ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Data Note

A guide to selecting high-performing antibodies for GCase (UniProt ID: P04062) for use in western blot, immunoprecipitation, and immunofluorescence

[version 1; peer review: 2 approved]
PUBLISHED 15 Dec 2025
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the YCharOS (Antibody Characterization through Open Science) gateway.

Abstract

The human GBA1 gene encodes glucocerebrosidase (GCase), a lysosomal enzyme that hydrolyzes glucosylceramides. Variants in GBA1 and reduced GCase activity have been linked to Parkinson’s disease and Gaucher’s disease. Here we have characterized twenty-four GCase commercial antibodies for western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. These studies are part of a larger, collaborative initiative seeking to address antibody reproducibility issues by characterizing commercially available antibodies for human proteins and publishing the results openly as a resource for the scientific community. While the use of antibodies and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific needs.

Keywords

P04062, GBA1, GCase , antibody characterization, antibody validation, western blot, immunoprecipitation, immunofluorescence

Introduction

Variants in GBA1, which encodes the lysosomal hydrolase glucocerebrosidase (GCase), represent one of the most common genetic risk factors for Parkinson’s disease.1 Biallelic mutations in GBA1 are also causative of Gaucher’s disease, a lysosomal storage disorder.2 GCase is responsible for the hydrolysis of glucosylceramide, and mutations in GBA1 can impair the enzyme’s structure, leading to reduced activity, stability, and protein levels.1 The scientific community would benefit from specific and renewable GCase antibodies to investigate how disease-related mutations affect the protein’s biochemical and cellular characteristics.

This research is part of a broader collaborative initiative in which academics, funders and commercial antibody manufacturers are working together to address antibody reproducibility issues by characterizing commercial antibodies for human proteins using standardized protocols, and openly sharing the data.3 It consists of identifying human cell lines with adequate target protein expression and the development/contribution of equivalent knockout (KO) cell lines, followed by antibody characterization procedures using most commercially available renewable antibodies against the corresponding protein.3 Here we characterized twenty-four commercial GCase antibodies, selected and donated by participant antibody manufacturers, for use in western blot, immunoprecipitation, and immunofluorescence (also referred to as immunocytochemistry), enabling biochemical and cellular assessment of GCase properties and function.

The authors do not engage in result analysis or offer explicit antibody recommendations. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Guidelines on how to interpret antibody characterization data found in this study are featured on the YCharOS gateway4 and in Table 4 of this data note.3

Table 1. Summary of the cell lines used.

InstitutionCatalog numberRRID (Cellosaurus)Cell line Genotype
Horizon DiscoveryC631CVCL_Y019 HAP1WT
Horizon DiscoveryHZGHC004541c001CVCL_SP63 HAP1GBA1 KO
Abcamab255448CVCL_0030 HeLaWT
Abcamab265038CVCL_B1SQ HeLaGBA1 KO
ATCCHTB-14CVCL_0022 U-87 MGWT
ATCCCRL-4000CVCL_4388 RPE-1WT
Academic partner--RPE-1GBA1 KO

Table 2. Summary of the GCase antibodies tested.

CompanyCatalog numberLot numberRRID (Antibody registry)ClonalityClone IDHostConcentration (μg/μL) Vendors recommended applications
Abcamab125065**1003589-3AB_10973982 recombinant monoEPR5142rabbit0.10Wb
Abcamab128879**1048619-1AB_11144121 recombinant monoEPR5143(3)rabbit0.23Wb
Abcamab309228**1089805-5AB_3105954 recombinant monoEPR26755-29rabbit1.02other
Abcamab309229**1089807-5AB_3105953 recombinant monoEPR26755-42rabbit1.02other
Abcamab55080*1035295-1AB_2109076 monoclonal200mouse1.00Wb, IF
-2020A4849*20231009AB_3696746monoclonal1/17 (MJFF request)mouse1.00NA
-P1AM1914-001-28*20.02.2024AB_3696747monoclonal1/23 (MJFF request)mouse1.00NA
ABCD AntibodiesABCD_AR148**11/15/2024AB_3076343 recombinant mono2D4rabbit0.05NA
ABCD AntibodiesABCD_AR150**11/15/2024AB_3076344 recombinant mono2L18rabbit0.02NA
ABclonalA19057**4000000500AB_2862550 recombinant monoARC0500rabbit0.51Wb
Bio-Techne (Novus Biologicals)NBP2-66871**HO0913NArecombinant monoJM10-76rabbit1.00Wb, IF
Bio-Techne (R&D Systems)MAB7410*CHEF0422011AB_2938856 monoclonal812201mouse0.50Wb, IF
Cell Signaling Technology88162**1NArecombinant monoE2R1Lrabbit0.08Wb
GeneTexGTX10126743817AB_1950346 polyclonal-rabbit0.73Wb, IF
GeneTexGTX11407343677AB_10620339 polyclonal-rabbit1.78Wb
MilliporeSigmaG41710000181205AB_1078958 polyclonal-rabbit1.00Wb
Proteintech20622-1-AP00013380AB_10696317 polyclonal-rabbit0.45IF
Proteintech27972-1-AP00059099AB_2881024 polyclonal-rabbit0.60Wb
Thermo Fisher ScientificMA5-26589*YE3914194AB_2724337 monoclonalOTI1D12mouse1.00Wb
Thermo Fisher ScientificMA5-26591*YE3914195AB_2724339 monoclonalOTI4G4mouse1.00Wb
Thermo Fisher ScientificMA5-32591**YE3913381AAB_2809868 recombinant monoJM10-76rabbit1.00Wb
Thermo Fisher ScientificMA5-35236**YE3913567AB_2849139 recombinant monoARC0500rabbit0.40Wb
Thermo Fisher ScientificMA5-38382**YE3914005AB_2898296 recombinant mono4H4rabbit0.40Wb
Thermo Fisher ScientificMA5-52914**ZJ4492612AB_3249389 recombinant mono23GB5775rabbitNAWb

** = Recombinant antibody,

* = Monoclonal antibody, NA = Not available.

Table 3. Table of secondary antibodies used.

Company Secondary antibody Catalog number RRID (Antibody registry) Clonality Concentration (μg/μL) Working concentration (μg/mL)
Thermo Fisher ScientificHRP-Goat Anti-Rabbit Antibody (H+L)65-6120AB_2533967 polyclonal1.00.2
Thermo Fisher ScientificHRP-Goat Anti-Mouse Antibody (H+L)62-6520AB_2533947 polyclonal1.50.75
Cell Signaling TechnologyProtein A, HRP conjugate12291NApolyclonal0.1250.5
Thermo Fisher ScientificAlexa Fluor™ 555-Goat anti-Rabbit IgG (H+L)A-21429AB_2535850 polyclonal2.00.5
Thermo Fisher ScientificAlexa Fluor™ 555-Goat anti-Mouse IgG (H+L)A-21424AB_141780 polyclonal2.00.5

Table 4. Illustrations to assess antibody performance in all western blot, immunoprecipitation and immunofluorescence.

Western blotImmunoprecipitationImmunofluorescence
102a4d68-2f48-4589-98a0-cad02d05d050_Graphical3.gif 102a4d68-2f48-4589-98a0-cad02d05d050_Graphical2.gif 102a4d68-2f48-4589-98a0-cad02d05d050_Graphical1.gif

Results and discussion

Our standard protocol involves comparing readouts from wild type (WT) and KO cells.5,6 The first step was to identify a cell line(s) that expresses sufficient levels of a given protein to generate a measurable signal using antibodies. To this end, we examined the DepMap (Cancer Dependency Map Portal, RRID:SCR_017655) transcriptomics database to identify all cell lines that express the target at levels greater than 2.5 log2 (transcripts per million “TPM” + 1), which we have found to be a suitable cut-off.7 The HAP1 expresses the GBA1 transcript at 3.5 log2 TPM+1. A GBA1 KO HAP1 cell line was obtained from Horizon Discovery ( Table 1). Moreover, as seen on DepMap, the HAP1 does not carry mutations in the GBA1 that could affect antibody–epitope binding.

To screen all twenty-four by western blot, WT and GBA1 KO protein lysates were ran on SDS-PAGE, transferred onto nitrocellulose membranes, and then probed with twenty-four GCase antibodies in parallel ( Figure 1). HeLa expresses the GBA1 transcript at 5.4 log2 TPM+1, and a HeLa GBA1 KO is commercially available at Abcam. Protein expression of GCase was evaluated by western blot in the two cell types HAP1 and HeLa in addition to WT U-87 MG and RPE-1 ( Figure 2).

102a4d68-2f48-4589-98a0-cad02d05d050_figure1.gif

Figure 1. GCase antibody screening by western blot.

Lysates of HAP1 WT and GBA1 KO were prepared, and 30 μg of protein were processed for western blot with the indicated GCase antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Antibody dilutions used: ab125065** at 1/100, ab128879** at 1/1000, ab309228** at 1/200, ab309229** at 1/200, ab55080* at 1/500, 2020A4849* at 1/1000, P1AM1914-001-28* at 1/1000, ABCD_AR148** 1/50 (1 μg/mL), ABCD_AR150** at 1/20, A19057** at 1/1000, NBP2-66871** at 1/500, MAB7410* at 1/500, 88162** at 1/100, GTX101267 at 1/100, GTX114073 at 1/1000, G4171 at 1/1000, 20622-1-AP at 1/100, 27972-1-AP at 1/1000, MA5-26589* at 1/100, MA5-26591* at 1/100, MA5-32591** at 1/1000, MA5-35236** at 1/1000, MA5-38382** at 1/1000, and MA5-52914** at 1/1000. Predicted band size: 59.7 kDa. **= recombinant antibody, *= monoclonal antibody.

102a4d68-2f48-4589-98a0-cad02d05d050_figure2.gif

Figure 2. GCase western blot on various cell lysates.

Lysates were prepared from WT and GBA1 KOs in HAP1, neural progenitor cells and HeLa as well as WT U-87 MG and RPE-1. 30 μg of protein were processed for western blot with anti-GCase A19057** diluted at 1/1000. Predicted band size: 59.7 kDa. **= recombinant antibody.

We then assessed the capability of all twenty-four antibodies to capture GCase from HAP1 protein extracts using immunoprecipitation techniques, followed by western blot analysis. For the immunoblot step, a specific GCase antibody identified previously (refer to Figure 1) was selected. Equal amounts of the starting material (SM) and the unbound fractions (UB), as well as the whole immunoprecipitate (IP) eluates were separated by SDS-PAGE ( Figure 3).

102a4d68-2f48-4589-98a0-cad02d05d050_figure3.gif

Figure 3. GCase antibody screening by immunoprecipitation on HAP1 lysates.

HAP1 lysates were prepared, and immunoprecipitation was performed using 1 mg of lysate and 2.0 μg of the indicated GCase antibodies pre-coupled to Dynabeads protein A or protein G. Samples were washed and processed for western blot with the anti-GCase ab55080* diluted at 1/500 or A19057** at 1/1000. The Ponceau stained transfers of each blot are shown. SM=4% starting material; UB=4% unbound fraction; IP=immunoprecipitate, HC= antibody heavy chain. **= recombinant antibody, *= monoclonal antibody.

Based on the assessment of GCase expression in Figure 2, the highest expressing RPE-1 cells were selected for antibody screening in immunofluorescence. A KO cell line was generated by an academic partner in RPE-1 using CRISPR/Cas9. For immunofluorescence, twenty-two antibodies were screened using a mosaic strategy. First, RPE-1 WT and GBA1 KO cells were labelled with different fluorescent dyes in order to distinguish the two cell lines, and the GCase antibodies were evaluated. Both WT and KO lines imaged in the same field of view to reduce staining, imaging and image analysis bias ( Figure 4). Quantification of immunofluorescence intensity in hundreds of WT and KO cells was performed for each antibody tested, and the images presented in Figure 4 are representative of this analysis.3

102a4d68-2f48-4589-98a0-cad02d05d050_figure4.gif

Figure 4. GCase antibody screening by immunofluorescence in RPE-1 cells.

RPE-1 WT and GBA1 KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated GCase antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody including DAPI. Acquisition of the blue (nucleus-DAPI), green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of the merged blue and red (grayscale) channels are shown. WT and KO cells are outlined with green and magenta dashed line, respectively. When an antibody was recommended for immunofluorescence by the supplier, we tested it at the recommended dilution. The rest of the antibodies were tested at 1 and 2 μg/ml, and the final concentration was selected based on the detection range of the microscope used and a quantitative analysis not shown here. Antibody dilutions used: ab125065** at 1/50, ab128879** at 1/200, ab309228** at 1/500, ab309229** at 1/500, ab55080* at 1/1000, 2020A4849* at 1/500, P1AM1914-001-28* at 1/500, ABCD_AR148** 1/100, ABCD_AR150** at 1/100, A19057** at 1/500, NBP2-66871** at 1/1000, MAB7410* at 1/500, 88162** at 1/500, GTX101267 at 1/100, GTX114073 at 1/700, G4171 at 1/1000, 27972-1-AP at 1/300, MA5-26589* at 1/1000, MA5-26591* at 1/1000, MA5-32591** at 1/1000, MA5-35236** at 1/400, and MA5-38382** at 1/200. Bars = 10 μm. **= recombinant antibody, *= monoclonal antibody.

This study confirms the utility of the mouse monoclonal antibodies clones 1/17 and 1/23 for immunoprecipitation and immunofluorescence,8 and identifies rabbit recombinant antibodies suitable across multiple applications. The availability of both mouse- and rabbit-specific GCase antibodies enables multiplexing experiments and supports the development of antibody pairs for applications such as ELISA assays.

In conclusion, we have screened twenty-four GCase commercial antibodies by western blot, immunoprecipitation, and immunofluorescence by comparing the signal produced by the antibodies in human HAP1 and RPE-1 WT and GBA1 KO cells. To assist users in interpreting antibody performanyce, Table 4 outlines various scenarios in which antibodies may perform in all three applications.7 Several high-quality and renewable antibodies that successfully detect GCase were identified in all applications. Researchers who wish to study GCase in a different species are encouraged to select high-quality antibodies, based on the results of this study, and investigate the predicted species reactivity of the manufacturer before extending their research.

Limitations

Inherent limitations are associated with the antibody characterization platform used in this study. Firstly, the YCharOS project focuses on renewable (recombinant and monoclonal) antibodies and does not test all commercially available GCase antibodies. YCharOS partners provide approximately 80% of all renewable antibodies, but some top-cited polyclonal antibodies may not be available through these partners. We encourage readers to consult vendor documentation to identify the specific antigen each antibody is raised against, where such information is available.

Secondly, the YCharOS effort employs a non-biased approach that is agnostic to the protein for which antibodies have been characterized. The aim is to provide objective data on antibody performance without preconceived notions about how antibodies should perform or the molecular weight that should be observed in western blot. As the authors are not experts in GCase, only a brief overview of the protein’s function and its relevance in disease is provided. GCase experts are invited to analyze and interpret observed banding patterns in western blots and subcellular localization in immunofluorescence.

Thirdly, YCharOS experiments are not performed in replicates primarily due to the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line, confirms the lack of protein expression in the KO cell line and supports conclusions regarding the specificity of the other antibodies. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted following titration. Additionally, our independent data is performed subsequently to the antibody manufacturers internal validation process, therefore making our characterization process a repeat.

Lastly, as comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a single cell type for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results. Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations can impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines.

Method

The standardized protocols used to carry out this KO cell line-based antibody characterization platform was established and approved by a collaborative group of academics, industry researchers and antibody manufacturers. The detailed materials and step-by-step protocols used to characterize antibodies in western blot, immunoprecipitation and immunofluorescence are openly available on Protocols.io (protocols.io/view/a-consensus-platform-for-antibody-characterization ).3 Brief descriptions of the experimental setup used to carry out this study can be found below.

Cell lines and antibodies

The cell lines, primary and secondary antibodies used in this study are listed in Tables 1, 2, and 3, respectively. To ensure consistency with manufacturer recommendations and account for proprietary formulations (where antibody concentrations are not disclosed), antibody usage is reported as dilution ratios rather than absolute concentrations. To facilitate proper citation and unambiguous identification, all cell lines and antibodies are referenced with their corresponding Research Resource Identifiers (RRIDs).9,10 HAP1 KO clone corresponding to the GBA1 was generated with low passage cells at Horizon Discovery. Guide RNA (CCCATCCAGGCTAATCACAC) were used to induce a 23bp deletion in the exon 3 of GBA1 gene. All cell lines used in this study were regularly tested for mycoplasma contamination and were confirmed to be mycoplasma-free.

Antibody screening by western blot

HAP1 WT and GBA1 KO cells were collected in RIPA buffer (25mM Tris-HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) (Thermo Fisher Scientific, cat. number 89901) supplemented with 1x protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated 30 min on ice. Lysates were spun at ~110,000 x g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and western blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used.

Western blots were performed with precast midi 4-20% Tris-Glycine polyacrylamide gels (Thermo Fisher Scientific, cat. number WXP42012BOX) ran with Tris/Glycine/SDS buffer (Bio-Rad, cat. number 1610772), loaded in Laemmli loading sample buffer (Thermo Fisher Scientific, cat. number AAJ61337AD) and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual western blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated O/N at 4°C with 5% milk in TBS with 0,1% Tween 20 (TBST) (Cell Signalling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) Or Clarity Western ECL Substrate (Bio-Rad, cat. number 1705061) prior to detection with the iBright™ CL1500 Imaging System (Thermo Fisher Scientific, cat. number A44240).

Antibody screening by immunoprecipitation

Antibody-bead conjugates were prepared by adding 2 μg to 500 μl of Pierce IP Lysis Buffer from Thermo Fisher Scientific (cat. number 87788) in a microcentrifuge tube, together with 30 μl of Dynabeads protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) (Thermo Fisher Scientific, cat. number 10002D and 10004D, respectively). Anti-GCase MA5-52914** was at an unknown concentration and thus 10 μl were tested in IP. All tubes were rocked for ~1 h at 4°C followed by two washes to remove unbound antibodies. HAP1 WT were collected in Pierce IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) supplemented with protease inhibitor. Lysates were rocked 30 min at 4°C and spun at 110,000 x g for 15 min at 4°C. 0.5 ml aliquots at 1 mg/ml of lysate were incubated with an antibody-bead conjugate for ~1 h at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of IP buffer and processed for SDS-PAGE and western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels. Protein A:HRP was used as a secondary detection system at a concentration of 0.5 μg/ml.

Antibody screening by immunofluorescence

RPE-1 WT and GBA1 KO cells were labelled with a green and a far-red fluorescence dye, respectively (Thermo Fisher Scientific, cat. number C2925 and C34565). The nuclei were labelled with DAPI (Thermo Fisher Scientific, cat. Number D3571) fluorescent stain. WT and KO cells were plated on 96-well plate with optically clear flat-bottom (Perkin Elmer, cat. number 6055300) as a mosaic and incubated for 24 hrs in a cell culture incubator at 37oC, 5% CO2. Cells were fixed in 4% paraformaldehyde (PFA) (VWR, cat. number 100503-917) in phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL). Cells were permeabilized in PBS with 0,1% Triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary GCase antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/ml for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS.

Images were acquired on an ImageXpress micro confocal high-content microscopy system (Molecular Devices), using a 20x NA 0.95 water immersion objective and scientific CMOS cameras, equipped with 395, 475, 555 and 635 nm solid state LED lights (lumencor Aura III light engine) and bandpass filters to excite DAPI, Cellmask Green, Alexa-555 and Cellmask Red, respectively. Images had pixel sizes of 0.68 x 0.68 microns, and a z-interval of 4 microns. For analysis and visualization, shading correction (shade only) was carried out for all images. Then, maximum intensity projections were generated using 3 z-slices. Segmentation was carried out separately on maximum intensity projections of Cellmask channels using CellPose 1.0, and masks were used to generate outlines and for intensity quantification.11 Figures were assembled with Adobe Illustrator.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 15 Dec 2025
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Worrall D, Alende C, Fothouhi M et al. A guide to selecting high-performing antibodies for GCase (UniProt ID: P04062) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved]. F1000Research 2025, 14:1400 (https://doi.org/10.12688/f1000research.174230.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 15 Dec 2025
Views
0
Cite
Reviewer Report 13 Jan 2026
Karen Bowman, University of Leicester, Leicester, England, UK 
Approved
VIEWS 0
The study involved characterisation of twenty-four commercial antibodies, from several different companies, for the human glucocerebrosidase (GCase) protein for use in western blot, immunoprecipitation, and immunofluorescence. The study formed part of the wider YCharOS collaboration to characterise commercial antibodies for human ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Bowman K. Reviewer Report For: A guide to selecting high-performing antibodies for GCase (UniProt ID: P04062) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved]. F1000Research 2025, 14:1400 (https://doi.org/10.5256/f1000research.192114.r446553)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
1
Cite
Reviewer Report 10 Jan 2026
Deborah Moshinsky, Institute for Protein Innovation, Boston, Massachusetts, USA 
Approved
VIEWS 1
The authors tested 24 commercially available antibodies to GCase for their ability to bind to antigen in Western Blotting, Immunoprecipitation, and Immunofluorescence.  Cell lines expressing the target at high levels were used and comparisons were made to knockouts.  Renewable antibodies ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Moshinsky D. Reviewer Report For: A guide to selecting high-performing antibodies for GCase (UniProt ID: P04062) for use in western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: 2 approved]. F1000Research 2025, 14:1400 (https://doi.org/10.5256/f1000research.192114.r442397)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 15 Dec 2025
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.