.001), supporting an ongoing inflammatory state. C-reactive protein (CRP) was positive in 28% of patients with AS and negative in all control subjects (p < 0.001), further corroborating the presence of systemic inflammation in the AS group. Assessment of disease activity using the Bath Ankylosing Spondylitis Disease activity index (BASDAI) showed a mean score of 4.90 ± 1.00 in patients, while all healthy controls had a BASDAI of 0.00 (p < 0.001). Among patients with AS, 80% were classified as having moderate disease activity, and 20% had severe illness, whereas no disease activity was reported in the control group (p < 0.001).

Table 2. Demographic and clinical characteristics of AS and HC.

ParameterAS (n = 50)HC (n = 50) p-value
Age (mean ± S.D.) year 39.9000 ± 11.2381531.0600 ± 10.463560.059 NS
Sex N (%) Male 36 (72%)30 (60.0%)<0.001**
Female 14 (28%)20 (40.0%)
Family history N (%) Yes 11 (22%)0 (0.0%)<0.001**
No 39 (78%)50 (100.0%)
Activity of illness N (%) Moderate 40 (80.0%)0 (0.0%)<0.001**
Severe 10 (20.0%)0 (0.0%)
CRP N (%) Negative 36 (72%)50 (100.0%)<0.001**
Positive 14 (28%)0 (0.0%)
ESR (Mean ± S.D.) mm/hr 18.6200 ± 16.529378.2800 ± 5.05092<0.001**
BMI (mean ± S. D.) kg/m 228.2360 ± 5.1868326.7920 ± 3.805410.060 NS
BASDAI Mean ± S.D. 4.90 ± 1.000.00 ± 0.000<0.001**

** Highly significant.

As displayed in Table 3, serum IL-18 levels were significantly greater in patients with AS (median of 235.7060, range (23-485.78)) compared to HC (median 151.10, range (102.04-250.19)), with highly significant variations (p < 0.001).

Table 3. Interleukin-18 level of patients with AS in comparison with HC.

GroupNo. of subjectIL-18 (pg/ml) Median (min-max) P-value
AS 50235.7060 (23-485.78)<0.001**
HC 50151.10 (102.04-250.19)

Table 4 illustrates the correlation analysis between serum IL-18 levels with clinical and inflammatory parameters in patients with ankylosing spondylitis. In particular, IL-18 revealed no significant correlation with BASDAI (p = 0.843), ESR (p = 0.915) or BMI (p = 0.884).

Table 4. Correlations of interleukin-18 levels with clinical and inflammatory parameters in patients with Ankylosing Spondylitis.

BASDAIESRIL-18 BMI
BASDAI 10.2550.029-0.086
P-value 0.0740.8430.553
ESR 0.2551-0.0150.254
P-value 0.0740.9150.075
IL-18 0.029-0.0151-0.021
P-value 0.8430.9150.884
BMI -0.0860.254-0.0211
P-value 0.5530.0750.884

To evaluate the diagnostic value of IL-18, a ROC curve was generated ( Figure 1). The analysis showed an AUC of 0.943 (p < 0.001), At a criterion value >185.97, sensitivity and specificity were 96.0% and 92.0%, respectively, which reflected excellent diagnostic accuracy. These results suggested that IL-18 has strong potential as a biomarker for differentiating AS patients from healthy individuals.

61debc28-83c4-4f2c-ba74-67d0fd1831a6_figure1.gif

Figure 1. Receiver Operating Characteristic (ROC) curve of IL-18 for predicting susceptibility to ankylosing spondylitis.

Table 5, showed the frequencies of alleles and genotype of the IL-18 rs549908 polymorphism for both patients and HC. The results revealed that there was a significant relation among TT genotype and patients compared to HC (OR = 3.52, p = 0.004). In contrast, the TG and GG genotypes showed no statistically significant variations among groups (p = 0.15 and p = 0.21). The study found that the T allele was significantly more prevalent among patients with AS than in HC (OR = 2.32, p = 0.006). Conversely, G exhibited a relatively low frequency in patients, compared to HC (OR = 0.43, p = 0.006).

Table 5. Frequencies of alleles and genotype of the rs549908 of gene in AS and HC.

Genotype and Allele FrequenciesAS (n= 50)HC (n= 50)OR95%CI P-value
N (%)N (%)
TT 26 (0.531)12 (0.235)3.521.51-8.190.004
TG 17 (0.347)25 (0.490)0.540.24-1.190.15
GG 7 (0.140)13 (0.275)0.460.17-1.270.21
T 69 (0.69)49 (0.49)2.321.36-4.270.006
G 31 (0.31)51 (0.51)0.430.24-0.770.006

The amplification plot illustrates the fluorescence intensity versus the PCR cycles for all samples in Figure 2. Each curve represents a single sample, showing successful amplification of IL-18 rs549908. The exponential phase was clearly visible after cycle 20, confirming the validity of the genotyping assay.

61debc28-83c4-4f2c-ba74-67d0fd1831a6_figure2.gif

Figure 2. SNPs genotyping amplification plots of IL-18 rs549908.

In Figure 3, the dual-color scatter plot displayed distinct separation of the genotypes. Samples were clearly distributed into three well-defined clusters corresponding to the TT, TG, and GG genotypes. Each point represented an individual sample, and the separation of the clusters provided clear discrimination between homozygous and heterozygous alleles.

61debc28-83c4-4f2c-ba74-67d0fd1831a6_figure3.gif

Figure 3. SNPs genotyping amplification plots showing fluorescence signals that indicate the alleles A and B in homozygous and heterozygous genotypes of IL-18 rs549908.

To test Hardy-Weinberg equilibrium (HWE) for the IL-18 rs549908 polymorphism, a chi-squared test was conducted. As presented in Table 6, the genotype distribution in both the AS patient group (χ2 = 2.10, p = 0.14) and the control group (χ2 = 8.006 × 10−6, p = 0.99) showed no significant deviation from HWE. These outcomes demonstrated that genotype distributions were consistent with Hardy-Weinberg in both groups.

Table 6. Hardy-Weinberg equilibrium of the rs549908 of gene in the patients and HC.

HWEAS (n = 50)HC (n = 50)
GenotypesObservedExpectedObserved Expected
TT2623.81212.0
TG1721.42525.0
GG74.81313.0
X2 value2.108.006 × 10−6
p-value0.140.99

Based on the analysis of the genetic model provided in Table 7, the possible mode of inheritance of the polymorphism rs549908 regarding illness risk was assessed. In the dominant model, the combination of the TG and GG genotypes demonstrated a significant relationship with a protective effect against the illness (OR = 0.29, p = 0.007) in comparison to the TT genotype. On the contrary, the recessive model, which compared the GG genotype with the combined TG and TT genotypes, showed no statistically significant relation (OR = 0.46, p = 0.21). Likewise, the over-dominant model that compared TG genotypes with the combined TT and GG genotypes showed no significant relation (OR = 0.49, p = 0.10).

Table 7. Genetic model action of the IL-18 gene.

Genetic modelGenotypesPatients (n = 50)HC (n = 50)OR95% C.I. P-value
Dominant TG+GG 17/725/130.290.13-0.680.007
TT (Ref.) 26121
Recessive TG+TT (Ref.) 17/2625/121
GG 7130.460.17-1.270.21
Over-dominant TT+GG (Ref.) 26/712/131
TG 17250.490.22-1.090.1

The relationship among IL-18 levels and rs549908 genotypes in both patients and HC with different disease activity was presented in Table 8. According to the outcomes, in the control group, IL-18 levels exhibited a significant level of consistency for different genotypes. In individuals with moderate disease activity, IL-18 concentration was elevated across all the genotypes, with GG (268.42 pg/mL), TT (239.06 pg/mL), and TG (222.26 pg/mL) genotypes having mean values that were greater when compared to the control group. Likewise, IL-18 was elevated in individuals with severe disease activity GG (251.52 pg/mL), TG (249.25 pg/mL), TT (231.03 pg/mL). There were statistically significant variations in the IL-18 levels in serum among the genotypes and activity of the illness (p = 0.001).

Table 8. Relationship among rs549908 genotypes and serum IL-18 levels according to disease activity in patients and HC.

Activityrs549908n IL-18
HC GG 13 153.218 (134.11-185.97)
TG 25 142.7650 (131.00-175.10)
TT 12 162.7315 (150.39-185.32)
AS Moderate GG 5 268.4210 (169.55-279.02)
TG 11 222.2640 (187.09-391.88)
TT 23 239.0620 (178.77-485.78)
severe GG 2 251.5230 (245.45-257.59)
TG 6 249.2480 (205.66-333.46)
TT 3 231.0290 (216.31-249.57)
p-value 0.001

Discussion

This study investigated the relation among the IL-18 rs549908 polymorphism and susceptibilities to ankylosing spondylitis (AS) in an Iraqi population by analyzing the distribution of genotypes and alleles, as well as evaluating serum IL-18 levels as a potential inflammatory biomarker. The IL-18 rs549908 polymorphism appeared to have a genetic component to, susceptibilities, since the investigation found significant variations in frequencies of alleles and genotype among patients with AS and healthy controls. Serum IL-18 levels were also noticeably greater in patients with AS, confirming the substance's function as an important inflammatory marker in the illness.18 In this investigation, ankylosing spondylitis patients had considerably greater serum IL-18 concentrations (235.7060 pg/mL) than healthy controls (151.10 pg/mL; p = 0.001). Furthermore, the correlation between the serum IL-18 and clinical parameters, such as BASDAI, ESR, and BMI, in the patients with AS, was examined, and no statistically significant correlations were observed. These findings were consistent with previous reports, which indicated that although IL-18 levels were increased in AS patients, they did not significantly associate with clinical activity measures, suggesting that IL-18 may reflect disease susceptibility rather than activity.19 Chromosome 11q22.2–22.3 contains the IL18 gene, and a number of variants in its promoter area have been linked to a raised risk of developing a number of inflammatory and autoimmune illnesses.15 There was a strong correlation among the TT genotype and heightened vulnerability to ankylosing spondylitis (AS), according to the study of the IL-18 rs549908 genotype distribution. With an odds ratio (OR) of 3.52 (p = 0.004), 53.1% of patients with AS and 23.5% of healthy controls were found to have the TT genotype. On the other hand, the frequency of the G allele was 31.0% in individuals and 51.0% in controls (OR = 0.43, p = 0.006), suggesting a possible protective impact. In the Iraqi population under study, these results imply that the TT genotype could operate as a genetic predisposing factor for AS. A synonymous polymorphism found in the IL18 gene's exon region, the rs549908 variation had been linked in the past to a number of autoimmune disorders, such as atrophic conditions, systemic lupus erythematosus (SLE), and rheumatoid arthritis (RA).20 In line with these outcomes, Abdulridha et al. found that immune-regulatory gene polymorphisms were substantially linked to a greater risk of autoimmune illnesses.21 Notably, Kirkik et al. demonstrated a significant association between the TLR4 rs41426344 polymorphism and disease activity in Turkish patients with ankylosing spondylitis, emphasizing the importance of immune-regulatory gene variants in AS pathogenesis across different populations.22 These results provide more credence to the theory that rs549908 played a role in the genetic vulnerability that underlies AS. Although this study focused specifically on the IL-18 rs549908 polymorphism. The outcomes aligned with broader research emphasizing the role of genetic variation in immune-regulatory pathways underlying autoimmune illness susceptibilities. Genetic model analysis indicated a significant dominant inheritance pattern, where individuals carrying TG or GG genotypes exhibited a markedly reduced risk of developing ankylosing spondylitis compared to TT homozygotes (OR = 0.29, p = 0.007). This suggested that the presence of the G allele might have conferred a protective effect against AS. Comparable relations were observed in studies of other immune-related disorders, where variants within immune-modulating genes were similarly linked to illness risk under dominant genetic models. These outcomes reinforced the notion that polymorphisms influencing immune function contributed to immune dysregulation and supported the multifactorial etiology of autoimmune illnesses.23,24 Serum IL-18 levels were further analyzed in relation to IL-18 rs549908 genotypes and disease activity scores in individuals with ankylosing spondylitis. Across all genotypes, patients with AS exhibited significantly greater IL-18 concentrations compared to healthy controls (p = 0.001). Among individuals with moderate disease activity, the highest serum IL-18 levels were observed in individuals with the GG genotype (268.42 pg/mL), followed by those with TT and TG genotypes. A similar trend was noted in patients with severe disease activity, although the absolute IL-18 values were slightly lower than in the moderate group. These outcomes suggest that while the TT genotype was associated with increased susceptibility to AS, serum IL-18 levels did not correlate directly with genotype. This indicates that IL-18 levels may be regulated by additional factors beyond genetic variation at rs549908. Similar observations were reported by Doss et al., who found no significant variations in serum IL-18 concentrations among different IL-18 genotypes in individuals with cutaneous lichen planus.25 The markedly elevated serum IL-18 levels in AS patients, it was crucial to account for potential confounding factors such as biologic therapy, disease duration, and co-infections, which may affect IL-18 concentrations independently of genotype, demonstrating the need for caution in the interpretation of these elevated cytokine levels. Limited samples in GG genotype group may be considered as the cause for immune differences between people and the extent of illness, which will affect the cytokine level instead of genotype. Nevertheless, even though the sample size was limited and affected the generality of the results, this study is the first study where the genotype was associated with AS development among the Iraqi population. Further studies need to investigate the polymorphisms in rs549908 in other autoimmune diseases among the Middle East populations in order to increase the knowledge about immune system-related genes in the region. Currently, the study has shown that some IL-18 polymorphisms are statistically associated with AS resistance. Actually, the genotypes GT and the protective allele were found to have a reduced susceptibility even after adjusting for other potential confounders. This finding agrees with those of other previously conducted studies that reported an inverse relationship between the genotypes GC (rs187238) and AG (rs360719) with the occurrence of inflammation. Hence, it can be concluded that the presence of these IL-18 polymorphisms has a protective effect on AS. These results align with and expand upon previous investigations of IL-18 polymorphisms in immune-mediated and inflammatory conditions. For example, Liang et al. reported associations of rs187238 and rs1946518 with biliary atresia, supporting the concept that IL-18 variants can alter disease risk in diverse contexts.26 Similarly, Lando et al and Aboraia et al. identified rs549908 as a variant associated with total IgE levels in asthma patients across European populations, further reinforcing its involvement in immune dysregulation.27,28 However, at times, contrary findings have been found in connection with the differences in genetics and environment. This is illustrated in a study by Eitan et al., where none of rs187238, rs1946518, or rs549908 were associated with alopecia areata among Jordanians.29 Similarly, Mazurek-Mochol et al. found that there was no significant relationship between SNP rs187238 and the predisposition towards periodontitis, despite a difference in IL-18 gene expression existing amongst individuals with differing genotypes.13 Such contradictions made it clear that IL-18 plays a rather complicated role as a pro-inflammatory cytokine and, under certain circumstances, may act as a possible protective agent against disease. The outcomes of the study are especially important due to the fact that they demonstrate that the polymorphism of the IL-18 gene resulted in a lower probability of AS appearance. In its turn, it is well-known that according to the data of multiple studies related to various other diseases, some mutations resulted in higher chances of pathology development. Thus, it may be assumed that for the AS case, there is a particular allele that can avoid inflammation. Supporting this, de Almeida Viana et al. showed that rs187238 influenced lipid metabolism in COVID-19 patients, suggesting pleiotropic effects of IL-18 polymorphisms beyond classical inflammation.30 Taken together, these findings imply that the biological effect of IL-18 variants may be disease and tissue-specific.

Conclusion

This pilot study demonstrated that serum levels of IL-18 were significantly elevated in patients with ankylosing spondylitis (AS), suggesting a potential role of this cytokine in disease pathogenesis. Moreover, the T allele and TT genotype of the IL-18 rs549908 SNP were associated with an increased susceptibility to AS in the Iraqi population, whereas the G allele, particularly in the GG and TG genotypes, appeared to confer a protective effect under a dominant genetic model. However, these findings should be interpreted with caution. The relatively small study population limits the generalizability of the results, and the observed associations must therefore be considered preliminary and exploratory in nature. Larger studies across diverse populations are required to validate these findings and to clarify the functional impact of IL-18 gene polymorphisms in the onset and progression of AS.

Ethical considerations

Ethical approval was obtained from the Biotechnology Department Ethics Committee at the College of Science, University of Baghdad (No. CSEC/0725/0086 on July 12, 2025). Every participant gave written informed consent before they enrolled.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 15 Dec 2025
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Jasim IK and Saud AM. The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a Sample of Iraqi Patients [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2026, 14:1399 (https://doi.org/10.12688/f1000research.172631.2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 15 Dec 2025
Views
15
Cite
Reviewer Report 30 Apr 2026
Sahar m Hussein, Al-Nahrain University, Baghdad, Iraq 
Approved
VIEWS 15
The study contributed suitable and methodical information on the correlation between IL-18 rs549908 polymorphism and serum IL-18 expression levels with susceptibility to ankylosing spondylitis in Iraqi subjects.
The incorporation of genetic and immunological analysis is an evident strength and ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Hussein Sm. Reviewer Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a Sample of Iraqi Patients [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2026, 14:1399 (https://doi.org/10.5256/f1000research.190371.r475867)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 14 May 2026
    Ibtehal kadhim, Biotechnology, University of Baghdad, Baghdad, Iraq
    14 May 2026
    Author Response
    Dear Reviewer,
    We sincerely thank you for your constructive and encouraging comments.
    The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 14 May 2026
    Ibtehal kadhim, Biotechnology, University of Baghdad, Baghdad, Iraq
    14 May 2026
    Author Response
    Dear Reviewer,
    We sincerely thank you for your constructive and encouraging comments.
    The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for ... Continue reading
Views
14
Cite
Reviewer Report 25 Apr 2026
Raghad Hassan Hussein, Department of Medical laboratory Techniques, College of health and medical techniques, Middle Technical University, Baghdad, Iraq 
Approved
VIEWS 14
This manuscript presents an  investigation into the association between the IL-18 rs549908 polymorphism and ankylosing spondylitis (AS) in an Iraqi population. The study addresses an important gap in the literature by providing population-specific genetic and immunological data, which are ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Hassan Hussein R. Reviewer Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a Sample of Iraqi Patients [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2026, 14:1399 (https://doi.org/10.5256/f1000research.190371.r475866)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 14 May 2026
    Ibtehal kadhim, Biotechnology, University of Baghdad, Baghdad, Iraq
    14 May 2026
    Author Response
    Dear Reviewer,
    We thank you for your positive evaluation and helpful comments.
    The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 14 May 2026
    Ibtehal kadhim, Biotechnology, University of Baghdad, Baghdad, Iraq
    14 May 2026
    Author Response
    Dear Reviewer,
    We thank you for your positive evaluation and helpful comments.
    The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including ... Continue reading
Views
25
Cite
Reviewer Report 21 Jan 2026
Duygu Kırkık, Hamidiye Faculty of Medicine, University of Health Sciences, Istanbul, Turkey 
Approved with Reservations
VIEWS 25
This study presents a unique and regionally valuable contribution by addressing the association between the IL-18 rs549908 polymorphism and serum IL-18 levels with ankylosing spondylitis (AS) in an Iraqi population. The combined evaluation of genetic analysis and biochemical measurements is ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Kırkık D. Reviewer Report For: The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a Sample of Iraqi Patients [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2026, 14:1399 (https://doi.org/10.5256/f1000research.190371.r445404)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 14 May 2026
    Ibtehal kadhim, Biotechnology, University of Baghdad, Baghdad, Iraq
    14 May 2026
    Author Response
    Dear Reviewer,
    We sincerely thank you for your careful evaluation and valuable comments.
    The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as “relations among” ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 14 May 2026
    Ibtehal kadhim, Biotechnology, University of Baghdad, Baghdad, Iraq
    14 May 2026
    Author Response
    Dear Reviewer,
    We sincerely thank you for your careful evaluation and valuable comments.
    The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as “relations among” ... Continue reading

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 15 Dec 2025
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.