<i>Escherichia coli</i> Infection Risk Following Sleeve Gastrectomy

Laheeb Rajab Hamad

doi:10.12688/f1000research.172843.1

Home Browse Escherichia coli Infection Risk Following Sleeve Gastrectomy

ALL Metrics

-

Views

-

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Escherichia coli Infection Risk Following Sleeve Gastrectomy

[version 1; peer review: 1 not approved]

Laheeb Rajab Hamad

PUBLISHED 28 Feb 2026

Author details Author details

Pathological Analysis, University Of Fallujah, Anbar, Fallujah, +964, Iraq

Laheeb Rajab Hamad
Roles: Data Curation

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Fallujah Multidisciplinary Science and Innovation gateway.

Abstract

Abstract*

Backgruond

Extremely obese patients can benefit greatly from sleeve gastrectomy, a very common and successful therapeutic procedure that is usually carried out via laparoscopy. A SG involves the excision of about eighty percent of the stomach. Beyond the possibility of significant weight loss, there are drawbacks to the SG procedure. A patient's may be susceptible to postoperative infection from gram-negative bacteria (E. coli).

Method

A study carried out at academic hospital center. It included 80 patients had sleeve gastrectomy for the study from ages above 25 year visiting the gastrointestinal tract hospital surgical unit between the first of Jan and the end of December 2024. It acquired data regarding the sociodemographic traits and the microbiological examinations conducted both prior to and following surgery, Qualitative data were presented as number and percentage, frequency distribution tables and All analyses were conducted at a significance value <.05.

Result

The majority of patients (81.3%) had no chronic illness, and the mean age of the participants was 45. Infection occurred in 17 cases (21.1%), leading to post-operative UTI and wound infection (64.7%, 35.3%). Compared to men, women are more prone to contract E. coli. E. coli was the most prevalent microbe (67%) that was isolated from patients, and fimH was the most virulent factor gene, followed by pap, Afa, and aer.

Conclusion

The results showed a percentage of (18.7%) of extraintestinal E. coli infection among patients with sleeve gastrectomy and most of cases were females (22.91%). E. coli showed high resistance towards amoxicillin, cefoxitin but sensitive to norfloxacin and ampicillin/sulbactam. The most virulence factor found from isolate was famH.

Keywords

Sleeve gastrectomy, GNB, Escherichia coli, virulent factor, and laprascopy

Corresponding author: Laheeb Rajab Hamad

Competing interests: No competing interests were disclosed.

Grant information: The author(s) declared that no grants were involved in supporting this work.

Copyright: © 2026 Rajab Hamad L. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions.

How to cite: Rajab Hamad L. Escherichia coli Infection Risk Following Sleeve Gastrectomy [version 1; peer review: 1 not approved]. F1000Research 2026, 15:330 (https://doi.org/10.12688/f1000research.172843.1) First published: 28 Feb 2026, 15:330 (https://doi.org/10.12688/f1000research.172843.1) Latest published: 28 Feb 2026, 15:330 (https://doi.org/10.12688/f1000research.172843.1)

Introduction

The term “obesity” refers to an excess or abnormal build-up of human body fat which can harm one's health. Because of the interaction of genes, lifestyle, environment and emotional factors, so its cause is multifactorial and complex.¹ When obesity is severe, sleeve gastrectomy is one of the methods used treatment choices of bariatric surgeon to perform with the most consistent results in excess weight loss, remission of comorbidities and improving life quality.^2,3 A common bariatric procedure is sleeve gastrectomy, which uses five or six upper abdomen ports to reshape the stomach into a narrow, tubular structure.⁴ In which two third of the stomach is resected.² Because laparoscopic sleeve gastrectomy reduces stomach capacity and modifies gastric motility and hormonal levels (namely ghrelin and peptide YY), it causes weight loss.^5,6 In which, 76 % of the excess weight lost during first 6 months, then 80% of excess weight lost after one year more weight lost around 84% of excess weight after 2 years with improved comorbidities, this was reported in studies of Durmush et al.⁷ With the minimally invasive endoscopic sleeve gastrectomy, the stomach is reduced in size and formed into a tube using an endoscope. This mechanism can lower calorie consumption and lead to weight loss. Benefits include fewer problems, reduce hospital stays, and quicker recovery than traditional bariatric surgery.^8–10 The Early complications of the surgery include bleeding, infections, pulmonary embolism (PE), anastomotic leaks, and gastrointestinal problems such as perforations or obstruction and to treat these, prompt medical attention and possibly surgery are essential.¹¹ Over time, improvements in infection control and medical knowledge have been extremely beneficial to the surgical field. but, wound site infections are still a persistent and worrisome problem in hospitals. The susceptibility of wound site infection is concerning because it is linked to the increased rates of nosocomial morbidity and mortality.¹² These infections can range in severity from appropriately minor surface incisional infections to more serious complications such as the development of deep organ space intra-abdominal abscesses and incisional hernias.^13–15 According to the study of Rawan Sh eldein et al., The gram-negative Escherichia coli bacteria is the highest prevalent microorganism that causes wound site infection in gastrointestinal tract procedure.^16,17 In this context, Escherichia coli, the highest prevalent gram-negative bacterium in the human intestinal tract, is not dangerous. On the other hand, when E.coli is found outside of the intestinal tract, it can cause pneumonia, bacteremia, peritonitis, UTIs, and other illnesses. UTIs, or urinary tract infections, are a frequent postoperative complication following sleeve gastrectomy.^18–20 As well, the bacteria affect over 40% of patients and accounts for a considerable amount of nosocomial infections.^4,21 All parts of the urinary tract, from the kidney to the urethra, can develop a urinary tract infection. Urinary catheters are commonly used to monitor output and aid in the drainage of urine following bariatric surgery. and consequence the urinary tract can become infected with nosocomial bacteria through catheters.²² More than ninety percent of cases are caused by the principal pathogenic agent, Escherichia coli (E. coli). Similarly, E.coli infections are responsible with around half of nosocomial catheter-associated UTIs (CAUTIs).^23–25 The goal of this research paper was to figure out the E.coli infection occurrence in sleeve gastrectomy and characterize the bacteriology, and risk factors linked to E.coli infection in patients having sleeve gastrectomy and the proper use of surgical antimicrobial prophylaxis in sleeve gastrectomy.

The goal of this research paper was to estimate the susceptibility of E. coli infection occurrence and characterize the bacteriology linked to E.coli infection in patients having sleeve gastrectomy and the proper use of surgical antimicrobial prophylaxis in sleeve gastrectomy.

Methods

A study conducted at academic hospital. we included 80 patients had sleeve gastrectomy for the study from age above 25 year, visiting the gastrointestinal tract hospital surgical unit between 1st Jan to the end of December 2024. We gathered information on the sociodemographic characteristics, and isolated microorganisms from patient’s specimen.

Sampling

Eighty sleeve gastrectomy patients made up the study population. Throughout thirty-day follow-up period, all patients were watched for indications of SSIs or UTIs. Samples of urine and swabs from the incisions of patients who might have had surgical site infections were collected after their procedures, Samples were sent right away for examination to the microbiological lab.²⁶

Data collection

Demographic information was gathered from the operating room’s electronic registration and used to identify the patients. Patients having abdominal surgeries other than sleeve gastrectomy, patients in the absence of 30-day follow-up data, patients whose findings (such as pneumonia, UTIs, etc.) were known at the time of surgery and patients whose data points for certain variables were missing also eliminated. The result obtained from participant patients had sleeve gastrectomy and followed up for presenting with wound infection or genitourinary symptoms and detection of gram-negative GNB using molecular and microbiological techniques. specimens are quickly transported to central laboratories. Urine, blood, and wound swab specimens from patients suspected and were collected using an aseptic technique and stored in sterile containers to prevent contamination by highly skilled nursing staff in order to determine the E.coli burden in the sleeve gastrectomy patient’s population. The samples were moved to the central laboratory's microbiology department in less than thirty minutes. In the meantime, an Excel document with the patient's age, gender, specimen type, and collection date were assembled from the hospital record room. In addition to collecting blood samples for tests (CBC, CRP, ESR, and FBS), other samples (urine and wound swap) were isolated, and the results of the cultures were ascertained. The isolates underwent disc-diffusion technique testing for antibiotic resistance and were sequenced to determine their type.

Hematological and serum analysis

Every blood sample was obtained using continuous flow testing (CBC) and tubes containing EDTA anticoagulant. examined with the Sysmex, XT-2000i automated hematological analysis system. The CBC test yielded values for leukocyte count (WBCs), hemoglobin level (Hb), red blood cells (RBCs), platelet count, MPV, and PDW PDW, MPV, and PLTs had normal ranges of 10–17%, 8.5–12.5 fl, and 150,000–400,000/ml, respectively. Additionally, blood samples were taken and tested for each participant for the CRP and glucose tests. concentrations were evaluated by standard kit (sigma Aldrich, 236603, G3660) respectively and performed according to manufacturer’s instruction. Further ESR test was done by the method described by.²⁷

GNB isolation an identification

Samples obtained from the subjects and cultured on MacConkey agar, 5% human blood agar, and lauryl sulfate-aniline blue agar medium. After 24 hours, the sample should be deemed sterile if there is no growth. The plates underwent incubation aerobically at 37 °C for one day before phenotypic characterization was performed. Following a purification of the isolates, a colony count of =104 CFU/mL was considered significant. The bacterial colonies were then identified by their morphological characteristics, microscopic appearance, and a battery of biochemical tests. analyses performed using the Vitek2 system (Biome ́rieux) and GN test cards, and the results were validated through API-20E tests. The manufacturer's instructions were followed for analysis and interpretation of the results.

Molecular method identification (PCR- reaction)

The kit manufacturer's instructions (Geneaid Biotech Ltd., New Taipei City, Taiwan) were followed for sequencing and DNA extraction. employed to further amplify the sample, and it was based on the findings of the biochemical test. Two primer sets were designed specifically for Gram-negative bacteria, and they were tested against reference strains and/or clinical isolates in a single PCR reaction before being tested in a multiplex configuration. Enterobacter sp. 27F/1492R 16S ribosomal RNA (16SrRNA) primer and P. aeruginosa comprised the second set, while E.coli, K. pneumoniae, and K. oxytoca comprised the first set.²⁸ The amplification reactions were conducted in a total reaction volume of 30 μl using the following protocol: primer annealing at 55 °C for 1 minute, the last step (extension) at 72 °C for 30 seconds, first denaturation at 94 °C for 5 minutes, and second denaturation at 94 °C for 30 seconds.

Gene amplification

Universal primers were used in order to amplify the GN isolate genes. 27F/1492R. which, in addition to the reference strains, Table 1, amplify roughly 1500 bp. The isolates recognized as E.coli are then seen under a UV light on a 1.5% agarose gel.

Table 1. Displays the primer sequences of targeted gene expression.

Bacteria & Gene	Primer name	Sequences (5′-3′)	Primer conc. (pmol/mL)	Reference
E. coli (uid A) gene	EC486-F EC486-R	ATCACCGTGGTGACGCTGTCGC CACCACGATGCCATGTTCATCT	0.4	This research
Enterobacter sp. (HSP60) gene	EP162 EP162	F-GCTCGTAGCCGCTAAACTGG R-CCTTCACCCGCTTTCACGTT	0.3	This research
P. aeruginosa (alg-D) gene	PsA98-R PsA98-R	-GGGGGATCTTGCGGACCTCA -TCCTTAGAGTGCCCACCCC	0.2	This research
K. pneumoniae (rpo-B) gene	KP548 KP548	F-CCAACGGTGTGGTTACTGACG R-AATAGGTTCGCCCAGGGACA	0.3	This research
A. baumannii (gyr-B) gene	AB605 AB605	F-TGGCTTACACGGCGTAGGT R-GCGCATCATCACCAGTCACAT	0.5	²⁸
16SrRNA	27 1492	F-AGAGTTTGATCMTGGCTCAG R-GGTTACCTTGTTACGACTT	0.5	This research

Antimicrobial resistance testing

The following antimicrobials, including ampicillin/clavulanic acid, ampicillin/sulbactam, trimethoprim/sulfamethoxazole, amoxicillin, ampicillin, amikacin, gentamicin, ofloxacin, nitrofurantoin, cefotetan, cefotaxime, cefoxitin, and cefiximewere examined using AST-N291 test cards to quantify the presence of (Extended-Spectrum Beta Lactamase). The strain of E. coli ATCC 25966 was utilized as a control. Finding each strain of E. coli's lowest inhibitory concentration required applying the agar dilution techniques advised by the Clinical and Laboratory Standards Institute (CLSI).

Virulence factor gene

PCR was employed to determine the main components of ExPEC's virulence. The genes selected as the most commonly occurring in extraintestinal E.coli infection Included in this were the following: fimbrial adhesin -1 (fimH), cytotoxic necrotizing factors (cnf 1 and cnf 2), aerobactin (iutA), P-fimbriae (papC and papG), S-fimbrial adhesin (sfaA and sfaS), and afimbrial adhesin (afa).²⁹

Statistical analysis

The Statistical Package for Social Science (SPSS) program, version 23, was used for data entry and analysis. Using the Excel program, graphics were produced. To display quantitative data, the mean (X) and standard deviation (SD) were utilized. The qualitative data was presented using numbers, percentages, and frequency distribution tables. When utilizing the chi square test of significance, a significant P value of less than 0.05 was selected for every meaningful test. The rate of patients who developed UTIs and surgical wound infection among all those admitted to the surgical centers was used to express the incidence rate. The ratio of isolates confirmed to be resistant to antibiotics to all isolates exposed to the antibiotic was used to express antibiotic resistance.

Results

Table 2 reveals that (60 %) of the participant patients are female of mean age 48. While the male participants percentage were 40% and mean age 42 with the mean body mass index (B.M.I.) of 46 and 52 for males and females respectively. Most of them has no chronic illness.

Table 2. The study population characteristics.

	Number of sleeve gastrostomies	Mean age (years)	Mean BMI^a
Total	80
Males	32 (40%)	42	46
Females	48 (60%)	48	52
Chronic illness	15 (18.7%)	48	52

a Body Mass Index.

Among those who were part of the study, the rate of infection occurence was 17 cases (21.2%), with 2 cases (6.25%) occurring in men and 15 cases (31.25%) in women. There was a significant (p = 0.001) difference in the incidence between the sexes, and 13 cases (86.6%) had chronic illnesses that were statistically significant (p = 0.011).

All sleeve gastrectomy patient that had UTI or SSI infection 17 case showed high level of ESR while 8 cases of sleeve gastrectomy with no infection shoed high level (68%) (32%). With significant value of p=<0.001. the count of wbcs and PLT showed high count in 16 cases of infected participant with significant value p=0.0062, 0.001 respectively. While hgb level showed no significant difference between participants (p= 0.245) as Table 3.

Table 3. Infected and non-infected sleeve gastrectomy participants' frequency distribution of blood parameters.

Variable	Level	SG with infection n = 17		SG without infection n = 63		p-value
		N	%	N	%
Hgb	<12	8	47	25	39.6	0.245
	12-14	9	52.9	38	60.3
	16	2	11.7	5	7.9
WBC	<4000	0	0	21	33.3	0.0062
WBC	9000-13000	16	94.1	54	85.7	0.0062
ESR	Negative	0	0	55	87.3	<0.001
ESR	Positive	17	100	8	12.6	<0.001
Plt (X103/μ L)	Normal	1	5.8	59	93.6	0.001
Plt (X103/μ L)	High level	16	94.1	4	6.3	0.001

Cause of infection related to GNB in sleeve gastrectomy

This study finds that: - Five genera of bacteria that are Gram-negative were isolated and identified. using molecular techniques from study participants who had SSI and UTI. Gram-negative bacteria accounted for 15 cases (18.7%); of these, 10 cases (66.6%) had E.coli as the primary cause of the infection, followed by K. pneumonia in 2 cases (13.37%), P. aeruginosa, Enterobacter sp., and A. baumannii in 1 case (6.66%) each Figure 1.

Figure 1. Rate of GNB infection in samples isolated from sleeve gastrectomy.

PCR detection of E.coli strain

When examined under a UV lamp, E. coli strains identified by the Vitek2 system displayed a 220/258 bp PCR product size on a 1.5% agarose gel ( Figure 2). PCR results of isolates recognized as E. coli observed under a UV lamp on a 1.5% agarose gel. E. coli (ATCC 25996) is the positive control, and Lane 1 represents it. Samples of bacteria are shown in Lanes 2 through 15, while the DNA ladder (sollis) is shown in Lane 14. In lanes 2 and 3, the bands at 220 and 258 bp were not visibleas ( Figure 2)

Figure 2. PCR results of isolates recognized as E. coli observed under a UV lamp on a 1.5% agarose gel.

.

Antimicrobial susceptibility of E.coli

The sleeve gastrectomy samples contained multiple antibiotic-resistant E. Coli strains, of which 14 (93.3%) were resistant to amoxicillin, 11 (73.3%) to ampicillin and cefotetan, 10 (66.6%) and 8 (53.3%) to ofloxacin; 5 (33.3%) to cefotaxime, cefoxitin, and ciprofloxacin; 2 (13.3%) to nitrofurantoin, and 4 (26.6) to trimethoprim/sulfamethoxazole. In the Table 4 reveals that E. coli isolate is highly resistant to amoxicillin (93.33%), cefoxitin and gentamicin (80%) followed by cefotetan and Amoxicillin/clavulanate (73.3%) (66.6) respectively. but were susceptible to Ampicillin/sulbactam and Norfloxacin. As Table 4.

Table 4. Antimicrobial resistance profile of E. coli bacteria in sleeve gastrectomy.

Antibiotic	Resistance % (no.=15)
	No.	%
Amoxicillin/clavulanate (25 mcg)	10	66.6
Amoxicillin (25 mcg)	14	93.33
Ampicillin (25 mcg)	7	46.6
Ampicillin/sulbactam (25 mcg)	0	0
Amikacin (30 mcg)	3	20
Cefotaxime (25 mcg)	8	53.3
Cefoxitin (30 mcg)	12	80
Cefotetan (30 mcg)	11	73.3
Gentamicin (10 mcg)	12	80
Ciprofloxacin (5 mcg)	5	33.3
ofloxacin (5 mcg)	8	53.3
Nitrofurantoin (100 mcg)	2	13.3
Trimethoprim/sulfamethoxazole (25 mcg)	4	26.6
Norfloxacin (5 mcg)	0	0

This study reveals that the most prominent genes >60% in 15 Escherichia coli isolates from infected wound and urine in sleeve gastrectomy patient are fimH, pap, aer and Afa (93%) (86.6) (80%) (60%) respectively ( Table 5).

Table 5. The frequency of virulence factors of 15 Escherichia coli isolates from urine and infected wounds in patients undergoing sleeve gastrectomy.

Virulence factors	Gene	No. (%)
Type 1 fimbriae	fimH	14 (93%)
P fimbriae	pap	13 (86.6%)
cytotoxic necrotizing factors	cnf	1 (6.67%)
aerobactin	aer	12 (80%)
S and FIC fimbriae	Sfa	8 (53.3%)
Afa adhesins	afa	9 (60%)
Haemolysin A	hlyA	7 (46.6%)

Discussion

The most effective course of treatment for treating comorbidities related to obesity and achieving weight loss for long period is sleeve gastrectomy surgery.³⁰ For obese patients with a BMI around 40 kg/m² and an obesity-related comorbidity, a sleeve gastrectomy is advised.³¹ One of the most prevalent complication is post operation infection with gram negative bacteria. most common UTI in hospitalized and ambulatory settings.³² Surgical wound infection accounts for 19.73% of all HAIs and is regarded as a global health care system issue.³³

This study focused in infection via extraintestinal E. coli bacteria and it accounts for 18.7% of 80 participant sleeve gastrectomy causing UTI and surgical wound infection (HAI). In which the latter is predominant cause of infection among infected participant (76.5%). the susceptibility to E. coli infection in this study was (16.25%) causing UTI and (1.25%) causing SSI, the risk of UTI increased after sleeve gastrectomy. There is no significant change in the risk of E. coli infection among men and female parallel to previous study of sattar et al.³⁴ The participant mean age 45 was and their mean BMI were 49. while the risk of infection significantly increases in the presence of chronic illness. Our research is the initial to show the susceptibility of E. coli infection in sleeve gastrectomy.

Leukocyte counts rising and ESRs increasing are typically associated with infections, such as SSIs and UTIs. Since variations in these parameters are used to diagnose inflammatory and infectious diseases.³⁵ Furthermore, platelets were mentioned as an indicator of an infection of the urinary tract.³⁶ Similar to the findings reported by,³⁷ This study demonstrated that SSIs and UTIs had noticeably higher levels of platelets and leucocytes. There was also a notable difference in MPV between the infected and non-infected groups. Timely therapeutic and preventive interventions aimed at surgical wound infections and UTIs are contingent upon early detection.³⁸ In this study, GNB were isolated and identified using Vitek2, and they were subsequently further detected using a molecular technique called PCR amplification reaction, with the positive control being E. coli (ATCC 25966). According to the results, 76% of the isolates had E.coli. while 13% contained K. pneumonia. This study bears similarities to that of Helemen et al.²¹ and differs from the study by Kaman and Bahrouz,³⁹ which revealed that; K. pneumonia was the most prevalent gram-negative infection. There are many possible explanations for the reported differences in the distribution of SSI and UTI bacteria; these include differences in the population under study (e.g., sex, age, comorbidities, nosocomial pathogens found in surgery centers, aseptic techniques), policies for infection control and prevention, geographical distribution, and patterns of resistance in the bacterial isolates under study.^40,41

The best antimicrobial agents were found to be ampicillin/clavulnic acid and norfloxacin, while levels of amoxicillin/clavunic acid resistance were found to be consistent with findings from a prior study of Aabed, Kawthar et al.⁴² who found that amoxicillin possessed the highest resistance. high rates of incorrect prescription of cefoxitin or amoxicillin for surgical antimicrobial prophylaxis and extended spectrum beta-lactamase generation in these strains⁴³ could be a reasonable explanation for the high levels of resistance.

They are the result of various genes, which the PCR technology may identify.⁴⁴ Fimbria-1 (fimH), P fimbria (papC and papG), binding adhesin (afa), and S fimbria (sfaA and sfaS) were among the adhesin-related genes investigated in this work study. fimH was the most common (93%) followed by pap (86%). Through its role in inducing adherence to uroepithelial protein, FimH is an essential component of uropathogenic E. coli strains' pathogenicity.⁴⁵ And this is parallel to the study of Daga et al.²⁹ Then followed by aer gene with percentage of (80%) and hyla gene (46.6%), The results showed a percentage of (18.7%) of extraintestinal E.coli infection among patients with sleeve gastrectomy and most of cases were females (31.25%). Only a few percentages of E.coli virulence genes cause urinary tract infections; the bacteria E. coli strains frequently contain the cvaC and hlyA genes [49].

Ethical considerations

Ethical approval was obtained from the University of Fallujah, Institutional Review Committe (IRC), (Code No.: UOF.MED.2025.001 16/11/2025). Prior to sample collection, written informed consent was obtained from each participant after they were informed of the study objectives. Prior to sample collection, written informed consent was obtained from each participant after they were informed of the study objectives.

Data availability

A study acquired data regarding the sociodemographic traits and the microbiological examinations conducted both prior to and following surgery, Due to ethical restrictions regarding the confidentiality of participants, as stipulated by the Ethics Committee at the University of Fallujah, preliminary data at the participant level is not publicly available. The study received Institutional Review Board (IRB) approval, subject to data access being restricted to qualified researchers for approved scientific and ethical purposes. Data access requests may be submitted to the author-in-chief and are subject to approval by the Ethics Committee. Data will be shared anonymously and in accordance with a Data Use Agreement.

Acknowledgements

I would like to thank the surgeons at Ramadi and Fallujah hospitals for their support and assistance in preparing this study.

References

1. Fandiño J, Benchimol AK, Coutinho WF, et al.: Cirurgia Bariátrica Aspectos Clínico-Cirúrgicos E Psiquiátricos. Rev. Psiquiatr. 2004; 26(1): 47–51.
2. Wagner NRF, Zaparolli MR, Cruz MRR, et al.: Postoperative Changes In Intestinal Microbiota And Use Of Probiotics In Roux-En-Y Gastric Bypass And Sleeve Vertical Gastrectomy: An Integrative Review. Arq. Bras. Cir. Dig. 2018 Dec 6; 31(4): E1400. PubMed Abstract | Publisher Full Text | Free Full Text
3. Associação Brasileira Para O Estudo Da Obesidade E Da Síndrome Metabólica: Diretrizes Brasileiras De Obesidade 2016. São Paulo (Brasil): 4ª ed2016. Reference Source
4. Aderinto N, Olatunji G, Kokori E, et al.: Recent Advances In Bariatric Surgery: A Narrative Review Of Weight Loss Procedures. Annals Of Medicine & Surgery. December 2023; 85(12): 6091–6104. PubMed Abstract | Publisher Full Text | Free Full Text
5. Ariyasu H, Takaya K, Tagami T, et al.: Stomach Is A Major Source Of Circulating Ghrelin, And Feeding State Determines Plasma Ghrelin-Like Immunoreactivity Levels In Humans. J. Clin. Endocrinol. Metab. 2001; 86: 4753–4758. PubMed Abstract
6. Sudan R, Jacobs DO: Biliopancreatic Diversion With Duodenal Switch. Surg. Clin. North Am. 2011; 91: 1281–1293.
7. Durmush EK, Ermerak G, Durmush D: Short-Term Outcomes Of Sleeve Gastrectomy For Morbid Obesity: Does Staple Line Reinforcement Matter?. Obes. Surg. 2014; 24: 1109–1116. PubMed Abstract | Publisher Full Text
8. Nduma BN, Mofor KA, Tatang JT, et al.: Endoscopic Gastric Sleeve: A Review Of Literature. Cureus. 2023; 15: E36353. Publisher Full Text
9. Advantages Of Endoscopic Sleeve Gastroplasty (Esg) Compared To Laparoscopic Sleeve Gastrectomy (Lsg): Doctor Marvin - Endoscopic Sleeve Gastroplasty (Esg). Accessed 10 July 2023. Reference Source
10. Silva AF, Mendes KD, Ribeiro VD, et al.: Risk Factors For The Development Of Surgical Site Infection In Bariatric Surgery: An Integrative Review Of Literature. Rev. Lat. Am. Enfermagem. 2023; 31: E3798. Publisher Full Text
11. Ferraz ÁA, Vasconcelos CF, Santa-Cruz F, et al.: Surgical Site Infection In Bariatric Surgery: Results Of A Care Bundle. Rev. Col. Bras. Cir. 2019; 46: E2252.
12. Chopra T, Marchaim D, Lynch Y, et al.: Epidemiology And Outcomes Associated With Surgical Site Infection Following Bariatric Surgery. Am. J. Infect. Control. 2012; 40: 815–819. PubMed Abstract | Publisher Full Text
13. Christou NV, Jarand J, Sylvestre JL, et al.: Analysis Of The Incidence And Risk Factors For Wound Infections In Open Bariatric Surgery. Obes. Surg. 2004; 14: 16–22. PubMed Abstract
14. Norman G, Atkinson RA, Smith TA, et al.: Intracavity Lavage And Wound Irrigation For Prevention Of Surgical Site Infection. Cochrane Database Syst. Rev. 2017; 2017: Cd012234. Publisher Full Text
15. Hassan RSEE, Osman SOS, Aabdeen MAS, et al.: Incidence And Root Causes Of Surgical Site Infections After Gastrointestinal Surgery At A Public Teaching Hospital In Sudan. Patient Saf. Surg. 2020; 14: 45. PubMed Abstract | Publisher Full Text | Free Full Text
16. Mylotte JM, Tayara A, Goodnough S: Epidemiology Of Bloodstream Infection In Nursing Home Residents: Evaluation In A Large Cohort From Multiple Homes. Clin. Infect. Dis. 2002 Dec 15; 35(12): 1484–1490. PubMed Abstract | Publisher Full Text
17. Mccue JD: Gram-Negative Bacillary Bacteremia In The Elderly: Incidence, Ecology, Etiology, And Mortality. J. Am. Geriatr. Soc. 1987 Mar; 35(3): 213–218. PubMed Abstract | Publisher Full Text
18. Jain S, Self WH, Wunderink RG, et al.: Cdc Epic Study Team. Community-Acquired Pneumonia Requiring Hospitalization Among U.S.Adults. N. Engl. J. Med. 2015 Jul 30; 373(5): 415–427. PubMed Abstract | Publisher Full Text | Free Full Text
19. Foxman B: Urinary Tract Infection Syndromes: Occurrence, Recurrence, Bacteriology, Risk Factors, And Disease Burden. Infect. Dis. Clin. N. Am. 2014; 28: 1–3. PubMed Abstract | Publisher Full Text
20. Helmen ZM, Helm MC, Helm JH, et al.: Predictors Of Postoperative Urinary Tract Infection After Bariatric Surgery. Obes. Surg. 2018; 28: 1950–1954. PubMed Abstract | Publisher Full Text
21. Jacobsen SÁ, Stickler DJ, Mobley HL, et al.: Complicated Catheter-Associated Urinary Tract Infections Due To Escherichia Coli And Proteus Mirabilis. Clin. Microbiol. 2008; 21: 26–59.
22. Alvarez AP, Demzik AL, Alvi HM, et al.: Risk Factors For Postoperative Urinary Tract Infections In Patients Undergoing Total Joint Arthroplasty. Adv. Orthop. 2016; 2016: 7268985.
23. Mitchell BG, Ferguson JK, Anderson M, et al.: Length Of Stay And Mortality Associated With Healthcare-Associated Urinary Tract Infections: A Multi-State Model. J. Hosp. Infect. 2016; 93: 92–99. PubMed Abstract | Publisher Full Text
24. Narang V, Grover S, Kang A, et al.: Comparative Analysis Of Erythrocyte Sedimentation Rate Measured By Automated And Manual Methods In Anaemic Patients. J. Lab. Physicians. 2020 Dec; 12(4): 239–243. PubMed Abstract | Publisher Full Text
25. Elmer WK, Stephen DA, William MJ, et al.: A Color Atlas And Text Book Of Diagnostic Microbiology.1997.
26. Clermont O, Christenson JK, Denamur E, et al.: The Clermont Escherichia Coli Phylo-Typing Method Revisited: Improvement Of Specificity And Detection Of New Phylo-Groups. Environ. Microbiol. Rep. 2013; 5: 58–65. PubMed Abstract | Publisher Full Text
27. Stackebrandt DLE, Goodfellow M: 16s/23s Rrna Sequencing. Nucleic Acid Techniques In Bacterial Systematics. New York, NY: John Wiley And Sons; 1991.
28. Daga AP, Koga VL, Soncini JGM, et al.: Escherichia Coli Bloodstream Infections In Patients At A University Hospital: Virulence Factors And Clinical Characteristics. Front. Cell. Infect. Microbiol. 2019 Jun 6; 9: 191. PubMed Abstract | Publisher Full Text | Free Full Text
29. Courcoulas AP, Gallagher JW, Neiberg RH, et al.: Bariatric Surgery Vs Lifestyle Intervention For Diabetes Treatment: 5-Year Outcomes From A Randomized Trial. J. Clin. Endocrinol. Metab. 2020; 105. Publisher Full Text
30. Fried M, Yumuk V, Oppert JM, et al.: Interdisciplinary European Guidelines On Metabolic And Bariatric Surgery. Obes. Surg. 2014; 24: 42–55. [32. Srinivasan U, Foxman B, Marrs Cf. Identification Of A Gene Encoding Heat Resistant Agglutinin In Escherichia Coli As A Putative Virulence Factor In Urinary Tract Infection. J Clin Microbiol 2003; 41:285–9. PubMed Abstract | Publisher Full Text
31. Colás-Ruiz E, Del-Moral-Luque JA, Gil-Yonte P, et al.: Incidence Of Surgical Site Infection And Risk Factors In Rectal Surgery: A Prospective Cohort Study. Cir. Esp. 2018; 96(10): 640–647. PubMed Abstract | Publisher Full Text
32. Sattar F, Sattar Z, Zaman M, et al.: Frequency Of Post-Operative Surgical Site Infections In A Tertiary Care Hospital In Abbottabad, Pakistan. Cureus. 2019; 11(3). Publisher Full Text
33. Lee IR, Shin JI, Park Sj OH, et al.: Mean Platelet Volume In Young Children With Urinary Tract Infection. Sci. Rep. 2015; 5: 18072–18074.
34. Zayed KMS, Abdelhakeem AM, Gafarhs ET: Diagnostic Of Plateletparameters Versus Interleukin-6 In Children With Urinary Tract Infection. Egypt Paediatrassoc Gaz. 2016; 64: 142148.
35. Catal F, Bavbek N, Bayrak O, et al.: Platelet Parameters In Children With Upper Urinary Tract Infection: Is There A Specific Response?. Ren. Fail. 2008; 30(4): 377–381. PubMed Abstract | Publisher Full Text
36. Hou TY, Gan HQ, Zhou JF, et al.: Incidence Of And Risk Factors For Surgical Site Infection After Colorectal Surgery: A Multiple-Center Prospective Study Of 3,663 Consecutive Patients In China. Int. J. Infect. Dis. 2020; 96: 676–681. PubMed Abstract | Publisher Full Text
37. Ali KM, Al-Jaff BMA: Source And Antibiotic Susceptibility Of Gram-Negative Bacteria Causing Superficial Incisional Surgical Site Infections. International Journal Of Surgery Open. 2021; Volume 30: 100318. 2405-8572. Publisher Full Text
38. Mukagendaneza MJ, Munyaneza E, Muhawenayo E, et al.: Incidence, Root Causes, And Outcomes Of Surgical Site Infections In A Tertiary Care Hospital In Rwanda: A Prospective Observational Cohort Study. Patient Saf. Surg. 2019; 13: 1–8.
39. Hope D, Ampaire L, Oyet C, et al.: Antimicrobial Resistance In Pathogenic Aerobic Bacteria Causing Surgical Site Infections In Mbarara Regional Referral Hospital, Southwestern Uganda. Sci. Rep. 2019; 9(1): 17299. PubMed Abstract | Publisher Full Text
40. Aabed K, Moubayed N, Motlak A, et al.: A Comparison Of Human Gut Microbiota And Analysis Of Antimicrobial Resistance Of E. Coli Isolates In Saudi Adults Undergoing Bariatric Surgery. Biomedica. 2020; 36(2).
41. Manyahi J: Bacteriological Spectrum Of Post-Operative Wound Infections And Their Antibiogram In A Tertiary Hospital, Dar Es Salaam, Tanzania. Muhimbili University Of Health And Allied Sciences); 2012. (Doctoral Dissertation).
42. Licznar P, Eychenne I, Aze´Ma C, et al.: Revised Prevalence Of Afa+ Escherichia Coli Strains In Acute Pyelonephritis Of Children. Pathol Biol (Paris). 2003; 51: 512–515. PubMed Abstract
43. Dale AP, Woodford N: Extra-Intestinal Pathogenic Escherichia Coli (Expec): Disease, Carriage And Clones. J. Infect. 2015; 71: 615–626. PubMed Abstract | Publisher Full Text
44. Al-Sudani SFK, Hamad LR, Ali FA: Diagnosis And Detection Of Vick Gene In Streptococcus Mutans Isolated From The Saliva Of Patients With Diabetic Type 2 With Tooth Decay In The Iraqi Population. Cell. Mol. Biol. 2021; 67(4): 222–231.
45. Koga VL, Tomazetto G, Cyoia PS, et al.: Molecular Screening Of Virulence Genes In Extraintestinal Pathogenic Escherichia Coli Isolated From Human Blood Culture In Brazil. Biomed. Res. Int. 2014; 2014: 465054. PubMed Abstract | Publisher Full Text | Free Full Text

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 28 Feb 2026

Author details Author details

Pathological Analysis, University Of Fallujah, Anbar, Fallujah, +964, Iraq

Laheeb Rajab Hamad
Roles: Data Curation

Competing interests

No competing interests were disclosed.

Grant information

The author(s) declared that no grants were involved in supporting this work.

Article Versions (1)

version 1

Published: 28 Feb 2026, 15:330

https://doi.org/10.12688/f1000research.172843.1

Copyright

© 2026 Rajab Hamad L. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

0

SEE MORE DETAILS

CITE

how to cite this article

Rajab Hamad L. Escherichia coli Infection Risk Following Sleeve Gastrectomy [version 1; peer review: 1 not approved]. F1000Research 2026, 15:330 (https://doi.org/10.12688/f1000research.172843.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 28 Feb 2026

Views

9

Reviewer Report 06 Apr 2026

Mohamed Hany, Alexandria University, Alexandria, Egypt

Not Approved

https://doi.org/10.5256/f1000research.190603.r465331

This manuscript examines postoperative Escherichia coli infection following sleeve gastrectomy in 80 patients, aiming to estimate infection prevalence, characterize bacterial isolates and resistance patterns, identify virulence genes, and explore risk factors. The topic is relevant, especially locally. The authors report ... Continue reading

This manuscript examines postoperative Escherichia coli infection following sleeve gastrectomy in 80 patients, aiming to estimate infection prevalence, characterize bacterial isolates and resistance patterns, identify virulence genes, and explore risk factors. The topic is relevant, especially locally. The authors report a 21.2% infection rate, 18.7% Gram-negative organisms, E. coli as the most common isolate, high fimH prevalence, and antibiotic resistance. However, unresolved ethical issues, inconsistencies, unreliable citations, incomplete methods, and language problems weaken the manuscript. Currently, the findings are not sufficiently reliable for indexing.
Review points to the authors

The results section contains too many contradictions to be treated as trustworthy in its current state. The uploaded review already identifies several concrete discrepancies: the abstract gives an infection rate of 21.1%, whereas the results section gives 21.2% for 17/80, the abstract reports E. coli prevalence as 67%, whereas the results use 66.6%, and the conclusion gives a female infection rate of 22.91% while the results reportedly indicate 31.25% based on 15/48. On their own, minor rounding differences can happen, but here the inconsistencies are not limited to rounding; they extend to denominators, proportions, and interpretive statements. This pattern suggests that the manuscript was not thoroughly cross-checked before submission.
The discrepancy in female infection risk is particularly serious because it changes the clinical interpretation. If the manuscript reports 15 infected women out of 48 female patients, that corresponds to 31.25%, not 22.91%. A value of 22.91% would require a different denominator or numerator, neither of which is explained. This means the conclusion is either based on an incorrect calculation or on a different dataset from the one shown in the results. Authors cannot claim sex-associated risk while simultaneously presenting incompatible percentages for the same comparison.
The manuscript also appears to contradict itself about statistical significance. The discussion states that there was “no significant change in the risk of E. coli infection among men and females,” whereas the results reportedly give p = 0.001 for sex-based difference. These two statements cannot both be true. This is more serious than a wording issue because it means the discussion either misreads the results or attempts to reinterpret them without justification. When a discussion reverses the statistical conclusion reported in the results, confidence in the whole analytical section is substantially reduced.
Table 3 raises additional concerns because the hemoglobin-category percentages for the infected group sum to 111.6%. That is mathematically impossible unless categories overlap, percentages were copied incorrectly, or the denominator changed across rows. None of those possibilities is explained. A table with percentages exceeding 100% is a strong indicator of either data-entry error or poor table construction, and it should prompt a full re-audit of the dataset rather than a superficial correction.
The antimicrobial susceptibility results are also inconsistent throughout the manuscript. The text reports cefoxitin resistance as 33.3%, whereas Table 4 shows 80%. It also notes additional contradictions in the text regarding the counts and percentages resistant to amoxicillin, ampicillin, cefotetan, and ofloxacin. These are not trivial inconsistencies, as resistance proportions are central to the paper's microbiological message. A cefoxitin resistance rate of 33.3% versus 80% suggests markedly different implications for the burden of resistant E. coli and the potential relevance of beta-lactam resistance mechanisms.
Another important numerical inconsistency concerns the number of E. coli cases versus the number of E. coli isolates analyzed for virulence genes. The uploaded report states that the results describe 10 E. coli cases out of 15 Gram-negative infections, yet Table 5 reports virulence data for 15 Escherichia coli isolates. This discrepancy is not explained. If multiple isolates came from individual patients, this must be clearly stated, and the statistical analysis should account for non-independence. If not, then one of the numbers is wrong.
The citation problems are extensive and materially affect the manuscript's scientific credibility. The manuscript identifies direct mismatches between in-text citations and bibliography entries, including the misnaming of “Helemen et al.” where the bibliography instead points to Jacobsen et al., “sattar et al.” where the listed citation is Zayed et al., “Aabed, Kawthar et al.” where the bibliography instead points to Licznar et al., and even a phantom Ref [49] despite the bibliography containing only 45 references.
Several citations are not merely mismatched but scientifically irrelevant to the statements they are used to support. The manuscript correctly notes that Jain et al. is a New England Journal of Medicine paper on community-acquired pneumonia requiring hospitalization among U.S. adults, not a paper on postoperative UTI, E. coli, or bariatric surgery; its PMID is 26172429. Likewise, Jacobsen et al. is a review of catheter-associated UTI due to E. coli and Proteus mirabilis with PMID 18202436; even if it were cited correctly, it is not interchangeable with bariatric postoperative-infection literature. Courcoulas et al. is a diabetes-treatment trial comparing bariatric surgery and lifestyle intervention, not a virulence-factor methods paper; its PMID is 31917447. Using these papers in the wrong contexts gives the appearance of literature support where none actually exists.
The citation problem is exacerbated by evidence of corruption in the bibliography. The manuscript notes the use of a commercial website citation (“Doctor Marvin”) instead of a peer-reviewed scientific source and also describes a merged reference in which Fried et al. appears concatenated with a separate Srinivasan citation. That kind of reference-list corruption raises concern that the bibliography may have been assembled carelessly or with broken reference-management output. Once the reference architecture becomes unreliable, the manuscript’s claims become much harder to verify independently.
The novelty claim is overstated and should be substantially moderated. The manuscript notes that postoperative infections after bariatric surgery are well established and that several published studies have addressed postoperative UTIs, SSIs, or pathogen profiles in bariatric settings. For example, Helmen et al. studied postoperative UTI after bariatric surgery (PMID: 29318506), Chopra et al. studied SSI epidemiology after bariatric surgery (PMID: 22325729), Goto et al. studied infectious-disease risk after bariatric surgery (PMID: 28637274), Ruiz-Tovar et al. examined SSI risk after laparoscopic sleeve gastrectomy (PMID: 23718274), and Althuwaini et al. reported microbiologic findings in post-LSG leakage (PMID: 30091102). Daga et al. provide virulence-factor characterization in bloodstream E. coli isolates rather than bariatric postoperative infection (PMID: 31245301), and Sora et al. emphasize the broader ExPEC framework, including virulence and resistance biology (PMID: 34832511). Against that background, the present paper may have local descriptive value, but it does not convincingly establish a robust or methodologically secure advance.
The manuscript notes that the PCR protocol does not specify the number of cycles; primer sequences are attributed to “This research” without validation details; the susceptibility workflow is unclear regarding Vitek2 versus agar dilution; and the CLSI edition is not stated. These are not mere technical omissions. In a microbiology-focused paper, reproducibility depends on precisely these details. The reported PCR product size discrepancy and the unexplained isolate counts further weaken confidence that the laboratory methods were adequately documented.
The language problems go beyond ordinary copyediting and frequently interfere with scientific meaning. The manuscript already provides several examples, and I agree that they should be addressed line by line rather than with generic “language polishing.” For example, “Because of the interaction of genes,lifestyle, environment and emotional factors, so its cause is multifactorial and complex” should become “Obesity is a multifactorial and complex condition resulting from interactions among genetic, lifestyle, environmental, and psychological factors.” Likewise, “A patient’s may be susceptible to postoperative infection from gram-negative bacteria (E. coli)” is grammatically incorrect and should read “Patients may be susceptible to postoperative infections caused by Gram-negative bacteria, particularly Escherichia coli.”
Terminology also needs correction. The phrase “susceptibility of E. coli infection” is scientifically imprecise because “susceptibility” could refer either to patient susceptibility to infection or antimicrobial susceptibility of bacterial isolates. Those are entirely different concepts. The authors should specify whether they mean “risk of postoperative E. coli infection,” “incidence of postoperative E. coli infection,” or “antimicrobial susceptibility profile of E. coli isolates.” Similarly, “sleeve gastrostomies” is anatomically incorrect in this context and must be “sleeve gastrectomies”; “famH” should be fimH; and “ampicillin/clavulnic acid” or “amoxicillin/clavunic acid” should be corrected to “ampicillin/clavulanic acid” and “amoxicillin/clavulanic acid.” These errors suggest that the manuscript has not undergone adequate subject-specific proofreading.
There are also recurring problems with scientific style and nomenclature. Species names should be italicized throughout, “Gram-negative” should be capitalized and hyphenated consistently, abbreviations such as GNB should be defined at first use, and colloquial phrases such as “to figure out” should be replaced with standard academic verbs such as “to determine” or “to investigate.” The phrase “Our research is the initial to show…” is not acceptable scientific English; a more defensible formulation would be “To our knowledge, this study is among the first from Iraq to characterize…”

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

No
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Bariatric surgeon

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 28 Feb 2026

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1
Version 1 28 Feb 26	read

Mohamed Hany, Alexandria University, Alexandria, Egypt

Comments on this article

All Comments(0)

Add a comment

Sign up for content alerts

Browse by related subjects

Back to all reports

Reviewer Report

9 Views

06 Apr 2026 | for Version 1

Mohamed Hany, Alexandria University, Alexandria, Egypt

9 Views Cite this report Responses(0)

Not Approved

This manuscript examines postoperative Escherichia coli infection following sleeve gastrectomy in 80 patients, aiming to estimate infection prevalence, characterize bacterial isolates and resistance patterns, identify virulence genes, and explore risk factors. The topic is relevant, especially locally. The authors report a 21.2% infection rate, 18.7% Gram-negative organisms, E. coli as the most common isolate, high fimH prevalence, and antibiotic resistance. However, unresolved ethical issues, inconsistencies, unreliable citations, incomplete methods, and language problems weaken the manuscript. Currently, the findings are not sufficiently reliable for indexing.
Review points to the authors

The results section contains too many contradictions to be treated as trustworthy in its current state. The uploaded review already identifies several concrete discrepancies: the abstract gives an infection rate of 21.1%, whereas the results section gives 21.2% for 17/80, the abstract reports E. coli prevalence as 67%, whereas the results use 66.6%, and the conclusion gives a female infection rate of 22.91% while the results reportedly indicate 31.25% based on 15/48. On their own, minor rounding differences can happen, but here the inconsistencies are not limited to rounding; they extend to denominators, proportions, and interpretive statements. This pattern suggests that the manuscript was not thoroughly cross-checked before submission.
The discrepancy in female infection risk is particularly serious because it changes the clinical interpretation. If the manuscript reports 15 infected women out of 48 female patients, that corresponds to 31.25%, not 22.91%. A value of 22.91% would require a different denominator or numerator, neither of which is explained. This means the conclusion is either based on an incorrect calculation or on a different dataset from the one shown in the results. Authors cannot claim sex-associated risk while simultaneously presenting incompatible percentages for the same comparison.
The manuscript also appears to contradict itself about statistical significance. The discussion states that there was “no significant change in the risk of E. coli infection among men and females,” whereas the results reportedly give p = 0.001 for sex-based difference. These two statements cannot both be true. This is more serious than a wording issue because it means the discussion either misreads the results or attempts to reinterpret them without justification. When a discussion reverses the statistical conclusion reported in the results, confidence in the whole analytical section is substantially reduced.
Table 3 raises additional concerns because the hemoglobin-category percentages for the infected group sum to 111.6%. That is mathematically impossible unless categories overlap, percentages were copied incorrectly, or the denominator changed across rows. None of those possibilities is explained. A table with percentages exceeding 100% is a strong indicator of either data-entry error or poor table construction, and it should prompt a full re-audit of the dataset rather than a superficial correction.
The antimicrobial susceptibility results are also inconsistent throughout the manuscript. The text reports cefoxitin resistance as 33.3%, whereas Table 4 shows 80%. It also notes additional contradictions in the text regarding the counts and percentages resistant to amoxicillin, ampicillin, cefotetan, and ofloxacin. These are not trivial inconsistencies, as resistance proportions are central to the paper's microbiological message. A cefoxitin resistance rate of 33.3% versus 80% suggests markedly different implications for the burden of resistant E. coli and the potential relevance of beta-lactam resistance mechanisms.
Another important numerical inconsistency concerns the number of E. coli cases versus the number of E. coli isolates analyzed for virulence genes. The uploaded report states that the results describe 10 E. coli cases out of 15 Gram-negative infections, yet Table 5 reports virulence data for 15 Escherichia coli isolates. This discrepancy is not explained. If multiple isolates came from individual patients, this must be clearly stated, and the statistical analysis should account for non-independence. If not, then one of the numbers is wrong.
The citation problems are extensive and materially affect the manuscript's scientific credibility. The manuscript identifies direct mismatches between in-text citations and bibliography entries, including the misnaming of “Helemen et al.” where the bibliography instead points to Jacobsen et al., “sattar et al.” where the listed citation is Zayed et al., “Aabed, Kawthar et al.” where the bibliography instead points to Licznar et al., and even a phantom Ref [49] despite the bibliography containing only 45 references.
Several citations are not merely mismatched but scientifically irrelevant to the statements they are used to support. The manuscript correctly notes that Jain et al. is a New England Journal of Medicine paper on community-acquired pneumonia requiring hospitalization among U.S. adults, not a paper on postoperative UTI, E. coli, or bariatric surgery; its PMID is 26172429. Likewise, Jacobsen et al. is a review of catheter-associated UTI due to E. coli and Proteus mirabilis with PMID 18202436; even if it were cited correctly, it is not interchangeable with bariatric postoperative-infection literature. Courcoulas et al. is a diabetes-treatment trial comparing bariatric surgery and lifestyle intervention, not a virulence-factor methods paper; its PMID is 31917447. Using these papers in the wrong contexts gives the appearance of literature support where none actually exists.
The citation problem is exacerbated by evidence of corruption in the bibliography. The manuscript notes the use of a commercial website citation (“Doctor Marvin”) instead of a peer-reviewed scientific source and also describes a merged reference in which Fried et al. appears concatenated with a separate Srinivasan citation. That kind of reference-list corruption raises concern that the bibliography may have been assembled carelessly or with broken reference-management output. Once the reference architecture becomes unreliable, the manuscript’s claims become much harder to verify independently.
The novelty claim is overstated and should be substantially moderated. The manuscript notes that postoperative infections after bariatric surgery are well established and that several published studies have addressed postoperative UTIs, SSIs, or pathogen profiles in bariatric settings. For example, Helmen et al. studied postoperative UTI after bariatric surgery (PMID: 29318506), Chopra et al. studied SSI epidemiology after bariatric surgery (PMID: 22325729), Goto et al. studied infectious-disease risk after bariatric surgery (PMID: 28637274), Ruiz-Tovar et al. examined SSI risk after laparoscopic sleeve gastrectomy (PMID: 23718274), and Althuwaini et al. reported microbiologic findings in post-LSG leakage (PMID: 30091102). Daga et al. provide virulence-factor characterization in bloodstream E. coli isolates rather than bariatric postoperative infection (PMID: 31245301), and Sora et al. emphasize the broader ExPEC framework, including virulence and resistance biology (PMID: 34832511). Against that background, the present paper may have local descriptive value, but it does not convincingly establish a robust or methodologically secure advance.
The manuscript notes that the PCR protocol does not specify the number of cycles; primer sequences are attributed to “This research” without validation details; the susceptibility workflow is unclear regarding Vitek2 versus agar dilution; and the CLSI edition is not stated. These are not mere technical omissions. In a microbiology-focused paper, reproducibility depends on precisely these details. The reported PCR product size discrepancy and the unexplained isolate counts further weaken confidence that the laboratory methods were adequately documented.
The language problems go beyond ordinary copyediting and frequently interfere with scientific meaning. The manuscript already provides several examples, and I agree that they should be addressed line by line rather than with generic “language polishing.” For example, “Because of the interaction of genes,lifestyle, environment and emotional factors, so its cause is multifactorial and complex” should become “Obesity is a multifactorial and complex condition resulting from interactions among genetic, lifestyle, environmental, and psychological factors.” Likewise, “A patient’s may be susceptible to postoperative infection from gram-negative bacteria (E. coli)” is grammatically incorrect and should read “Patients may be susceptible to postoperative infections caused by Gram-negative bacteria, particularly Escherichia coli.”
Terminology also needs correction. The phrase “susceptibility of E. coli infection” is scientifically imprecise because “susceptibility” could refer either to patient susceptibility to infection or antimicrobial susceptibility of bacterial isolates. Those are entirely different concepts. The authors should specify whether they mean “risk of postoperative E. coli infection,” “incidence of postoperative E. coli infection,” or “antimicrobial susceptibility profile of E. coli isolates.” Similarly, “sleeve gastrostomies” is anatomically incorrect in this context and must be “sleeve gastrectomies”; “famH” should be fimH; and “ampicillin/clavulnic acid” or “amoxicillin/clavunic acid” should be corrected to “ampicillin/clavulanic acid” and “amoxicillin/clavulanic acid.” These errors suggest that the manuscript has not undergone adequate subject-specific proofreading.
There are also recurring problems with scientific style and nomenclature. Species names should be italicized throughout, “Gram-negative” should be capitalized and hyphenated consistently, abbreviations such as GNB should be defined at first use, and colloquial phrases such as “to figure out” should be replaced with standard academic verbs such as “to determine” or “to investigate.” The phrase “Our research is the initial to show…” is not acceptable scientific English; a more defensible formulation would be “To our knowledge, this study is among the first from Iraq to characterize…”

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

No
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Bariatric surgeon

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

Respond to this report

Responses (0)

[1] 1. Fandiño J, Benchimol AK, Coutinho WF, et al.: Cirurgia Bariátrica Aspectos Clínico-Cirúrgicos E Psiquiátricos. Rev. Psiquiatr. 2004; 26(1): 47–51.

[2] 2. Wagner NRF, Zaparolli MR, Cruz MRR, et al.: Postoperative Changes In Intestinal Microbiota And Use Of Probiotics In Roux-En-Y Gastric Bypass And Sleeve Vertical Gastrectomy: An Integrative Review. Arq. Bras. Cir. Dig. 2018 Dec 6; 31(4): E1400. PubMed Abstract | Publisher Full Text | Free Full Text

[3] 3. Associação Brasileira Para O Estudo Da Obesidade E Da Síndrome Metabólica: Diretrizes Brasileiras De Obesidade 2016. São Paulo (Brasil): 4ª ed2016. Reference Source

[4] 4. Aderinto N, Olatunji G, Kokori E, et al.: Recent Advances In Bariatric Surgery: A Narrative Review Of Weight Loss Procedures. Annals Of Medicine & Surgery. December 2023; 85(12): 6091–6104. PubMed Abstract | Publisher Full Text | Free Full Text

[5] 5. Ariyasu H, Takaya K, Tagami T, et al.: Stomach Is A Major Source Of Circulating Ghrelin, And Feeding State Determines Plasma Ghrelin-Like Immunoreactivity Levels In Humans. J. Clin. Endocrinol. Metab. 2001; 86: 4753–4758. PubMed Abstract

[6] 6. Sudan R, Jacobs DO: Biliopancreatic Diversion With Duodenal Switch. Surg. Clin. North Am. 2011; 91: 1281–1293.

[7] 7. Durmush EK, Ermerak G, Durmush D: Short-Term Outcomes Of Sleeve Gastrectomy For Morbid Obesity: Does Staple Line Reinforcement Matter?. Obes. Surg. 2014; 24: 1109–1116. PubMed Abstract | Publisher Full Text

[8] 8. Nduma BN, Mofor KA, Tatang JT, et al.: Endoscopic Gastric Sleeve: A Review Of Literature. Cureus. 2023; 15: E36353. Publisher Full Text

[9] 9. Advantages Of Endoscopic Sleeve Gastroplasty (Esg) Compared To Laparoscopic Sleeve Gastrectomy (Lsg): Doctor Marvin - Endoscopic Sleeve Gastroplasty (Esg). Accessed 10 July 2023. Reference Source

[10] 10. Silva AF, Mendes KD, Ribeiro VD, et al.: Risk Factors For The Development Of Surgical Site Infection In Bariatric Surgery: An Integrative Review Of Literature. Rev. Lat. Am. Enfermagem. 2023; 31: E3798. Publisher Full Text

[11] 11. Ferraz ÁA, Vasconcelos CF, Santa-Cruz F, et al.: Surgical Site Infection In Bariatric Surgery: Results Of A Care Bundle. Rev. Col. Bras. Cir. 2019; 46: E2252.

[12] 12. Chopra T, Marchaim D, Lynch Y, et al.: Epidemiology And Outcomes Associated With Surgical Site Infection Following Bariatric Surgery. Am. J. Infect. Control. 2012; 40: 815–819. PubMed Abstract | Publisher Full Text

[13] 13. Christou NV, Jarand J, Sylvestre JL, et al.: Analysis Of The Incidence And Risk Factors For Wound Infections In Open Bariatric Surgery. Obes. Surg. 2004; 14: 16–22. PubMed Abstract

[14] 14. Norman G, Atkinson RA, Smith TA, et al.: Intracavity Lavage And Wound Irrigation For Prevention Of Surgical Site Infection. Cochrane Database Syst. Rev. 2017; 2017: Cd012234. Publisher Full Text

[15] 15. Hassan RSEE, Osman SOS, Aabdeen MAS, et al.: Incidence And Root Causes Of Surgical Site Infections After Gastrointestinal Surgery At A Public Teaching Hospital In Sudan. Patient Saf. Surg. 2020; 14: 45. PubMed Abstract | Publisher Full Text | Free Full Text

[16] 16. Mylotte JM, Tayara A, Goodnough S: Epidemiology Of Bloodstream Infection In Nursing Home Residents: Evaluation In A Large Cohort From Multiple Homes. Clin. Infect. Dis. 2002 Dec 15; 35(12): 1484–1490. PubMed Abstract | Publisher Full Text

[17] 17. Mccue JD: Gram-Negative Bacillary Bacteremia In The Elderly: Incidence, Ecology, Etiology, And Mortality. J. Am. Geriatr. Soc. 1987 Mar; 35(3): 213–218. PubMed Abstract | Publisher Full Text

[18] 18. Jain S, Self WH, Wunderink RG, et al.: Cdc Epic Study Team. Community-Acquired Pneumonia Requiring Hospitalization Among U.S.Adults. N. Engl. J. Med. 2015 Jul 30; 373(5): 415–427. PubMed Abstract | Publisher Full Text | Free Full Text

[19] 19. Foxman B: Urinary Tract Infection Syndromes: Occurrence, Recurrence, Bacteriology, Risk Factors, And Disease Burden. Infect. Dis. Clin. N. Am. 2014; 28: 1–3. PubMed Abstract | Publisher Full Text

[20] 20. Helmen ZM, Helm MC, Helm JH, et al.: Predictors Of Postoperative Urinary Tract Infection After Bariatric Surgery. Obes. Surg. 2018; 28: 1950–1954. PubMed Abstract | Publisher Full Text

[21] 21. Jacobsen SÁ, Stickler DJ, Mobley HL, et al.: Complicated Catheter-Associated Urinary Tract Infections Due To Escherichia Coli And Proteus Mirabilis. Clin. Microbiol. 2008; 21: 26–59.

[22] 22. Alvarez AP, Demzik AL, Alvi HM, et al.: Risk Factors For Postoperative Urinary Tract Infections In Patients Undergoing Total Joint Arthroplasty. Adv. Orthop. 2016; 2016: 7268985.

[23] 23. Mitchell BG, Ferguson JK, Anderson M, et al.: Length Of Stay And Mortality Associated With Healthcare-Associated Urinary Tract Infections: A Multi-State Model. J. Hosp. Infect. 2016; 93: 92–99. PubMed Abstract | Publisher Full Text

[24] 24. Narang V, Grover S, Kang A, et al.: Comparative Analysis Of Erythrocyte Sedimentation Rate Measured By Automated And Manual Methods In Anaemic Patients. J. Lab. Physicians. 2020 Dec; 12(4): 239–243. PubMed Abstract | Publisher Full Text

[25] 25. Elmer WK, Stephen DA, William MJ, et al.: A Color Atlas And Text Book Of Diagnostic Microbiology.1997.

[26] 26. Clermont O, Christenson JK, Denamur E, et al.: The Clermont Escherichia Coli Phylo-Typing Method Revisited: Improvement Of Specificity And Detection Of New Phylo-Groups. Environ. Microbiol. Rep. 2013; 5: 58–65. PubMed Abstract | Publisher Full Text

[27] 27. Stackebrandt DLE, Goodfellow M: 16s/23s Rrna Sequencing. Nucleic Acid Techniques In Bacterial Systematics. New York, NY: John Wiley And Sons; 1991.

[28] 28. Daga AP, Koga VL, Soncini JGM, et al.: Escherichia Coli Bloodstream Infections In Patients At A University Hospital: Virulence Factors And Clinical Characteristics. Front. Cell. Infect. Microbiol. 2019 Jun 6; 9: 191. PubMed Abstract | Publisher Full Text | Free Full Text

[29] 29. Courcoulas AP, Gallagher JW, Neiberg RH, et al.: Bariatric Surgery Vs Lifestyle Intervention For Diabetes Treatment: 5-Year Outcomes From A Randomized Trial. J. Clin. Endocrinol. Metab. 2020; 105. Publisher Full Text

[30] 30. Fried M, Yumuk V, Oppert JM, et al.: Interdisciplinary European Guidelines On Metabolic And Bariatric Surgery. Obes. Surg. 2014; 24: 42–55. [32. Srinivasan U, Foxman B, Marrs Cf. Identification Of A Gene Encoding Heat Resistant Agglutinin In Escherichia Coli As A Putative Virulence Factor In Urinary Tract Infection. J Clin Microbiol 2003; 41:285–9. PubMed Abstract | Publisher Full Text

[31] 31. Colás-Ruiz E, Del-Moral-Luque JA, Gil-Yonte P, et al.: Incidence Of Surgical Site Infection And Risk Factors In Rectal Surgery: A Prospective Cohort Study. Cir. Esp. 2018; 96(10): 640–647. PubMed Abstract | Publisher Full Text

[32] 32. Sattar F, Sattar Z, Zaman M, et al.: Frequency Of Post-Operative Surgical Site Infections In A Tertiary Care Hospital In Abbottabad, Pakistan. Cureus. 2019; 11(3). Publisher Full Text

[33] 33. Lee IR, Shin JI, Park Sj OH, et al.: Mean Platelet Volume In Young Children With Urinary Tract Infection. Sci. Rep. 2015; 5: 18072–18074.

[34] 34. Zayed KMS, Abdelhakeem AM, Gafarhs ET: Diagnostic Of Plateletparameters Versus Interleukin-6 In Children With Urinary Tract Infection. Egypt Paediatrassoc Gaz. 2016; 64: 142148.

[35] 35. Catal F, Bavbek N, Bayrak O, et al.: Platelet Parameters In Children With Upper Urinary Tract Infection: Is There A Specific Response?. Ren. Fail. 2008; 30(4): 377–381. PubMed Abstract | Publisher Full Text

[36] 36. Hou TY, Gan HQ, Zhou JF, et al.: Incidence Of And Risk Factors For Surgical Site Infection After Colorectal Surgery: A Multiple-Center Prospective Study Of 3,663 Consecutive Patients In China. Int. J. Infect. Dis. 2020; 96: 676–681. PubMed Abstract | Publisher Full Text

[37] 37. Ali KM, Al-Jaff BMA: Source And Antibiotic Susceptibility Of Gram-Negative Bacteria Causing Superficial Incisional Surgical Site Infections. International Journal Of Surgery Open. 2021; Volume 30: 100318. 2405-8572. Publisher Full Text

[38] 38. Mukagendaneza MJ, Munyaneza E, Muhawenayo E, et al.: Incidence, Root Causes, And Outcomes Of Surgical Site Infections In A Tertiary Care Hospital In Rwanda: A Prospective Observational Cohort Study. Patient Saf. Surg. 2019; 13: 1–8.

[39] 39. Hope D, Ampaire L, Oyet C, et al.: Antimicrobial Resistance In Pathogenic Aerobic Bacteria Causing Surgical Site Infections In Mbarara Regional Referral Hospital, Southwestern Uganda. Sci. Rep. 2019; 9(1): 17299. PubMed Abstract | Publisher Full Text

[40] 40. Aabed K, Moubayed N, Motlak A, et al.: A Comparison Of Human Gut Microbiota And Analysis Of Antimicrobial Resistance Of E. Coli Isolates In Saudi Adults Undergoing Bariatric Surgery. Biomedica. 2020; 36(2).

[41] 41. Manyahi J: Bacteriological Spectrum Of Post-Operative Wound Infections And Their Antibiogram In A Tertiary Hospital, Dar Es Salaam, Tanzania. Muhimbili University Of Health And Allied Sciences); 2012. (Doctoral Dissertation).

[42] 42. Licznar P, Eychenne I, Aze´Ma C, et al.: Revised Prevalence Of Afa+ Escherichia Coli Strains In Acute Pyelonephritis Of Children. Pathol Biol (Paris). 2003; 51: 512–515. PubMed Abstract

[43] 43. Dale AP, Woodford N: Extra-Intestinal Pathogenic Escherichia Coli (Expec): Disease, Carriage And Clones. J. Infect. 2015; 71: 615–626. PubMed Abstract | Publisher Full Text

[44] 44. Al-Sudani SFK, Hamad LR, Ali FA: Diagnosis And Detection Of Vick Gene In Streptococcus Mutans Isolated From The Saliva Of Patients With Diabetic Type 2 With Tooth Decay In The Iraqi Population. Cell. Mol. Biol. 2021; 67(4): 222–231.

[45] 45. Koga VL, Tomazetto G, Cyoia PS, et al.: Molecular Screening Of Virulence Genes In Extraintestinal Pathogenic Escherichia Coli Isolated From Human Blood Culture In Brazil. Biomed. Res. Int. 2014; 2014: 465054. PubMed Abstract | Publisher Full Text | Free Full Text

Escherichia coli Infection Risk Following Sleeve Gastrectomy

Abstract

Abstract*

Backgruond

Method

Result

Conclusion

Keywords

Introduction

Methods

Sampling

Data collection

Hematological and serum analysis

GNB isolation an identification

Molecular method identification (PCR- reaction)

Gene amplification

Table 1. Displays the primer sequences of targeted gene expression.

Antimicrobial resistance testing

Virulence factor gene

Statistical analysis

Results

Table 2. The study population characteristics.

Table 3. Infected and non-infected sleeve gastrectomy participants' frequency distribution of blood parameters.

Cause of infection related to GNB in sleeve gastrectomy

Figure 1. Rate of GNB infection in samples isolated from sleeve gastrectomy.

PCR detection of E.coli strain

Figure 2. PCR results of isolates recognized as E. coli observed under a UV lamp on a 1.5% agarose gel.

Antimicrobial susceptibility of E.coli

Table 4. Antimicrobial resistance profile of E. coli bacteria in sleeve gastrectomy.

Table 5. The frequency of virulence factors of 15 Escherichia coli isolates from urine and infected wounds in patients undergoing sleeve gastrectomy.

Discussion

Ethical considerations

Data availability

Acknowledgements

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated