ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Correspondence

APOC3 may not be a predictor of risk of ischemic vascular disease in the Chinese population

[version 1; peer review: 2 approved, 1 approved with reservations]
* Equal contributors
PUBLISHED 07 Nov 2014
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

The genetic background of ischemic vascular disease is actively being explored. Several studies have shown that inhibition of APOC3 significantly reduces plasma levels of apolipoprotein C3 and triglycerides. Recently, the TG and HDL Working Group and Jørgensen et al. reported that loss-of-function mutations in APOC3 are associated with decreased triglyceride levels and a reduced risk of ischemic vascular disease in European and African individuals. We performed a replication study in 4470 Chinese participants. The coding regions of APOC3 were amplified and re-sequenced. However, only synonymous and intronic variants with no functional consequences were identified. None of the loss-of-function mutations reported in European and African individuals were observed. Therefore, APOC3 may not be an ideal predictor for risk of ischemic vascular disease in the Chinese population.

Keywords

ischemic vascular disease, risk prediction, APOC3

Correspondence

The genetic basis of ischemic vascular disease such as coronary artery disease is actively being explored. Most studies have focused on susceptibility factors contributing to an increased risk1, while only few studies have identified protective variants conferring reduced risk. Recently, the TG and HDL Working Group and Jørgensen et al. reported that loss-of-function mutations in APOC3 are associated with decreased triglyceride levels and a reduced risk of ischemic vascular disease in individuals of European and African ancestry2,3. Approximately 1 in 150 individuals were heterozygous carriers of at least one of the four mutations: R19X, A43T, IVS2+1G→A, and IVS3+1G→T. Heterozygous carriers for these mutations had a significantly lower incidence of ischemic vascular disease as compared to non-carriers (hazard ratio = 0.59). Triglyceride and circulating APOC3 levels in the carriers were only 61% and 54% of those in non-carriers, respectively. These critical findings prompted us to undertake a replication study in China, where over one million people are affected by cardiovascular diseases each year (http://www.nhfpc.gov.cn/).

A total of 4470 unrelated Chinese participants were enrolled, including 1488 healthy controls, 1050 patients with ischemic stroke, 628 patients with coronary artery disease, and 1304 patients with venous thrombosis, which could also be exacerbated by effects on the coagulation system resulting from elevated triglyceride levels. The 1488 healthy controls and 1050 patients with ischemic stroke were described in a previous study4. Briefly, healthy individuals did not present any relevant medical history or family history of ischemic vascular disease. Ischemic stroke was confirmed by brain computed tomography (CT) and/or brain magnetic resonance imaging (MRI). The 1304 patients with venous thrombosis were described previously5. Thrombosis was confirmed by objective investigations such as color Doppler ultrasonography and/or CT angiography. Patients with coronary artery disease were enrolled in our hospital from September 2013 to March 2014. Coronary artery disease was validated by angiographic evidence of at least one segment of a major coronary with over 50% organic stenosis. The characteristics of the 628 patients with coronary artery disease are summarized in Table 1. Written informed consent was obtained from all participants, and the study was approved by the Ethics Committee of Union Hospital affiliated with Huazhong University of Science and Technology (Approval number 2013-03-0052).

Table 1. Characteristics of the 628 patients with coronary artery disease.

CharacteristicNumberPercentage
Onset age (yr, mean)61.6 ± 10.8
     <40111.7%
     ≥40 and <6025640.8%
     ≥6036157.5%
Sex
     male40865.0%
     female22035.0%
Coronary artery disease
     angina pectoris42267.2%
     myocardial infarction20632.8%
Family history
     yes325.1%
     no59694.9%
Current smoker
     yes15725.0%
     no47175.0%
Drinking
     yes7912.6%
     no54987.4%
Hypertension
     yes42567.7%
     no20332.3%
Type 2 diabetes
     yes17527.9%
     no45372.1%
Fasting serum lipid levels
     TC3.97 ± 0.99 mmol/L
     TG1.55 ± 1.05 mmol/L
     HDL-C1.19 ± 0.29 mmol/L
     LDL-C2.07 ± 0.76 mmol/L

TC, total cholesterol; TG, triglycerides; HDL-C, high density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol.

The diagnosis of myocardial infarction was based on typical chest pain with a duration over 30 min, on electrocardiographic patterns, and on increased creatine kinase MB isoenzyme and troponin I levels. Hypertension is defined as systolic blood pressure ≥ 140 mmHg and/or diastolic blood pressure ≥ 90 mmHg. Type 2 diabetes were clarified using the 1999 WHO criteria, including fasting plasma glucose ≥ 7.0 mmol/L, 2-hour oral glucose tolerance test plasma glucose ≥ 11.1 mmol/L or ongoing therapy for diabetes.

Blood samples were collected into a vacutainer tube containing 0.105 mol/L trisodium citrate and were then centrifuged at 2000 g for 15 minutes. Genomic DNA was isolated using a salt precipitation method and was then used for sequencing. The four exons and the flanking intronic regions of APOC3 were amplified by PCR and then sequenced on an Applied Biosystems ABI 3730 Genetic Analyzer, as previously described2. The oligonucleotide pairs and annealing temperatures employed in PCR and sequencing are shown in Table 2. In this study, we identified only synonymous and intronic variants, with no functional consequences, and similar genotype distributions across the groups (Table 3). None of the loss-of-function mutations reported in European and African individuals were observed in the current cohort. Considering the relatively large sample size, we suggest that functional variants in APOC3 could be very rare in China. Therefore, the genetic background of ischemic vascular disease is highly variable among different ethnic groups, and APOC3 may not be an ideal predictor of risk of ischemic vascular disease in the Chinese population. Further studies are warranted to understand the genetic basis governing triglyceride levels and conferring protective effects on ischemic vascular disease in the Chinese population.

Table 2. Primers and annealing temperatures for PCR and sequencing.

ExonForward primer (5'-3')Reverse primer (5'-3')AT (ºC)Product size (bp)
1GCCTTTACTCCAAACACCCCAGTGCTTCTCCAGGCTTGCT58602
2 and 3CCTTCTGAGAGCCCGTATTAGCCCGCAGCAGCCTGACAAA58646
4GGGGCATAAACATCTGAGGTCTACCAGAAGGTGGATAGAGC58693

AT, annealing temperature. The accession number of APOC3 reference sequence in GenBank is NG_008949.1.

Table 3. APOC3 variants identified in the 4470 Chinese participants.

VariablesdbSNP IDControl group
n = 1488
Ischemic stroke
n = 1050
Coronary heart disease
n = 628
Venous thrombosis
n = 1304
Age (yr, mean)61.2 ± 12.862.2 ± 12.361.6 ± 10.851.7 ± 13.8
Male, n (%)978 (65.7%)691 (65.8%)408 (65.0%)638 (48.9%)
Variants, n (%)b
    c.10C>A (p.Arg4=)novel
        CC1485 (99.8%)1048 (99.8%)627 (99.8%)1301 (99.8%)
        CA3 (0.2%)2 (0.2%)1 (0.2%)3 (0.2%)
        P value0.950.840.87
    c.99G>A (p.Gln33=)rs200557528
        GG1481 (99.5%)1046 (99.6%)625 (99.5%)1296 (99.4%)
        GA7 (0.5%)4 (0.4%)3 (0.5%)8 (0.6%)
        P value0.730.980.61
    c.102T>C (p.Gly34=)rs4520
        TT655 (44.0%)456 (43.4%)278 (44.3%)582 (44.6%)
        TC641 (43.1%)449 (42.8%)272 (43.3%)566 (43.4%)
        CC192 (12.9%)145 (13.8%)78 (12.4%)156 (12.0%)
        P value0.800.950.75
    c.179+57G>Ars2070667
        GG1098 (73.8%)776 (73.9%)454 (72.3%)967 (74.2%)
        GA329 (22.1%)235 (22.4%)148 (23.6%)286 (21.9%)
        AA61 (4.1%)39 (3.7%)26 (4.1%)51 (3.9%)
        P value0.880.760.96
    c.240G>A (p.Lys80=)novel
        GG1483 (99.7%)1047 (99.7%)626 (99.7%)1301 (99.8%)
        GA5 (0.3%)3 (0.3%)2 (0.3%)3 (0.2%)
        P value0.820.950.60
    c.*40G>Crs5128
        GG763 (51.3%)535 (51.0%)328 (52.2%)665 (51.0%)
        GC562 (37.8%)394 (37.5%)240 (38.2%)494 (37.9%)
        CC163 (10.9%)121 (11.5%)60 (9.6%)145 (11.1%)
        P value0.900.640.98
    c.*71G>Trs4225
        GG1006 (67.6%)703 (66.9%)416 (66.2%)880 (67.5%)
        GT414 (27.8%)304 (29.0%)180 (28.7%)368 (28.2%)
        TT68 (4.6%)43 (4.1%)32 (5.1%)56 (4.3%)
        P value0.730.790.92

dbSNP, single nucleotide polymorphism database of the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/projects/SNP).

Comparisons between the controls and each case group were assessed with the use of the chi-square test. A two tailed P<0.05 was considered significant.

Consent

Written informed consent to publish these data has been obtained by each participant.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 07 Nov 2014
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Tang L, Cheng ZP, Wang QY et al. APOC3 may not be a predictor of risk of ischemic vascular disease in the Chinese population [version 1; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:270 (https://doi.org/10.12688/f1000research.5676.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 07 Nov 2014
Views
18
Cite
Reviewer Report 10 Dec 2014
Bin Zhang, Genomic Medicine Institute, Lerner Research Institute of Cleveland Clinic, Cleveland, OH, USA 
Approved with Reservations
VIEWS 18
The authors performed a confirmatory study for the recently reported protective effects of loss-of-function mutations in APOC3 in the Chinese population. Not a single loss-of-function mutation was identified in exons and exon-intron junctions of APOC3 in a total of 4470 ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Zhang B. Reviewer Report For: APOC3 may not be a predictor of risk of ischemic vascular disease in the Chinese population [version 1; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:270 (https://doi.org/10.5256/f1000research.6066.r6866)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
15
Cite
Reviewer Report 05 Dec 2014
Chang-Geng Ruan, Key Laboratory of Thrombosis and Haemostasis, Ministry of Health, Suzhou, China 
Approved
VIEWS 15
Two very recent landmark large-scale studies show that loss-of-function mutations in APOC3 are associated with lower levels of plasma triglycerides, and carriers of these mutations have a reduced risk of coronary heart disease in European and African individuals. Tang et ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Ruan CG. Reviewer Report For: APOC3 may not be a predictor of risk of ischemic vascular disease in the Chinese population [version 1; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:270 (https://doi.org/10.5256/f1000research.6066.r6920)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
19
Cite
Reviewer Report 13 Nov 2014
Javier Corral, Centro Regional de Hemodonación, Universidad de Murcia, Murcia, Spain 
Approved
VIEWS 19
Despite being a negative study, the information in this article is valuable. It describes a study that found no relevant mutation in APOC3 among a large number of Chinese subjects (4470), including 1488 healthy controls, 1050 patients with ischemic stroke, ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Corral J. Reviewer Report For: APOC3 may not be a predictor of risk of ischemic vascular disease in the Chinese population [version 1; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:270 (https://doi.org/10.5256/f1000research.6066.r6688)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 07 Nov 2014
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.