ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs

[version 3; peer review: 2 approved, 1 approved with reservations]
PUBLISHED 02 Dec 2016
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Species and populations with parallel evolution of specific traits can help illuminate how predictable adaptations and divergence are at the molecular and developmental level. Following the last glacial period, dwarfism and specialized bottom feeding morphology evolved rapidly in several landlocked Arctic charr Salvelinus alpinus populations in Iceland.  
To study the genetic divergence between small benthic morphs and limnetic morphs, we conducted RNA-sequencing charr embryos at four stages in early development. We studied two stocks with contrasting morphologies: the small benthic (SB) charr from Lake Thingvallavatn and Holar aquaculture (AC) charr.
The data reveal significant differences in expression of several biological pathways during charr development. There was also an expression difference between SB- and AC-charr in genes involved in energy metabolism and blood coagulation genes. We confirmed differing expression of five genes in whole embryos with qPCR, including lysozyme and natterin-like which was previously identified as a fish-toxin of a lectin family that may be a putative immunopeptide. We also verified differential expression of 7 genes in the developing head that associated consistently with benthic v.s.limnetic morphology (studied in 4 morphs). Comparison of single nucleotide polymorphism (SNP) frequencies reveals extensive genetic differentiation between the SB and AC-charr (~1300 with more than 50% frequency difference). Curiously, three derived alleles in the otherwise conserved 12s and 16s mitochondrial ribosomal RNA genes are found in benthic charr.
The data implicate multiple genes and molecular pathways in divergence of small benthic charr and/or the response of aquaculture charr to domestication. Functional, genetic and population genetic studies on more freshwater and anadromous populations are needed to confirm the specific loci and mutations relating to specific ecological traits in Arctic charr.

Keywords

Salmonids, Aquaculture, ecomorphs, Polymorphism, parallel evolution, immunology, craniofacial divergence, mtDNA

Revised Amendments from Version 2

The changes to the manuscript are rewriting of the introduction, results and discussion to present more clearly the biology of the Aquaculture charr used here as a reference strain, and the results from the contrast of the SB and AC transcriptomes and their implication both for evolutionary questions and also biology of the AC-charr. We also set out to reduce the emphasis on the ecological divergence in the description and interpretation of the results. We also rewrote part of the introduction, to provide better flow from general to specific background, and shortened the summary of molecular genetics of the craniofacial genes in the discussion. We clarified several issues, like the potential transgenerational effects in common garden experiment, the description of the Salmonid ancestor genome duplication and the age of the clade, and the qPCR results on both the Nattl genes and the summary of validated genes. We amended figures 1, 2 and 4, and cleaned or adjusted the language/spelling in accordance with the suggestions of the reviewers. We thank them dearly for their thoughtful comments and suggestions, which have clearly improved the manuscript.

See the authors' detailed response to the review by Örjan Östman
See the authors' detailed response to the review by Daniel Macqueen
See the authors' detailed response to the review by Anne Dalziel

Introduction

Historical contingencies and chance shape organisms during evolution1,2, but convergence in phenotype and molecular systems indicates that evolution is to some extent predictable3,4. Identification of genes and variants that influence evolved differences is not a trivial task5. Ideal systems to study the role of chance and necessity in ecological evolution would be related species or populations with readily observable phenotypic variation, living in a tractable ecological setting, and showing parallel evolution of specific traits within/among species/populations. Examples of such species complexes are provided by finches of the Galapagos islands6, while cichlids of the African great lakes also provide an exciting multi-species system in the same respect7. The threespine stickleback has also emerged as a model “single species” system8. The amount of diversity in the feeding specializations of fish provide great opportunities for studying adaptation and divergence at the developmental and genetic level.

Some northern freshwater fish species exhibit frequent parallelism in trophic structures and life history and in several cases are found as distinct resource morphs813. Local adaptation has been extensively studied in the salmonid family, to which our study species Arctic charr (Salvelinus alpinus) belongs14. This species is well suited for studying the developmental underpinnings of trophic divergence and parallel evolution. The common ancestor to salmonids experienced a whole genome duplication 88–103 million years ago, the fourth vertebrate whole-genome duplication (Ss4R)1518. This has provided time for divergence of ohnologous genes (paralogous genes originated by whole genome duplication event) in salmonid lineages. Estimates from the rainbow trout (Oncorhynchus mykiss) genome suggest that ohnologous genes are lost at a rate of about 170 genes per million years, and that around half of the original Ss4R ohnologue pairs are still functionally retained in rainbow trout16.

One approach to identify pathways related to function or morphological differences between species, populations or ecomorphs is to study gene expression during development19,20. For example a microarray study of liver samples from anadromous and resident populations of brown trout (Salmo trutta), revealed that gene expression in juveniles was more influenced by life history than relatedness21. Furthermore, Filteau et al. (2013)22 found a set of coexpressed genes differentiating two whitefish morphotypes, implicating Bone morphogenesis protein (BMP) signalling in the development of ecological differences in trophic morphology. Thus we were quite keen to apply RNA-sequencing to analyse ecomorphs in Arctic charr. De novo assembly of genomes and transcriptomes is complicated if many paralogs are present, which is the case in Arctic charr – see 23, 24. In this study we opted for mapping the reads (36 bp) to a related reference genome/transcriptome25, instead of de novo assembly. Two previous studies have used RNA-seq to study salinity tolerance in adult Arctic charr, and found links between gene expression and quantitative trait loci23,24.

Molecular studies of the highly polymorphic Arctic charr

Following the end of the last glacial period, about 10.000 years ago, Arctic charr colonized northern freshwater systems26. It is found as anadromous or lake/stream residents and exhibits high level of within species polymorphism11,26. Charr is also known to harbour substantial phenotypic plasticity, which may promote or reduce divergence9,27. Resource polymorphism in charr correlates with ecological attributes2830. For instance small charr with benthic morphology, are found in multiple lavaspring and stream habitats in Iceland31, and a comparative study of Icelandic lakes30 found that lakes with greater limnetic habitat, lower nutrients levels, and greater potential for zooplankton consumption appeared to promote resource polymorphism. Some of the larger lakes contain two or more distinct morphs, typically limnetic and benthic forms. Multiple lines of evidence show that these differences stem both from environmental and genetic causes3236. The best studied example of sympatric charr are the four morphs in Lake Thingvallavatn37; two have a benthic morphotype, a large benthivorous (LB-charr) and a small benthivorous (SB-charr), and two morphs are limnetic, a large piscivorous morph (PI-charr) and small planktivorous morph (PL-charr)38. Both PL and PI-charr operate in open water and feed on free-swimming prey, PL on planktonic crustaceans and PI on small fish. The PL, LB and SB-charr are presented in Figure 1.

24f79c98-11b0-45dc-b0d7-8355c5754509_figure1.gif

Figure 1. The Arctic charr morphs used in this study.

Adult individuals of the four morphs studied here, A) the Holar aquaculture charr, B) the small benthic charr, C) the planktivorous charr D) and the large benthic charr. The latter three all come from Lake Thingvallavatn and were sexually ripe. The morphs differ in size at maturation, body and head shape - mainly lower jaw and length of maxilla and colour pattern in the wild.

Several population genetics studies, using allozymes or mtDNA revealed no differences among charr morphs in Lake Thingvallavatn3941 while other studies using microsatellite markers and nuclear genes, found significant4244 genetic differences among morphs in the lake45. Importantly Kapralova et al. (2011)44 concluded that small benthic morphs have evolved repeatedly in Iceland and that gene flow has been reduced between the PL and SB morphs in Lake Thingvallavatn since its formation approximately 10,000 years ago46. We also discovered genetic separation in immunological genes (MHCIIα and cath2) between morphs in Iceland and within the lake45, consistent with ecologically driven evolution of immune functions. Recently qPCR analyses showed that expression of mTOR pathway components in skeletal muscle correlates with the SB-charr form in Iceland47, but it is unknown whether there is genetic differentiation in those genes or upstream regulators. Because individual genes have distinct histories48,49, genome wide methods are needed to identify genes and mutation that associate with divergence.

AC charr as a reference for sympatric Arctic charr

The ideal reference populations for developmental and molecular studies of landlocked and sympatric Arctic charr in Iceland would be local anadromous charr. However, capturing running charr from the wild is not trivial. For this study we chose to use the Icelandic aquaculture charr (AC) as a reference. The AC-charr was founded with fish from the north of Iceland, and has been bred at Holar University College since 199050. Body weight and age at sexual maturity have significant heritability in the Holar AC-charr, and the stock responded well to artificial selection for growth and performance characteristics. It is now the dominant charr breed in aquaculture in Iceland. While clearly a derived breed, it seems to have retained general limnetic craniofacial morphotype (Figure 1). The rationale for comparing SB-charr from Lake Thingvallavatn and AC-charr was threefold: i) SB charr represents an extensively studied and derived form of charr, that has been separated from anadromous fish for approx. 10,000 years, ii) AC charr was readily available for sampling (but wild anadromous charr was not), iii) we wanted an extreme contrast, because of budget reasons we could only sequence 8 samples at the time. Note, the transcriptome itself can only point out differences between the two morphs, but not highlight whether specific genes associate with SB or AC biology and breeding. But by focusing the verification on sympatric benthic and limnetic morphs of Lake Thingvallavatn, we could test and verify a subset of the signals found here. The contrast of SB and AC was justified as the data and studies5153 building on this data illustrate (see discussion).

Our long term research objectives are to investigate the genetics and developmental underpinnings of charr divergence and benthic parallelism. As a step towards this we compared the developmental transcriptome of SB charr and AC charr, reared in common lab environment to minimize the effects of environmentally induced phenotypic plasticity. The aims of this study are threefold. First, to find genes and pathways related to the development of phenotypic differences between small benthic charr from Lake Thingvallavatn and Icelandic aquaculture charr conforming to a limnetic morphotype. Second, to screen for signals of genetic differentiation between these two charr types. Third, we set out to verify a subset of the expression and genetic signals in the high-throughput sequencing data and also studying two more morphs (LB and PL) from Lake Thingvallavatn. The data reveal differential expression of genes that may affect the development of craniofacial and other phenotypic traits in charr. Genetic differences in nuclear and mitochondrial genes are also observed and provide a starting point for studying evolution of wild populations and genetics of domestication in Icelandic Arctic charr.

Methods

Sampling, rearing and developmental series

Overview of the experimental design, RNA sequencing, analyses and follow work is outlined in Figure 2. We set up crosses and reared embryos in the laboratory as described in 51. Embryos from four charr morphs were studied: an aquaculture charr (AC-charr) from the Holar breeding program50 and three natural morphs from Lake Thingvallavatn; SB, LB and PL-charr54. Samples of the first two, AC and SB-charr, with contrasting adult size and morphology (Figure 1), were collected in 2009 and material sent for RNA sequencing. The latter two were sampled in 2010 and were used for qPCR and SNP studies of selected genes. Briefly, in September 2009 we got material from spawning AC-charr from the Holar breeding program50, from single parent crosses and spawning SB-charr collected via gill netting in Olafsdrattur in Lake Thingvallavatn. Similarly, in the 2010 spawning season SB-, LB- and PL-charr were collected from Lake Thingvallavatn. For each parent group, eggs from several females (3–10) were pooled and fertilized using milt from several males (3–5) from the same group. Embryos were reared at ~ 5°C under constant water flow and in complete darkness at the Holar University College experimental facilities in Verid, Saudárkrókur. The water temperature was recorded twice daily and the average was used to estimate the relative age of the embryos using tausomite units (τs)55. Embryos and juveniles were sampled at designated time points, placed in RNAlater (Ambion) and frozen at −20°C. Post hatching juveniles were reared at the same temperature on standard Aquaculture food. For the investigation of different tissues of adult aquaculture charr (AC) from Hólar (fish size 20–25 cm) were used. Six randomly selected individuals were killed (by cutting through spinal cord) and dissected, and samples were taken from the skin, heart, liver, gills, spleen, intestine and kidney of each fish. The samples were placed in RNAlater (Ambion) and stored at −20°C. We used DNA for population genetic analyses from our previous study45, eight individuals from each of the three types, PL, LB and SB-charr.

24f79c98-11b0-45dc-b0d7-8355c5754509_figure2.gif

Figure 2. Schematic of RNA sequencing and follow up qPCR and population genetic work.

RNA from embryos of the AC and SB charr at four stages (AC embryos pictured at top) were sequenced with Illumina technology. Reads were mapped to Atlantic salmon expressed sequence tags (ESTs). To verify differentially expressed genes we used RNA from embryos and heads of these four morphs, and tissues from adult AC charr. To verify SNPs we genotyped population samples from three Lake Thingvallavatn morphs (PL, LB and SB).

Fishing in Lake Thingvallavatn was done with permissions obtained both from the owner of the land in Mjóanes and from the Thingvellir National Park commission. Ethics committee approval is not needed for regular or scientific fishing in Iceland (The Icelandic law on Animal protection, Law 15/1994, last updated with Law 157/2012). Sampling was performed by Holar University College Aquaculture Research Station (HUC-ARC) personnel. HUC-ARC has an operational license according to Icelandic law on aquaculture (Law 71/2008), which includes clauses of best practices for animal care and experiments.

RNA extraction and transcriptome sequencing

Embryos of AC- and SB-charr sampled in 2009 were used for transcriptome sequencing. For this we focused on the time covering development of pharyngeal arches and morphogenesis of the head: at 141, 163, 200 and 433 τs (post fertilization). For each combination of morphs and timepoints we pooled RNA from approximately six individuals. RNA extraction and following steps were performed as described earlier51,56. Briefly, the embryos were dechorionated and homogenized with a disposable Pellet Pestle Cordless Motor tissue grinder (Kimble Kontes, Vineland, NJ, USA) and RNA was extracted into two size-fractions using the Ambion mirVana kit (Life Technologies, Carlsbad, CA, USA). The high molecular weight fraction was further used for mRNA-seq and RNA quality was analysed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). RNA from samples was pooled - equal contribution of each sample - and first and second strand cDNA synthesis, fragmentation, adapter ligation and amplification were performed using the mRNA-Seq 8-Sample Prep Kit (Illumina, San Diego, CA, USA) according to manufacturer’s instructions. Sequencing was performed at DeCode genetics (Reykjavík, Iceland) using SOLEXA GAII technology (Illumina, San Diego, CA, USA).

The sequencing reads were deposited into the NCBI SRA archive under BioProject identifier PRJNA239766 and with accession numbers: SRX761559, SRX761571, SRX761575, SRX761577, SRX761451, SRX761461, SRX761490 and SRX761501.

The embryos sampled in 2010 were used for qPCR analyses. RNA was extracted from six whole embryos, in two replicates (two repetitions X three fish) (AC and SB sampled at 161 and 200 τs). For the extraction of RNA from heads of AC, SB, LB and PL, 12 embryos (two repetitions X six fish) at 178, 200 and 216 τs were used. Embryos were dechorionated and decapitated in front of the pectoral fin. RNA extraction and cDNA preparation were performed as described previously in 51. Similarly, RNA was extracted from a small piece (approximately 2 mm2) of skin, heart, liver, gill, spleen, intestine and liver from six adult AC-charr.

Analyses of RNA-seq data and mapping to Salmon EST contigs

As no S. alpinus genome is available and de novo assembly of the 36 bp reads yielded an excessive number of short contigs we chose to assess expression and genetic variation by mapping the reads to 59336 S. salar expressed sequence tag (EST) contigs from the SalmonDB [57, downloaded 22. March 2012] and the Arctic charr mitochondrial genome [48, NC_000861].

To estimate expression, reads were aligned with RSEM version 1.1.18 with default parameters. RSEM distributes reads that map to multiple locations to the most likely contig, using expectation maximization58. The read counts for contigs with the same annotation were pooled because some genes were represented by more than one contig, and due to whole genome duplication almost the half of salmonid genes exist as ohnologs16,18. Thus the expression tests are done on gene or paralog group level, instead of the contig level. We acknowledge that paralogous genes are not always expressed similarly, but feel its necessary to do this pooling because of the nature of the data. In the remainder of the paper, we will refer to gene or paralog group (the number of underlying contigs is indicated in relevant tables). This brought the number of genes considered down to 16851. Lastly, paralog groups with fewer than 800 mapped reads in the entire dataset were excluded from the analyses, yielding a total of 10496.

A generalized linear model (GLM) with morph and developmental time as explanatory variables was used to find genes with different expression levels between the two charr morphotypes (groups) using the edgeR-package in R59.

Y=Morph+Time+Error

To obtain further insight into the expression profiles of differently expressed genes, we performed clustering analyses on log-transformed cpm-values (counts per million; cpm-function in edgeR). The values for each gene were scaled by mean and standard deviation, and the euclidean distance used for the hclust-function in R60 with the default settings. We used the hypergeometric-test in goseq61 to test for gene ontology enrichment. Since we pooled the read-count from different contigs we could unfortunately not take gene length into account in those tests.

Tests of differential expression with qPCR

We previously identified suitable reference genes to study Arctic charr development51. Here we examined the expression of several genes in whole charr embryos, embryonic heads and adult tissues. Primers were designed using the Primer3 tool62 and checked for self-annealing and heterodimers according to the MIQE guidelines63 (S1 Table). Primers for genes with several paralogs were designed for regions conserved among paralogs, except for natterin-like, where primers were designed to match regions differing in sequence between paralogs. Relative expression was calculated using the 2−ΔΔCt method64. For the calculation of relative expression of genes in whole embryos, the geometric mean expression of three reference genes, β- Actin (Actb), elongation factor 1 α and Ubiquitin-conjugating enzyme E2 L3, was used for normalization. For visual comparisons among samples, the normalized expression was presented as relative to the expression in AC at 161 τs (calibration sample). For the embryonic head samples Eukaryotic Translation Initiation Factor 5A (If5a1) and Actb were used as reference genes and a biological replicate of AC at 178 (τs) as the calibrator sample, see 51, 52. Standard errors of relative expression were calculated from the standard errors (SE) of the ΔCT-values with the formula 2−(ΔΔCt+SE) = minimum fold expression and 2−(ΔΔCtSE) = maximum fold expression. The statistical analysis was performed using the ΔCT-values with a two-way ANOVA with GLM function in R.

Y=Morph+Time+MorphxTime+Error

Normal distribution of residuals was confirmed for all data. For the study of expression in the embryonic head we followed a significant morph effect in the ANOVA with Tukey’s post-hoc honest significant difference test, on relative expression ratios (ΔCTs). Three genes had lower efficiency (as low as 1.72). We acknowledge that the data on those genes may be weak.

Polymorphisms in the Arctic charr transcriptome

For analysis of genetic variation we mapped the reads to the salmon contigs, this time using the Burrow-Wheeler Aligner (BWA)65 with a seed length of 25, allowing two mismatches. We re-mapped the reads, since BWA allows short indels (RSEM does not) but disregarding them leads to many false SNPs close to indels. To extract candidate polymorphic sites from the Arctic charr transcriptome we ran VarScan266 with minimum coverage of 50 reads and minimum minor allele frequency of 0.1 on reads mapped to each S. salar contig for all of the 8 timepoints and morph combinations. This was done separately for reads that mapped uniquely to one contig only (UNI) and reads that mapped to two or more contigs (REP). These SNP-candidates were further processed in R60, following established principles for variant calling67. SNP-candidates at 90% frequency or higher in all samples were disregarded, as they reflect differences between Arctic charr and S. salar and are not the focus of this study. SNP-candidates with poor coverage in specific samples - i.e. coverage of five or fewer reads in three or four samples of each morph - were removed. As the SNP analysis was done on individual contigs, differences among paralogs appear in the data. To address this we use the fact that each sample is a pool of few individuals, thus true SNPs are unlikely to have the same frequency in all samples. However, variants reflecting differences between paralogs will have similar frequency all samples (assuming steady difference in their expression in all samples). We evaluated differences between samples with Fisher exact tests, and only SNPs significantly different between samples with a p < 0.05 (with no multiple testing correction) were retained. To compare morphs, read numbers were summed over the four samples from each morph. A conservative approach was taken by focusing on SNP-candidates that showed the largest differences in frequency between morphs (delta), without adjusting for multiple testing (Fisher exact test, p > 5%). SNP-candidates with the highest frequency difference (delta > 95%) were manually processed and redundant candidates removed. A similar approach was used to mine for polymorphisms in Arctic charr mtDNA (NC_000861), using S. salar mtDNA as the outgroup (NC_001960.1).

We wrote a python script to predict the impact of SNPs within the mRNA sequences. Polymorphisms were categorized according to their location (3’UTR, coding, 5’UTR), and those within the coding region into synonymous or non-synonymous.

Verification of candidate SNPs

We chose 12 candidate SNPs for verification (see below). As the AC-charr is not a random breeding population, and because our interest is on differences between wild morphs, we took random samples of spawning SB, LB and PL-charr from Lake Thingvallavatn (8 per morph) from our earlier study45. Using the same PCR and DNA sequencing approach we genotyped 12 candidate SNPs (S2 Table). Briefly, we first compared the Salmon genome and ESTs [57, downloaded 22. March 2012] and short contigs from our preliminary assembly of the Arctic charr transcriptome. This allowed us to infer the placement of the putative polymorphism in the locus, and design paralog specific primers for PCR (less than 1 kb amplicons). MJ tetrad machine was used for PCR and the program was 5 min. at 95°C, followed by 35 cycles of 30 sec. at 52°C, 1 min. at 72°C, 30 sec. at 95°C, ending with 12°C while waiting on the human. Each individual was genotyped by first amplifying the region of interest using PCR, followed by ExoSAP (Affymetrix), direct sequencing (BigDye) and finally run on an Applied Biosystems 3500xL Genetic Analyzer (Hitachi). Raw data was base-called using the Sequencing Analysis Software v5.4 with KBTMBasecaller v1.41 (Applied Biosystems). Ab1 files were run through Phred and Phrap and imported to Consed for visual editing of ambiguous bases and putative polymorphisms, and for trimming primers. The FASTA files were aligned with ClustalW online [68, http://www.ebi.ac.uk/Tools/msa/clustalw2/] and manually inspected in Genedoc69. All sequences where deposited to Genbank as popsets under the accession numbers KP019972-KP020026.

Comparative genomic analyses of sequence polymorphisms

Two approaches were used for genomic comparisons of verified SNPs in the mitochondrial genome. Using the charr mtDNA sequence we performed both a BLAST search on salmon ESTs (May 2013) and retrieved multiZ alignments of vertebrates from the UCSC genome browser (in September 2013). This yielded several hundred sequences from related fish and other vertebrates. The list was reduced to 20 sequences for visualization, by keeping members of the major taxa but removing more closely related sequences, aligned with ClustalW and manually adjusted in Genedoc. The species and genome versions used are; Human (Homo sapiens, hg19), Lamprey (Petromyzon marinus, petMar1), Fugu (Takifugu rubripes, fr2), Medaka (Oryzias latipes, oryLat2), Stickleback (Gasterosteus aculeatus, gasAcu1), Tetraodon (Tetraodon nigroviridis, tetNig2), Zebrafish (Danio rerio, danRer6). We also downloaded from NCBI the sequence of whole or partial mtDNA from several fish species; Brown trout (Salmo trutta, JQ390057 and AF148843), Broad whitefish (Coregonus nasus, JQ390058), Legless searsid (Platytroctes apus, AP004107), Pacific menhaden (Ethmidium maculatum, AP011602), Icefish (Salanx ariakensis, AP006231 and HM151535), Chain pickerel (Esox niger, AP013046) and Western Pacific roughy (Hoplostethus japonicus, AP002938). The three mitochondrial variants (numbered by the S. alpinus mtDNA - NC_000861) are; m1829G>A (CCACGTTGTGAAACCAAC[G/A]TCCGAAGGTGGATTTAGCAGT), m3211T>C (CGTGCAGAAGCGGGCATAAG[T/C]ACATAAGACGAGAAGACCCT) and m3411C>T (CTCTAAGCACCAGAATTT[C/T]TGACCAAAAATGATCCGGC).

Results

RNA sequencing characteristics

Each sample yielded good quality data, with sequencing depth from 49 to 58 million (average: 55 million) reads. To quantify the expression levels, the reads were aligned to a salmon EST-assembly57. Around 20% of the reads mapped uniquely to the EST data (S3 Table). A further 30% mapped to two or more contigs, probably representing paralogous genes, recent duplications or repeat-like elements within transcribed regions. A substantial fraction of the RNA-sequencing reads did not map to the contigs from S. salar. Analyses of those reads require an Arctic charr genome sequence or transcriptome assembly from longer and paired end reads, currently underway in our laboratory.

Differential expression during Arctic charr development

We detected considerable changes in the transcriptome during Arctic charr development (Figure 3a). The expression of 1603 and 2459 paralog groups differed significantly between developmental timepoints at the 1% and 5% levels of false discovery rate (FDR), respectively (Dataset 1). The difference was most pronounced between prehatching (timepoints: 141, 163, 200 τs) and post hatching embryos (timepoint 433 τs), as more than 70% of the paralog groups with FDR below 1% had higher expression in the latter (Figure 3a). Gene Ontology analyses reveal six enriched GO categories (below 10%FDR). The most drastic changes were seen in processes related to glycolysis (GO:0006096, FDR = 0.0009), where the expression of 19 out of 25 paralog groups changed during this developmental period. The other five classes that were differentially expressed during charr development are: ion transport (GO:0006811, FDR = 0.027), blood coagulation (GO:0007596, FDR = 0.03), DNA repair (GO:0006281, FDR = 0.08) and two immune related categories (GO:0019882, FDR = 0.08, GO:0006955, FDR = 0.09). Those results probably reflect developmental changes and/or differences in the environment of embryos before and after hatching.

24f79c98-11b0-45dc-b0d7-8355c5754509_figure3.gif

Figure 3. Heatmap of differentially expressed genes in the Arctic charr developmental transcriptome.

Two morphs (SB and AC) are represented, at four timepoints. (A) The 1603 genes with expression difference among time points, here clustered into four groups. (B) The 71 genes differentially expressed between morphs are clustered into 4 groups for each morph. High expression is indicated by blue and low expression by beige.

Differential expression between Arctic charr morphs

The embryos were reared in a common garden setting, which minimizes the impact of environmental factors, as we are interested in genes showing expression differences between the two morphs. In the data 296 paralog groups were differentially expressed (FDR < 5%) between the morphs (141 higher in SB and 152 higher in AC-charr, Dataset 1). Among genes with higher expression in SB-charr two biological GO categories were enriched: blood coagulation (GO:0007596, p = 0.001) and proteolysis (GO:0006508, p = 0.002). Recall, expression of blood coagulation factors also differed between developmental stages (see above). In AC-charr, genes in three categories: respiratory electron transport chain (GO:0022904, p = 0.0006), ATP synthesis coupled electron transport (GO:0042773, p = 0.002) and neurotransmitter transport (GO:0006836, p = 0.009) have higher expression. The first two GO categories both relate to energy generation in mitochondria and could reflect higher expression of genes with mitochondrial functions in AC-charr. At more stringent FDR (1%), 31 paralog groups, with diverse functional annotations, were higher expressed in SB and 40 genes higher in AC-charr (Figure 3b, Table 1 and Table 2). The higher expressed ESTs were clustered into 4 groups for each morph, reflecting in some cases functional similarity. For instance SB cluster 3 has three immune related paralog groups: Complement factor D (9), H-2 class I histocompatibility antigen L-D alpha chain (2) and Sushi domain-containing protein 2 (4) (Table 1). Note, however, that immune genes were not significantly enriched in the GO comparison of morphs. The results suggest genes with mitochondrial function, blood coagulation and other functions are differentially expressed between the morphs. Note, because only two morphs are compared, then those genes implicate pathways involved in either ecological divergence in SB charr or adaptation of the AC charr during breeding50. But as few samples were sequenced, qPCR verification was needed.

Table 1. Differentially expressed genes, with higher expression in the SB morph from Lake Thingvallavatn.

NRNameAbbrContlogFClogCPMFDRCluster
3766Histone H3 embryonic18.712.747.80E-035S-1
5103Natterin-like Nattl 62.757.127.76E-007S-2
356A7J6M9 Putative uncharacterized protein n175R12.334.663.30E-006S-1
6697Q1KY05 Main olfactory receptor-like Sorf 53.126.929.96E-005S-1
8151Sushi domain-containing protein 2 Susd2 42.205.550.0001S-3
1682Carcinoembryonic antigen-related cell adhesion
molecule 1
Ceacam1 32.553.830.0002S-1
6228Protein FAM98A21.964.760.0003S-1
7531STAM-binding protein-like Stampbl1 22.072.620.0005S-1
6712Q1M160 Myc-regulated DEAD box protein11.673.230.0009S-1
2300Cytosolic sulfotransferase 3 Sult3st1 31.732.130.0009S-1
2063Complement factor D Cfd 71.796.420.0016S-3
3326Galectin-3-binding protein A41.793.850.0017S-4
3169Flocculation protein 11 Flo11 21.864.050.0017S-1
1203B5XDY0 H-2 class I histocompatibility antigen
L-D alpha chain
21.702.120.0028S-3
9183UPI000065D844 related cluster21.975.550.0028S-1
2909Epidermis-type lipoxygenase 3 Loxe3 41.684.840.0029S-1
4884Myeloperoxidase Mpo 42.206.780.0029S-1
10003Uridine phosphorylase 1 Upp1 41.513.000.0047S-1
2513Desmoglein-1-alpha Dsg1 11.592.800.0054S-2
377A7SJA8 Predicted protein (Fragment)11.732.500.0055S-3
9204UPI00006A2900 related cluster26.383.260.0064S-1
9642UPI00017B1B0F related cluster12.001.920.0064S-2
1965Coiled-coil domain-containing protein 136 Ccdc136 22.152.320.0064S-2
9260UPI0000F1D4BA PREDICTED11.802.410.0065S-2
738Adseverin Scin 81.585.510.0073S-1
9678UPI00017B4479 related cluster12.181.970.0074S-4
8339Testin Tes 41.504.930.0080S-2
6840Q4SNH3 Chromosome 8 SCAF1454311.424.000.0080S-1
1668Carbohydrate sulfotransferase 6 Chst7 12.092.080.0090S-4
8341Testisin Prss21 22.012.760.0090S-4
6373Protein asteroid homolog 1 Aste1 61.294.240.0090S-4

Name: name of unigene or paralog group

Abbr: Abbreviated paralog group or gene name

Cont: Number of contigs

logFC: log Fold Change

logCPM: log Counts Per Million

FDR: False Discovery Rate

The cluster numbering corresponds to Figure 3.

Table 2. Differentially expressed genes, with higher expression in the AC morph.

NRNameAbbrContlogFClogCPMFDRCluster
3465Glutathione S-transferase P 1 Gstp1 1-8.352.451.12E-019A-2
2475Dehydrogenase/reductase SDR family member 7 Dhrs7 2-4.882.159.67E-014A-3
6945Q6NWE8 Sb:cb283 protein3-6.083.022.15E-013A-2
399A8DW32 Predicted protein1-5.326.384.27E-010A-1
9682UPI00017B4B48 related cluster2-3.702.812.61E-008A-2
9817Uncharacterized protein ART25-12.636.898.23E-008A-2
6724Q2L0Z2 Putative ATP-dependent RNA helicase1-3.411.891.88E-007A-2
1197B5XD10 Vacuolar proton pump subunit G 1 Atpv1g1 1-4.302.101.84E-006A-2
5325Nucleoside diphosphate kinase B Nme2 1-9.857.632.51E-006A-1
9205UPI0000D5B923: myelin basic protein isoform 1 Mbpa 3-2.493.459.18E-006A-3
6377Protein broad-minded Tbc1d32 1-2.112.744.75E-005A-1
5711Pistil-specific extensin-like protein1-2.162.600.0002A-3
3203Formin-like protein 20 Fmnl2b 7-1.981.950.0002A-3
9315UPI0000F2EC69: hypothetical protein2-5.604.570.0005A-2
363A7RFV0 Predicted protein (Fragment)2-1.744.960.0010A-3
6937Q6AZT1 MGC81677 protein3-2.063.810.0014A-2
3756Histone H1 Histh1 3-2.264.540.0017A-2
1133B5DGN9 Creatine kinase-1 Ckm1 7-4.725.500.0017A-3
309A1IMH7 CD80-like protein Cd80 12-1.944.290.0017A-2
7651Serine protease ami2-1.545.900.0017A-3
9935Uncharacterized protein C7orf63 homolog1-1.871.910.0025A-2
5219Nostrin Nostrin 2-2.553.380.0029A-2
1855Chondroitin sulfate N-acetylgalactosaminyl-
transferase 2
Csgalnact2 5-2.566.140.0034A-1
10203Xylose isomerase6-1.552.430.0035A-3
2249Cytochrome c oxidase subunit 3 Cox3 11-1.7811.150.0035A-3
18040S ribosomal protein S3-B Rps3b 2-5.318.670.0050A-1
1227B6NBL3 Putative uncharacterized protein3-1.592.950.0050A-2
5055NADH-ubiquinone oxidoreductase chain 6 Nd6 2-1.482.650.0061A-3
4634Metallothionein A Mta 1-3.335.440.0064A-2
342A5C0J4 Putative uncharacterized protein2-2.582.470.0064A-2
9698UPI00019258B4: similar to epithelial cell
transforming sequence 2 oncogene protein partial
1-2.062.940.0064A-2
5878Pro-opiomelanocortin B Pomcb 1-2.045.600.0065A-2
2248Cytochrome c oxidase subunit 2 Cox2 9-2.219.830.0074A-2
1246B8JI87 Novel protein similar to vertebrate collagen
type VI alpha 3 (COL6A3) (Fragment)
1-1.693.160.0080A-3
7994Sperm-associated antigen 5 Spag5 1-2.073.710.0080A-2
9515UPI000175F90F: similar to pleckstrin homology
domain containing family A member 7
1-2.001.870.0090A-2
1124B5DDZ4 Acta1 protein Actc1b 1-1.522.620.0090A-2
1127B5DG94 2-peptidylprolyl isomerase A Ppia1 2-2.565.670.0090A-1
9175UPI000054A3C0 PREDICTED: apolipoprotein B3-1.324.090.0090A-4
9671UPI00017B3C62 related cluster1-1.511.920.0096A-1

For column header explanation, see footer of Table 1.

Validation of gene expression differences in whole embryos and paralog specific expression of natterin genes

For validation we opted for qPCR analyses of 9 genes/paralog groups in whole embryos and 8 in embryonic heads (see next section), which showed differential expression between AC and SB-charr, with statistical support ranging from <1% to about 10% FDR. We studied paralog groups with less FDR support, in part to be able to cast a wider net (see below). Of the nine paralog groups studied in whole embryos, five were confirmed to be differentially expressed between AC and SB-charr at 161 or 200 τs (Figure 4, S4 Table and Dataset 2). Part of the reason may be that the transcriptome covered four developmental time points, but the validation only two. Three genes, Nattl, Alkaline phosphatase (Alp) and Lysozyme C II (Lyz2), had significantly higher expression in SB. The other two, Keratin-associated protein 4-3 (Krtap4-3) and Poly polymerase 6 (Parp6) had higher expression in AC embryos (Figure 4, S4 Table). No morph and time interaction was detected for any of the genes.

24f79c98-11b0-45dc-b0d7-8355c5754509_figure4.gif

Figure 4. qPCR validation of candidates from transcriptome in whole embryos of Arctic charr.

Relative expression of 9 genes (AI) analysed by qPCR in the small benthic (SB) charr from Lake Thingvallavatn and aquaculture (AC) charr at two different developmental timepoints (161 and 200 τs). 5 genes were differentially expressed between the two morphs (Alp, Krtap4-3, Lyz, Nattl, Parp6), while 4 further genes did not show significant expression differences between morphs (Cgat2, Cox6B1, Ndub6, Ubl5), see S4 Table. Error bars represent standard deviation calculated from two biological replicates.

As some genes are represented by different contigs or even paralogs, we set out to disentangle the expression of one paralog group Nattern-like (Nattl) in detail. We measured the expression of three natterin paralogs (nattl1, nattl2 and nattl3), by designing qPCR primers that matched divergent regions. These genes caught our interest because the only prior work implicated Natterin as a toxin produced by a tropical fish70,71. We studied nattl expression in several developmental stages in AC-, SB- and PL-charr as well as in selected tissues of adult AC-charr. The expression level of the three paralogs differed between morphs and timepoints (Figure 5 and S5 Table). Overall nattl2 had the highest expression in all morphs. The nattl1 had higher expression in embryos of PL-charr than in AC- and SB-charr, while nattl2 and nattl3 were more expressed in SB-embryos. Note however, the efficiency of the primers for the nattl genes ranged from 1.72 to 1.77, which suggests this data should be interpreted with caution.

24f79c98-11b0-45dc-b0d7-8355c5754509_figure5.gif

Figure 5. Relative expression of Natterin-like and its three paralogs during charr development in different morphs.

The expression is graphed for different morphs (SB, AC and PL) at four developmental timepoints (161, 200, 256 & 315 τs, relative to AC-charr at timepoint 161. A) General nattl expression along charr development. BD) Expression of nattl paralogs 1–3. ANOVA showing the variation among morphs is summarized in S5 Table.

In order to evaluate the hypothesis that nattl genes have immune-related functions we studied expression in adult tissues (in AC-charr). The nattl expression was highest in the gills, followed by expression in kidney, skin and spleen. Low expression levels were detected in liver, intestine and heart (S1 Figure and S5 Table). The three nattl paralogs followed different patterns, whilst each of them showed significant expression differences among tissues. Nattl1 was mainly expressed in spleen and kidney, while nattl2 showed a significantly higher expression in skin, liver and in gills. Similarly, the relative expression of nattl3 was highest in the gills and skin. This indicates that the three nattl paralogs are expressed in a tissue specific manner, and also differently during the development of the three charr morphs studied here.

Expression differences in the developing heads of benthic and limnetic charr morphs

The transcriptome only compared two morphs, but we want to find genes with relationship with benthic form or ecology. Thus we next compared two benthic (SB, LB) and two limnetic charr (AC, PL). To get a handle on the craniofacial divergence between sympatric Arctic charr morphs we used qPCR to study 8 paralog groups with expression difference in the RNA-seq data (all higher in SB). We focused on those with known craniofacial expression in zebrafish development72. We analyzed heads at three time-points (178, 200 and 218 τs) as this period overlaps with early stages of craniofacial skeletal formation in Arctic charr73,74. The qPCR confirmed the higher expression of seven out of these eight genes in the head of benthic charr compared to limnetic charr (Figure 6, S2 Figure and Dataset 3). These seven genes are Claudin 4 (Cldn4), adseverin (Scin), Junction plakoglobin (Jup), Lipolysis stimulated lipoprotein receptor (Lsr), Major vault protein (Mvp), Transforming growth factor beta receptor II (Tgfbr2) and Vitamin D receptor a (Vdra). The eighth gene, Retinoic acid receptor gamma-A (Rarg) gave a small but significant response in the head, but the effects were reversed, i.e. the expression was higher in AC. The expression difference of the seven genes was, in almost all cases, consistent over the three timepoints studied (See S2 Figure). In summary the qPCR confirmed the differential expression of 12 of the 17 paralog groups studied (Table 3), some which had 5–10% FDR support. The data reveal notable expression differences between these two charr morphs, and can lead to hypotheses about morph specific variation in particular structures, like the developing head. However this transcriptome should not be taken at face value, because a substantial fraction of signals were false positives.

24f79c98-11b0-45dc-b0d7-8355c5754509_figure6.gif

Figure 6. Expression differences of craniofacial candidate genes in developing head of Arctic charr morphs.

Relative expression ratios, calculated from the qPCR data, were subjected to an ANOVA to test the expression differences amongst four charr groups and three time points (τs). The underlined gene names reflect significant difference between SB and AC-charr. A post hoc Tukey’s test (HSD) was performed to determine the effects of morphs, time and morph by time interaction (M X T). White boxes represent low expression, while black boxes represent high expression. The shading represents significant different expression between the samples (α = 0.05, NS = not significant). The genes studied were, Claudin 4 (Cldn4), adseverin (Scin), Junction plakoglobin (Jup), Lipolysis stimulated lipoprotein receptor (Lsr), Major vault protein (Mvp), Transforming growth factor beta receptor II (Tgfbr2) Vitamin D receptor a (Vdra) and Retinoic acid receptor gamma-A (Rarg).

Table 3. Correspondence of transcriptome and qPCR verification on Arctic charr embryos.

TissueNameAbbrFDRmFRDtEffectqPCRMorph
EmbryoAlkaline phosphatase Alp 0.0700.0010.986*SB
EmbryoChondroitin sulfate
N-acetylgalactosaminyltransferase 2
Cgat 0.0040.331-2.556
EmbryoCytochrome c oxidase subunit 6B1 Cox6b1 0.0580.632-1.208
EmbryoB5X596 Keratin-associated protein 4-3 Krtap4-3 0.0120.278-1.986*AC
EmbryoLysozyme C II Lyz2 0.0410.0011.138*SB
EmbryoNatterin-like protein Nattl 0.0000.0002.755*SB
EmbryoNADH dehydrogenase [ubiquinone] 1
beta subcomplex subunit 6
Ndub6 0.0980.670-1.175
EmbryoPoly [ADP-ribose] polymerase 6 Parp6 0.1080.379-0.986*AC
EmbryoUbiquitin-like protein 5 Ubl5 0.0590.003-1.234
HeadClaudin-4 Cldn4 0.0680.0001.343*SB/LB
HeadMajor vault protein Mvp 0.0650.5280.958*SB/LB
HeadJunction plakoglobin Jup 0.0510.0061.147*SB/LB
HeadLipolysis-stimulated lipoprotein receptor Lsr 0.0130.0431.369*SB/LB
HeadTGF-beta receptor type-2 Tgfbr2 0.0650.0131.728*SB/LB
HeadVitamin D3 receptor A Vdra 0.0530.0521.312*SB/LB
HeadRetinoic acid receptor gamma-A Rarg 0.0120.0011.403
HeadAdseverin Scin 0.0070.0001.578*SB/LB

Tissue: which tissue was studied

Abbr: abbreviated paralog group or gene name

FRDm: FDR for comparison of SB and AC-charr in transcriptome

FDRt: FDR for comparison among developmental timepoints in transcriptome

Effect: logarithm of fold change between morphs, positive is higher in SB and negative higher in AC-charr in transcriptome (logFC.morph in supplemental dataset 1)

qPCR: results consistent with transcriptome (*), a blank cell reflects lack of correspondence

Morph: which morph(s) had higher expression in qPCR verification

Analyses of polymorphism in Arctic charr transcriptome

The RNA-seq data also revealed segregating variations with large frequency differences between charr morphs. To uncover candidate SNPs we mapped the reads to all of the S. salar EST-contigs. Filtering on coverage yielded 165,790 candidate SNPs (Table 4); of those 66.569 came from reads that mapped uniquely and 57.009 candidate SNPs from reads that mapped to more than one contig; with limited overlap between lists. Assuming that the expression of paralogous genes is stable, then differences among paralogs appear as SNPs at similar frequency in all samples. By requiring variant frequency differences (p < 0.05, uncorrected) between samples we reduced the list of candidates by two thirds, yielding over 20.000 candidate SNPs. Note, as cDNA from charr families was sequenced (not a population sample), estimates of SNP frequencies are imprecise. To err on the side of caution, we chose SNP candidates with 50% or higher frequency difference between morphs for further study. The candidate SNPs were also summarized by frequency of the derived allele, in reference to the S. salar sequence. This gave 672 and 872 SNPs at higher frequency, in AC-charr and SB-charr, respectively. The uniquely and multiply mapped reads, revealed approximately similar numbers of candidate SNPs. Gene ontology analysis showed that for derived SNPs in SB, there was an excess of variants in genes related to translation, both as a broad category and specific subgroups (S6 Table). There was also enrichment of SNPs in genes related to DNA-mediated transposition, DNA integration, DNA replication and oxidation-reduction process. No GO categories were enriched for high frequency derived SNPs in AC. Furthermore, functional effects of the candidate SNPs (UTR, synonymous and non-synonymous) were predicted. The distribution among those categories did not differ between variants detected by uniquely or repeatedly mapped reads, χ[3]2=2.59, p = 0.46 (S7 Table).

Table 4. Candidate SNPs in the Arctic charr transcriptome, filtered by coverage, difference between sample and morphs and frequency difference between morphs.

SNP-candidatesMorphUniRepTotal
Total9623174341165790
Filter coverage6656957009113776
Diff. Bwn. samples214172225242869
Diff. Bwn. morphs113851295323974
Delta > 0.5AC396285672
Delta > 0.5SB526353872
Delta > 0.75AC9568159
Delta > 0.75SB15595248
Delta > 0.95aAC171330
Delta > 0.95aSB29433

SNP-candidates: found by mapping to S. salar ESTs

Uni/REP: from UNIquely or REPeatedly mapped RNA-reads

Delta: differences in allele frequency between morphs, categorized by which morph had the higher derived allele frequency

a The number of SNP-candidates before the redundant ones were removed

A total of 60 candidate SNPs are nearly fixed in one morph, with frequency difference between morphs above 95% (after manual inspection of contigs and SNP position three candidates were removed since they represented the same SNP). Of these “fixed” SNPs 46 came from uniquely mapped reads and 14 from reads that mapped more than twice (Table 5 and Table 6). For the SNPs from uniquely mapped reads, 17 are fixed in AC-charr and 29 in SB-charr. The few genes with two or more polymorphic sites were; Keratin type II cytoskeletal 3 (Krt3), Cysteine sulfinic acid decarboxylase (Csad) and DNA-directed RNA polymerase I subunit RPA12 (Rpa12) with 5, 5 and 2 SNPs respectively. Krt3 and Csad had significant differentiation in both SB and AC. Similarly, 14 SNPs with large differentiation between morphs were predicted from reads that mapped on two or more contigs (Table 6). Of these, we found two variants in the mitochondrial 60S ribosomal protein L36 (RpL36) and variants in 4 other mitochondrial genes (28S ribosomal protein S18a mitochondrial (MRPS18A), Apoptosis-inducing factor 1 mitochondrial (AIFM1), Isocitrate dehydrogenase [NADP] mitochondrial (acIDH1) and Protein S100-A1 (S100a1)), all at higher frequency in AC-charr. PCR and Sanger sequencing of population samples confirmed SNPs in DNA2-like helicase (Dna2), a gene with nuclear and mitochondrial function, and two other genes Uroporphyrinogen decarboxylase (Urod), and Mid1-interacting protein 1-like (Mid1ip1) (S2 Table). The candidate variant Eukaryotic translation initiation factor 4 gamma 2 (Eif4g2) was not substantiated by the PCR/sequencing.

Table 5. SNP candidates from uniquely mapped reads.

(a) Higher frequency in AC morph
ContigAnnotationPosRefVarFreq-SBFreq-ACEffect
SS2U026955Keratin type II cytoskeletal 3300AT0.0000.984synonymous
SS2U026955Keratin type II cytoskeletal 3309GA0.0000.996synonymous
SS2U033960Cysteine sulfinic acid decarboxylase192CG0.0001.0005prime
SS2U033960Cysteine sulfinic acid decarboxylase416GT0.0000.961G to V
SS2U033960Cysteine sulfinic acid decarboxylase945CA0.0040.956synonymous
SS2U043396Eukaryotic translation initiation factor 2-alpha
kinase 1
134AG0.0001.0005prime
SS2U043886Transcription cofactor HES-61308TC0.0001.0005prime
SS2U044339Intraflagellar transport protein 52 homolog479TC0.0211.000D to G
SS2U045168Putative Peptide prediction1275GA0.0001.0003prime
SS2U045328E3 ubiquitin-protein ligase DTX3L388GA0.0000.977synonymous
SS2U045990Low-density lipoprotein receptor-related protein 1135TC0.0000.969synonymous
SS2U048125aTransmembrane protein 131-like480GA0.0001.000synonymous
SS2U052747Uridine 5’-monophosphate synthase914GA0.0000.951synonymous
SS2U054542Mediator of RNA polymerase II transcription
subunit 20
474CT0.0270.995synonymous
SS2U056193SUMO-conjugating enzyme UBC996AT0.0001.0003prime
SS2U057101ETS domain-containing protein Elk-3440CG0.0001.0003prime
SS2U058860Voltage-dependent anion-selective channel
protein 2
681GT0.0001.0003prime
(b) Higher frequency in SB morph
ContigAnnotationPosRefVarFreq-SBFreq-ACEffect
SS2U000399Insulin-like growth factor-binding protein 7598CA1.0000.0003prime
SS2U004484Titin387GA0.9900.010synonymous
SS2U026826L-asparaginase363CT1.0000.000H to Y
SS2U026955Keratin type II cytoskeletal 3116CA0.9960.031T to N
SS2U026955Keratin type II cytoskeletal 3264CT0.9700.008synonymous
SS2U026955Keratin type II cytoskeletal 3317CT1.0000.002T to M
SS2U033960Cysteine sulfinic acid decarboxylase363CT1.0000.0255prime
SS2U033960Cysteine sulfinic acid decarboxylase387CT1.0000.030synonymous
SS2U033960Cysteine sulfinic acid decarboxylase657TC0.9900.031synonymous
SS2U034322Cyclin-C1094AG1.0000.0003prime
SS2U034431Dolichyl-diphosphooligosaccharide–protein
glycosyltransferase subunit 2
436GA0.9920.000G to S
SS2U036025Nuclear receptor coactivator 436GA1.0000.0435prime
SS2U040590Glutamyl-tRNA(Gln) amidotransferase subunit A
homolog
478GA0.9720.000synonymous
SS2U045606Superkiller viralicidic activity 2-like 2500CT1.0000.000synonymous
SS2U047816Squalene synthase1139GA1.0000.029synonymous
SS2U048063Lysine-specific demethylase NO66669CT1.0000.000synonymous
SS2U050394UPF0542 protein C5orf43 homolog596GA1.0000.000synonymous
SS2U050880aTransmembrane protein 131-like901CT1.0000.000A to V
SS2U052076Eukaryotic translation initiation factor 3 subunit A824CT1.0000.031synonymous
SS2U053417RNA polymerase-associated protein LEO1454GA1.0000.049synonymous
SS2U054333Scaffold attachment factor B2382GA0.9990.000V to M
SS2U054705Cell division protein kinase 4122AG0.9710.0003prime
SS2U054965DNA-directed RNA polymerase I subunit RPA12106GA1.0000.0005prime
SS2U054965DNA-directed RNA polymerase I subunit RPA12411TG1.0000.000synonymous
SS2U055120Chromatin modification-related protein MEAF6350AC1.0000.000H to P
SS2U055153Complexin-11191CA1.0000.0313prime
SS2U057635Mitogen-activated protein kinase 14B1370AT1.0000.0263prime
SS2U058169Transmembrane protein 50A1214CG0.9730.0003prime
SS2U058802Signal recognition particle 54 kDa protein607TA0.9690.000C to S

aThose genes are distinct paralogs

Table 6. SNP candidates with significant difference frequency between AC and SB morphs, from reads that mapped to two or more contigs.

ContigAnnotationPosRefVarFreq-SBFreq-ACEffect
SS2U004839Actin alpha sarcomeric/cardiac550AC0.0150.9993prime
SS2U02129828S ribosomal protein S18a mitochondrial462AC0.0001.000synonymous
SS2U041264Apoptosis-inducing factor 1 mitochondrial341CT0.0000.952synonymous
SS2U054211aCytoplasmic dynein 1 intermediate chain 2136TC0.0180.974synonymous
SS2U054362aQ08CA8 Dynein cytoplasmic 1 intermediate
chain 2
945AG0.0001.000synonymous
SS2U055923Bystin1623AC0.0000.9833prime
SS2U058758Protein S100-A1253CT0.0000.984synonymous
SS2U059000Isocitrate dehydrogenase [NADP]
mitochondrial
1654TC0.0000.9753prime
SS2U05914660S ribosomal protein L36263TG0.0091.000synonymous
SS2U05914660S ribosomal protein L36470AC0.0091.000synonymous
SS2U036667Heterogeneous nuclear ribonucleoprotein K813CT1.0000.0225prime
SS2U042873RNA polymerase-associated protein LEO1460GA1.0000.000synonymous
SS2U058455Adenylosuccinate lyase1616CT1.0000.0003prime
SS2U058906Mid1-interacting protein 1-like350GT0.9850.000E to D

aThose genes are distinct paralogs

Polymorphism and expression of Arctic charr mtDNA

Considering the enrichment of differentially expressed genes related to mitochondrial energy metabolism (above), and high frequency candidate SNPs in several genes with mitochondrial function in AC-charr we decided to study the mitochondrial transcriptome further. The charr studied here reflect metabolic extremes, the aquaculture charr was bred for growth while the small benthic morph is thought to have experienced natural selection for slow metabolism and retarded growth38,75. Although mRNA preparation protocols were used for generating cDNA for the RNA-sequencing, a substantial number of reads came from non-polyadenylated sequences. By mapping the reads to mtDNA sequence of Arctic charr we could estimate expression and infer polymorphism both in genes and intergenic regions. There was a clear difference in sequencing coverage, with more than twice as many reads mapped from the AC- compared to SB-charr (mean fold difference 2.27, Wilcoxon test, p < 0.0004). Note, as only two types of fish are compared, the polarity of expression divergence is unknown.

The mapped RNA-reads were used to identify polymorphism and divergence in the entire mitochondrial chromosome. The polymorphisms were found by mapping to mtDNA from a Canadian S. alpinus48, but ancestral vs. derived status inferred by comparison to S. salar mtDNA. This revealed 82 candidate sites, including 35 that represent divergence between Icelandic and Canadian charr. A total of 20 candidate SNPs had high (more than 50%) frequency difference between SB- and AC-charr (Figure 7). There was no bias in the distribution of derived SNPs, 11 on the AC branch and 9 in SB. The divergence between Iceland and Canada is particularly little in the 12s and 16s ribosomal RNA genes. Curiously two SNPs in those genes differed strongly in frequency between morphs (Figure 7). To confirm and better estimate the frequency of variants in the ribosomal genes, we PCR amplified and sequenced two ~550 bp regions in the rRNA genes. Because of our interest in the evolutionary genetics of sympatric charr, we three morphs (PL, LB and SB) from Lake Thingvallavatn (Figure 8A, C & E, S2 Table). The 12s polymorphism (m1829G>A) differed significantly between the morphs (χ[2]2 = 8.6, p = 0.014), and was at highest frequency in the SB (0% in PL, 12.5% in LB and 75% in SB). Similarly m3411C>T in the 16s was enriched in SB (62.5%) but found at lower frequency in PL (0%) and LB (12.5%) (it differed significantly between morphs, χ[2]2 = 9.3333, p = 0.009). The Sanger sequencing also revealed three other polymorphisms in the amplified region, not seen in the transcriptome. Among those m3211T>C in the 16s gene was at 75% frequency in LB, but not found in the other morphs (χ[2]2 = 19.76, p < 0.0001).

24f79c98-11b0-45dc-b0d7-8355c5754509_figure7.gif

Figure 7. Genetic divergence in the mtDNA between SB- and AC-charr.

The frequency differences between morphs of candidate SNPs, estimated from the RNA-sequencing, graphed along the mtDNA chromosome. The SNPs indicate whether the derived allele is of higher frequency in SB (black dots) or AC (open circles). Sites of divergence between the Icelandic stocks and the Canadian reference sequence are indicated by triangles. The two black boxes represent the rRNA genes and gray boxes the 14 coding sequences (abbreviated names underneath each gene).

24f79c98-11b0-45dc-b0d7-8355c5754509_figure8.gif

Figure 8. Comparative genomics and population genetic differentiation in Arctic charr at 3 mtDNA locations.

Three variants in the 12s and 16s RNA genes are segregating in charr morphs in Lake Thingvallavatn. A, C, E) Frequency of each of those variants in three morphs from Lake Thingvallavatn (PL, LB and SB). A total of 8 individuals were genotyped from each morph, see methods. B, D, F) Aligned are several fish genomes, with Lamprey or humans as outgroups, reflecting a 38 bp window around each of the 3 positions (). Indicated are the two Arctic charr alleles, the reference allele (S._alpinus_REFcharr_WT) and the derived variant (S._alpinus_VARcharr_M). B) Alignment of variant m1829G>A in the 12s rRNA gene in fishes, using humans as an outgroup. D) Similar alignment of a 16s variant, m3211T>C and F) alignment of variant m3411C>T in the 16s rRNA gene.

In order to gauge the potential functionality of those variants we aligned the rRNA genes from nearly hundred fishes and several vertebrates. The position affected by m1829G>A and m3211T>C, in the 12s and 16s rRNAs, are not well conserved in fishes or vertebrates (Figure 8B & D). However m3411C>T, in the 16s rRNA, alters a position that is nearly invariant in 100 fish genomes (Figure 8F). The only exception is Pacific menhaden, which curiously also has T in this position. This region could not be aligned properly in other vertebrates. Thus m3411C>T alters a conserved position, but probably not very drastically as the introduced allele is tolerated in another fish species.

NR;Unigene.Description;NR.contigs;logCPM;logFC.morph;logFC.T163;logFC.T200;logFC.T433;FDR.morph;FDR.time;Contigs
1;1;1;2.612484616;-0.225481503;-0.278873417;-0.508896253;-1.277691095;0.747951606;0.249821976;SS2U035087
2;1-acyl-sn-glycerol-3-phosphate acyltransferase epsilon;4;3.761073585;-0.037996738;-0.049978651;-0.214128465;-0.287112446;0.960307572;0.980234357;"SS2U018930;SS2U019592;SS2U039760;SS2U056048
3;1-acyl-sn-glycerol-3-phosphate acyltransferase gamma;5;6.641146181;-0.093743693;0.20009448;-0.238354348;-0.208334783;0.88435103;0.892076961;"SS2U004154;SS2U024396;SS2U048217;SS2U050512;SS2U055142
4;1-acylglycerol-3-phosphate O-acyltransferase ABHD5;1;2.133993891;0.49521831;0.023509611;1.118101512;2.324916304;0.401948832;2.13E-05;SS2U003655
5;1-phosphatidylinositol-3-phosphate 5-kinase;7;5.260268835;-0.38689962;-0.088015122;-0.391712255;-0.113987932;0.465032901;0.944528332;"SS2U002134;SS2U003087;SS2U004468;SS2U006309;SS2U044956;SS2U047955;SS2U052927
6;1-phosphatidylinositol-45-bisphosphate phosphodiesterase delta-3-A;3;2.341483498;0.431834652;0.057641376;1.060875195;1.827508509;0.493633343;0.005589471;"SS2U009205;SS2U022276;SS2U023144
7;1-phosphatidylinositol-45-bisphosphate phosphodiesterase delta-4;2;2.264883133;0.792747977;-0.097681734;0.863114439;1.270034862;0.20906477;0.102563277;"SS2U022953;SS2U040057
8;1-phosphatidylinositol-45-bisphosphate phosphodiesterase gamma-2;10;3.139508136;0.713188012;0.090462865;0.212322212;1.519687203;0.212528803;0.017349671;"SS2U000135;SS2U008251;SS2U009524;SS2U009982;SS2U011052;SS2U017905;SS2U041812;SS2U042526;SS2U043584;SS2U056769
9;10 kDa heat shock protein mitochondrial;6;7.799633887;-0.862114545;-0.110956924;-1.044483907;-1.673802659;0.165095491;0.031331196;"SS2U004717;SS2U005582;SS2U025053;SS2U028699;SS2U050788;SS2U053447
10;116 kDa U5 small nuclear ribonucleoprotein component;3;7.000213188;0.486918577;-0.367990988;-0.215463197;-1.133955925;0.360141222;0.246758537;"SS2U003487;SS2U033745;SS2U052181
11;12-dihydroxy-3-keto-5-methylthiopentene dioxygenase;3;3.911848586;-0.723764887;-0.025457788;-0.792186481;-0.944435434;0.212472367;0.298942451;"SS2U002791;SS2U012428;SS2U056621
12;14 kDa phosphohistidine phosphatase;4;5.244222064;-0.563773699;0.160789827;-0.661330316;-0.340718352;0.344871943;0.628141603;"SS2U004897;SS2U053842;SS2U056111;SS2U057209
13;14-3-3 protein beta/alpha-1;8;9.171313556;0.095614462;0.035511723;0.041090437;-0.19442016;0.88064536;0.988917928;"SS2U009914;SS2U014987;SS2U015011;SS2U038869;SS2U042558;SS2U054347;SS2U058799;SS2U058972
14;14-3-3 protein beta/alpha-2;7;8.957141502;-0.257379786;0.006140266;-0.363991125;-0.695437341;0.656199827;0.592338255;"SS2U003874;SS2U007688;SS2U010089;SS2U013448;SS2U025534;SS2U058852;SS2U058868
15;14-3-3 protein epsilon;8;8.667318144;-0.361145939;0.160119787;-0.156305471;-0.294410443;0.502884329;0.90900795;"SS2U006277;SS2U014641;SS2U032523;SS2U036452;SS2U039538;SS2U052995;SS2U056978;SS2U057649
16;14-3-3 protein eta;1;6.600213965;-0.42158307;0.410260345;0.019051378;-0.168586586;0.428541857;0.814944143;SS2U056360
17;14-3-3 protein gamma-1;3;4.327066324;0.085545254;0.321091797;1.355584646;2.381201245;0.914552447;0.000281919;"SS2U020224;SS2U033530;SS2U046718
18;14-3-3 protein gamma-2;1;4.510861236;0.765738803;0.639947348;2.663870715;3.600739346;0.379845184;2.59E-05;SS2U048701
19;14-3-3 protein zeta;3;6.875487454;-0.335563171;0.145279794;-0.292905615;-0.232669211;0.573194022;0.917840857;"SS2U000658;SS2U051741;SS2U058533
20;14-3-3 protein zeta/delta;2;7.428260156;0.427798182;-0.140877964;0.108542693;0.392081067;0.408709329;0.851513193;"SS2U016659;SS2U057927
21;14-alpha-glucan-branching enzyme;2;3.042413021;0.892710917;0.106418452;1.375322749;1.922063649;0.207401194;0.017934593;"SS2U026017;SS2U028058
22;15 kDa selenoprotein;2;6.253954585;-0.80529457;0.195399573;-0.999801208;-1.240689902;0.227415942;0.115855957;"SS2U056695;SS2U058959
23;15-hydroxyprostaglandin dehydrogenase [NAD+];4;5.251629565;0.183546552;0.135330677;-0.141998365;0.570774647;0.775348257;0.678955932;"SS2U010083;SS2U038717;SS2U057358;SS2U058207
24;17-beta-hydroxysteroid dehydrogenase 14;3;5.185466229;0.31567291;-0.109987412;0.159190769;0.444034696;0.574472376;0.834254827;"SS2U006677;SS2U033760;SS2U058371
25;2'3'-cyclic-nucleotide 3'-phosphodiesterase;2;8.077383965;-0.218525486;0.367732124;-0.01492356;-0.600848565;0.715628762;0.42991632;"SS2U042736;SS2U056939
26;2-acylglycerol O-acyltransferase 2-A;5;2.458927261;0.428000924;0.274668818;0.437833355;0.635828036;0.481229598;0.840235407;"SS2U009307;SS2U011994;SS2U029798;SS2U041706;SS2U052121
27;2-amino-3-carboxymuconate-6-semialdehyde decarboxylase;1;2.922103392;-0.097074048;-0.182504475;-0.036632019;0.038738542;0.912496047;0.998274817;SS2U052082
28;2-amino-3-ketobutyrate coenzyme A ligase mitochondrial;3;4.52535201;-0.263590115;0.139116392;-0.012539865;0.253874869;0.640419788;0.979824326;"SS2U006645;SS2U007274;SS2U058373
29;2-aminoethanethiol dioxygenase;3;3.497900691;-0.321419314;0.36456262;0.001915721;-0.193790211;0.575455719;0.854908114;"SS2U012362;SS2U047445;SS2U055590
30;2-hydroxyacyl-CoA lyase 1;3;5.200967177;0.404513275;-0.131646828;0.359150262;0.759905736;0.481095107;0.449404569;"SS2U003230;SS2U014852;SS2U051718
31;2-oxoglutarate and iron-dependent oxygenase domain-containing protein 1;4;4.173033846;-0.060619158;-0.089973463;-0.374285612;-0.852045365;0.927630034;0.457784822;"SS2U021246;SS2U041176;SS2U043117;SS2U048634
32;2-oxoglutarate and iron-dependent oxygenase domain-containing protein 2;4;2.698309587;-0.684351189;-0.022296588;-0.710502718;-0.073093846;0.212528803;0.656271941;"SS2U020964;SS2U023809;SS2U024697;SS2U041648
33;2-oxoglutarate dehydrogenase mitochondrial;6;6.656969148;0.397717801;0.079638703;0.771518231;1.686102482;0.518480722;0.012739482;"SS2U015898;SS2U027755;SS2U030749;SS2U040484;SS2U042130;SS2U047766
34;2-oxoisovalerate dehydrogenase subunit alpha mitochondrial;2;4.705668206;0.789048388;-0.012571542;0.588147276;1.170022501;0.17017232;0.145758626;"SS2U014675;SS2U043384
35;2-oxoisovalerate dehydrogenase subunit beta mitochondrial;3;6.331992067;-0.184567693;0.013826487;-0.205154242;-0.00152498;0.752680634;0.989961948;"SS2U018362;SS2U049433;SS2U055173
36;24-dienoyl-CoA reductase mitochondrial;1;4.961320773;0.315645176;-0.149037773;0.297366645;1.09369054;0.584644751;0.103584083;SS2U044796
37;25-hydroxycholesterol 7-alpha-hydroxylase;2;3.214382274;-0.222220961;-0.223709437;-0.091760327;0.622466861;0.719686573;0.477324406;"SS2U035375;SS2U055951
38;26S protease regulatory subunit 4;22;8.533552286;-0.367148747;-0.057635086;-0.650346274;-0.945953669;0.515375627;0.295606682;"SS2U000228;SS2U010151;SS2U011752;SS2U011753;SS2U012688;SS2U012933;SS2U013810;SS2U013811;SS2U013935;SS2U020575;SS2U020715;SS2U023197;SS2U036612;SS2U036613;SS2U037972;SS2U040248;SS2U042370;SS2U045373;SS2U047133;SS2U052199;SS2U058522;SS2U058550
39;26S protease regulatory subunit 6A;18;8.253677439;-0.17228184;-0.189995137;-0.675727099;-0.853383109;0.782910075;0.422594111;"SS2U004029;SS2U008932;SS2U009083;SS2U009894;SS2U010142;SS2U011408;SS2U015041;SS2U033647;SS2U033648;SS2U033649;SS2U033650;SS2U040816;SS2U044050;SS2U044051;SS2U050352;SS2U051921;SS2U056860;SS2U059095
40;26S protease regulatory subunit 6B;7;7.126090461;0.009834256;-0.242365433;-0.30581166;-0.745460691;0.989071431;0.642677932;"SS2U002692;SS2U007157;SS2U009523;SS2U028733;SS2U038597;SS2U057664;SS2U058595
41;26S protease regulatory subunit 7;5;8.376547781;-0.257052465;-0.134738764;-0.710431026;-0.872461241;0.675286814;0.374988036;"SS2U000417;SS2U015749;SS2U029765;SS2U034493;SS2U058796
42;26S protease regulatory subunit 8;18;8.230321707;0.05270079;-0.225639511;-0.608322928;-1.023704563;0.941180218;0.309606235;"SS2U007232;SS2U008594;SS2U009304;SS2U013322;SS2U032380;SS2U032381;SS2U032382;SS2U037695;SS2U037696;SS2U040409;SS2U040410;SS2U042743;SS2U049808;SS2U050333;SS2U050641;SS2U051057;SS2U054751;SS2U057654
43;26S protease regulatory subunit S10B;6;7.65562158;-0.203435027;-0.167311415;-0.5384128;-0.974634262;0.72409881;0.306164559;"SS2U000606;SS2U006113;SS2U010477;SS2U044081;SS2U054959;SS2U057794
44;26S proteasome complex subunit DSS1;6;6.887659987;-0.774315096;0.181132612;-0.858714018;-1.019254593;0.208104783;0.175993729;"SS2U000916;SS2U008456;SS2U020081;SS2U020626;SS2U051119;SS2U059023
45;26S proteasome non-ATPase regulatory subunit 1;4;8.917522541;0.078399876;-0.010462799;-0.228966095;-0.21244349;0.90594062;0.981227175;"SS2U012719;SS2U036322;SS2U046523;SS2U057465
46;26S proteasome non-ATPase regulatory subunit 10;4;4.90235986;-0.118297419;-0.214363556;-0.601840846;-1.064868546;0.849579808;0.242014629;"SS2U010644;SS2U032193;SS2U040530;SS2U056913
47;26S proteasome non-ATPase regulatory subunit 11;6;7.109670026;-0.235081304;0.001951351;-0.288034111;-0.641287535;0.681065747;0.66409136;"SS2U018584;SS2U022136;SS2U022137;SS2U040196;SS2U046815;SS2U057146
48;26S proteasome non-ATPase regulatory subunit 12;9;7.13409551;-0.235948125;0.018766092;-0.390877057;-0.580103261;0.681690774;0.685201513;"SS2U011282;SS2U011613;SS2U012390;SS2U012391;SS2U020242;SS2U028769;SS2U053263;SS2U054778;SS2U054831
49;26S proteasome non-ATPase regulatory subunit 13;5;7.292928441;0.025174124;-0.076697993;-0.36904132;-0.774026842;0.972489366;0.534208271;"SS2U007629;SS2U012279;SS2U012322;SS2U038513;SS2U057731
50;26S proteasome non-ATPase regulatory subunit 14;6;7.77420275;-0.355224582;-0.030704389;-0.65508484;-1.140569281;0.541332864;0.163843833;"SS2U005680;SS2U012949;SS2U020653;SS2U024034;SS2U041001;SS2U056977
51;26S proteasome non-ATPase regulatory subunit 2;5;8.186805901;0.2427975;-0.135570494;-0.086270125;-0.313739032;0.675271169;0.976879367;"SS2U005642;SS2U041625;SS2U042926;SS2U051028;SS2U053413
52;26S proteasome non-ATPase regulatory subunit 3;3;7.899890138;-0.067114858;-0.110041332;-0.295265304;-0.626164189;0.917998;0.743983161;"SS2U000463;SS2U052183;SS2U058552
53;26S proteasome non-ATPase regulatory subunit 4;7;7.908815489;0.017318065;-0.133741333;-0.34933992;-0.511466553;0.981079705;0.851731748;"SS2U015561;SS2U029338;SS2U034552;SS2U036709;SS2U046483;SS2U051587;SS2U058665
54;26S proteasome non-ATPase regulatory subunit 5;7;4.869183843;-0.306241424;-0.078909095;-0.580967681;-1.229394279;0.5836968;0.114239288;"SS2U012282;SS2U013293;SS2U017568;SS2U018206;SS2U038185;SS2U048666;SS2U055930
55;26S proteasome non-ATPase regulatory subunit 6;6;7.346566165;-0.42608542;-0.138841393;-0.69599827;-1.110825811;0.434436135;0.189179238;"SS2U011170;SS2U033952;SS2U033953;SS2U054527;SS2U056315;SS2U057164
56;26S proteasome non-ATPase regulatory subunit 7;7;7.470946361;-0.400421495;-0.097805971;-0.772007365;-1.179148614;0.463117205;0.118341502;"SS2U010858;SS2U013445;SS2U019052;SS2U036834;SS2U048656;SS2U056703;SS2U056777
57;26S proteasome non-ATPase regulatory subunit 8;3;6.64641373;-0.313928299;-0.096714438;-0.646478964;-0.895896348;0.571700033;0.32586206;"SS2U016668;SS2U019905;SS2U058847
58;26S proteasome non-ATPase regulatory subunit 9;2;5.773556489;-0.459594803;0.038376908;-0.716815273;-0.782819986;0.436328465;0.383842162;"SS2U040755;SS2U058260
59;28 kDa heat- and acid-stable phosphoprotein;3;6.171767363;0.109339439;-0.128155366;-0.421473556;-0.63830012;0.864347717;0.725119944;"SS2U011068;SS2U047224;SS2U049439
60;28S ribosomal protein S11 mitochondrial;1;5.203915635;0.572861559;-0.470927495;0.190371684;0.239793828;0.323318217;0.728972213;SS2U056130
61;28S ribosomal protein S12 mitochondrial;3;5.427490213;-0.031845995;0.205320505;-0.487298981;-0.309306247;0.970050329;0.757679185;"SS2U017647;SS2U048115;SS2U051845
62;28S ribosomal protein S14 mitochondrial;1;5.128497011;-0.47441701;-0.185092754;-0.777058943;-1.240536351;0.396288574;0.139626385;SS2U055706
63;28S ribosomal protein S15 mitochondrial;4;5.501242752;-0.688277631;-0.073414991;-0.716551038;-0.696018301;0.215652119;0.509195192;"SS2U018180;SS2U028076;SS2U052753;SS2U056438
64;28S ribosomal protein S16 mitochondrial;5;5.422273596;-0.699601404;0.056692936;-0.775105155;-1.095121695;0.23827036;0.195950521;"SS2U019386;SS2U028793;SS2U038914;SS2U051880;SS2U055666
65;28S ribosomal protein S17 mitochondrial;1;3.698179019;-0.781067796;0.013740296;-0.250256492;-0.436823351;0.140788912;0.890427338;SS2U052929
66;28S ribosomal protein S18a mitochondrial;4;4.84299107;-0.63831584;0.042755114;-0.506040998;-0.669871827;0.238808747;0.576445807;"SS2U004691;SS2U021298;SS2U045590;SS2U057048
67;28S ribosomal protein S18b mitochondrial;3;5.508608188;-0.688429994;-0.020533866;-0.912165529;-0.9583115;0.234125835;0.224932303;"SS2U006506;SS2U012078;SS2U058582
68;28S ribosomal protein S18c mitochondrial;2;4.448254959;-1.242911541;0.191601846;-1.035553529;-1.265491362;0.067934031;0.096962162;"SS2U037873;SS2U054775
69;28S ribosomal protein S2 mitochondrial;4;4.156927822;0.506744993;-0.31807741;0.562772152;0.628290306;0.41233619;0.439788593;"SS2U009977;SS2U022108;SS2U022557;SS2U047360
70;28S ribosomal protein S21 mitochondrial;3;4.954435408;-0.897268292;0.297736865;-0.653767446;-0.430177306;0.186885004;0.608125734;"SS2U010989;SS2U010990;SS2U058039
71;28S ribosomal protein S22 mitochondrial;1;4.762075071;-0.167867263;0.084831144;-0.317253119;-0.204942406;0.780057818;0.92373926;SS2U052885
72;28S ribosomal protein S23 mitochondrial;3;5.638584938;-0.514081797;0.016439839;-0.671154438;-0.728621347;0.374825667;0.480773721;"SS2U043224;SS2U050518;SS2U055511
73;28S ribosomal protein S24 mitochondrial;1;4.856519781;-0.489962276;0.024117224;-0.610672455;-0.633718218;0.377381943;0.558476639;SS2U058450
74;28S ribosomal protein S25 mitochondrial;1;4.733867569;-0.790927035;-0.293817414;-1.317193043;-1.865835929;0.238329153;0.022618824;SS2U055707
75;28S ribosomal protein S26 mitochondrial;1;4.345595394;-0.68315987;0.112223002;-0.618365597;-0.460598881;0.286197167;0.71545054;SS2U047977
76;28S ribosomal protein S27 mitochondrial;4;4.731640031;-0.374618796;0.011200305;-0.345597686;-0.441173895;0.489805548;0.851600158;"SS2U034246;SS2U038384;SS2U041131;SS2U046008
77;28S ribosomal protein S28 mitochondrial;1;4.505666963;-1.028222902;0.188322294;-0.779662945;-0.661260452;0.122884871;0.447183828;SS2U058926
78;28S ribosomal protein S29 mitochondrial;1;6.597229352;0.013732677;0.000722904;-0.336260958;-0.237481976;0.985691689;0.947300455;SS2U056402
79;28S ribosomal protein S30 mitochondrial;4;5.240659923;-0.47584848;-0.095550638;-0.457352316;-0.508734647;0.37782767;0.815165066;"SS2U006502;SS2U006503;SS2U047973;SS2U052792
80;28S ribosomal protein S31 mitochondrial;3;4.964838903;-0.27951276;-0.037148585;-0.380414415;-0.321805332;0.635125282;0.919480863;"SS2U021444;SS2U047048;SS2U049762
81;28S ribosomal protein S33 mitochondrial;5;4.898911448;-0.550446693;0.053994499;-0.499990827;-0.739544151;0.296349215;0.472180402;"SS2U003850;SS2U007973;SS2U021798;SS2U036682;SS2U050839
82;28S ribosomal protein S34 mitochondrial;4;5.864085834;-0.040451501;0.040315913;-0.013629602;0.001429209;0.954288703;0.999555498;"SS2U016987;SS2U038996;SS2U056137;SS2U057302
83;28S ribosomal protein S35 mitochondrial;3;5.25740306;-0.052795555;-0.199060509;-0.479862344;-0.533731855;0.941737343;0.829968986;"SS2U002256;SS2U009639;SS2U055926
84;28S ribosomal protein S36 mitochondrial;4;5.43307422;-0.934530715;0.102337898;-0.864566062;-0.519667864;0.137182715;0.463025962;"SS2U013845;SS2U049500;SS2U049950;SS2U051234
85;28S ribosomal protein S5 mitochondrial;1;6.178530985;0.023186476;-0.189013133;-0.131140732;-0.00132169;0.975059328;0.992628004;SS2U052099
86;28S ribosomal protein S6 mitochondrial;1;3.879335649;-0.816243792;-0.00025288;-0.88482926;-0.894100441;0.14962952;0.233227714;SS2U058065
87;28S ribosomal protein S7 mitochondrial;5;4.940592381;-0.454465422;-0.111763416;-0.469467501;-0.74687189;0.411646096;0.619699253;"SS2U013106;SS2U013628;SS2U018480;SS2U054257;SS2U058541
88;28S ribosomal protein S9 mitochondrial;6;5.495421144;-0.111091831;-0.00708016;-0.236545782;-0.190926038;0.862085985;0.983437449;"SS2U006485;SS2U006486;SS2U015726;SS2U020944;SS2U050118;SS2U050872
89;3 beta-hydroxysteroid dehydrogenase type 7;3;3.48671514;-0.174860214;-0.066814768;-0.04981122;0.841527514;0.780265362;0.275895001;"SS2U036774;SS2U042422;SS2U056948
90;3'(2')5'-bisphosphate nucleotidase 1;7;4.849270994;-0.287841079;-0.166702746;-0.775132734;-1.13972179;0.645678099;0.198949412;"SS2U001678;SS2U025147;SS2U025148;SS2U034920;SS2U034921;SS2U042847;SS2U052711
91;3'-5' exoribonuclease 1;4;4.470430025;0.02279238;-0.103065279;-0.406062083;-0.700904269;0.975719147;0.646306174;"SS2U028207;SS2U028632;SS2U039327;SS2U052405
92;3'-5' exoribonuclease CSL4 homolog;1;5.868949005;0.739119967;-0.267601046;-0.044932866;0.061994606;0.147679878;0.967595152;SS2U049850
93;3-hydroxy-3-methylglutaryl-coenzyme A reductase;2;4.557159487;-0.135559043;0.362867627;0.230801883;0.476259806;0.82407821;0.892356028;"SS2U003076;SS2U055576
94;3-hydroxyacyl-CoA dehydrogenase type-2;4;6.698483102;0.146351129;-0.08990561;-0.15821137;0.060377516;0.832016291;0.994002833;"SS2U020095;SS2U023246;SS2U038157;SS2U057905
95;3-hydroxyanthranilate 34-dioxygenase;4;2.806312613;-0.784021498;0.329333314;0.343323797;-0.062139894;0.180123247;0.916947218;"SS2U006638;SS2U009895;SS2U009973;SS2U057913
96;3-hydroxybutyrate dehydrogenase type 2;2;6.274424607;0.125435903;-0.396453228;-0.511679208;-1.088528138;0.839803511;0.273416156;"SS2U034664;SS2U057977
97;3-hydroxyisobutyrate dehydrogenase mitochondrial;7;7.236679117;0.090590492;-0.001247416;0.010709836;0.274198658;0.888504031;0.971597254;"SS2U005697;SS2U008752;SS2U008753;SS2U009052;SS2U021506;SS2U039141;SS2U057617
98;3-hydroxyisobutyryl-CoA hydrolase mitochondrial;2;2.954833712;0.489151851;-0.700792529;0.195210922;0.437298775;0.46067388;0.432283716;"SS2U008687;SS2U045701
99;3-ketoacyl-CoA thiolase mitochondrial;6;7.05521624;0.319854961;-0.134167994;0.299334467;1.958246854;0.557600901;8.39E-06;"SS2U011940;SS2U013257;SS2U015495;SS2U053380;SS2U054192;SS2U058414
100;3-mercaptopyruvate sulfurtransferase;3;4.70146886;0.014550328;-0.2324319;-0.062748838;0.189315049;0.984455486;0.935887704;"SS2U015199;SS2U055198;SS2U057713
101;3-oxo-5-alpha-steroid 4-dehydrogenase 2;8;2.274953094;0.427539106;1.032875885;1.562785999;3.637908425;0.517605632;8.21E-10;"SS2U006473;SS2U010008;SS2U011564;SS2U045326;SS2U047204;SS2U047887;SS2U050754;SS2U052433
102;3-oxo-5-alpha-steroid 4-dehydrogenase 3;2;3.073396424;-1.395723203;0.04121692;-1.061170922;-1.280657543;0.034617034;0.108381277;"SS2U002622;SS2U039252
103;3-oxo-5-beta-steroid 4-dehydrogenase;2;1.881881779;-0.740713388;0.696503513;0.310488911;0.985125315;0.212033724;0.476871638;"SS2U030161;SS2U058423
104;3-oxoacyl-[acyl-carrier-protein] reductase;1;3.451483003;-0.198678211;-0.231535703;-0.861951831;-1.103377868;0.7674607;0.229366518;SS2U055976
105;3-oxoacyl-[acyl-carrier-protein] synthase mitochondrial;5;3.273610448;0.312415135;-0.247170465;-0.355600779;-0.716089603;0.589502488;0.723844181;"SS2U022454;SS2U022455;SS2U029834;SS2U033191;SS2U040650
106;3-phosphoinositide-dependent protein kinase 1;6;5.056949073;0.282977969;-0.045338465;0.438192622;0.787280815;0.638424983;0.442699727;"SS2U003646;SS2U025719;SS2U036683;SS2U052207;SS2U052369;SS2U053579
107;32-trans-enoyl-CoA isomerase mitochondrial;1;5.060236514;0.315473526;-0.291278524;0.162652782;1.062159009;0.604924622;0.093632544;SS2U042027
108;35 kDa SR repressor protein;3;1.824060517;-0.090947361;-0.420009053;-0.984891278;-1.342427156;0.907995592;0.16417265;"SS2U011092;SS2U011093;SS2U044490
109;39S ribosomal protein L1 mitochondrial;1;5.177307963;-0.323738425;-0.049886142;-0.438618079;-0.915599747;0.571141184;0.386355032;SS2U055407
110;39S ribosomal protein L10 mitochondrial;3;5.715818581;-0.223386475;-0.142401725;-0.621886385;-0.791811989;0.727156104;0.528478991;"SS2U034633;SS2U034634;SS2U050021
111;39S ribosomal protein L11 mitochondrial;3;6.129370374;-0.208981484;-0.151828368;-0.459695098;-0.683866177;0.728722982;0.674289321;"SS2U040747;SS2U045809;SS2U058684
112;39S ribosomal protein L12 mitochondrial;2;4.536190266;0.358462055;-0.24703571;0.335856908;-0.279791463;0.534445794;0.74165247;"SS2U033104;SS2U049370
113;39S ribosomal protein L13 mitochondrial;1;5.438678271;-0.827448493;0.130593086;-0.955806005;-1.099559439;0.170893461;0.117431739;SS2U056671
114;39S ribosomal protein L14 mitochondrial;2;5.311487374;-0.34798134;-0.134347978;-0.459120653;-0.725428274;0.516992493;0.602359158;"SS2U032587;SS2U057378
115;39S ribosomal protein L15 mitochondrial;4;5.035147451;-0.241334197;-0.067527135;-0.452019819;-0.599939486;0.678434104;0.702954532;"SS2U022409;SS2U023636;SS2U049843;SS2U053236
116;39S ribosomal protein L16 mitochondrial;4;6.648619769;-0.08631435;-0.149228221;-0.350240078;-0.469581461;0.898604882;0.900911339;"SS2U016460;SS2U016461;SS2U038594;SS2U057356
117;39S ribosomal protein L17 mitochondrial;2;5.86768091;-0.744910067;-0.101125029;-1.035016689;-1.501523128;0.188940894;0.030490293;"SS2U050385;SS2U056116
118;39S ribosomal protein L18 mitochondrial;1;6.309002485;-0.386618785;-0.176737656;-0.831236584;-0.857913722;0.523052614;0.38211911;SS2U056937
119;39S ribosomal protein L19 mitochondrial;1;5.896177159;-0.131518567;0.2313727;-0.063457004;-0.484252344;0.836544192;0.705272715;SS2U053687
120;39S ribosomal protein L2 mitochondrial;1;5.552983554;-0.318211192;-0.032473287;-0.404551784;-0.407090663;0.571141184;0.86445178;SS2U057312
121;39S ribosomal protein L20 mitochondrial;1;5.278083083;-0.077848179;-0.046665525;-0.020785944;-0.096000264;0.912496047;0.999555498;SS2U053878
122;39S ribosomal protein L21 mitochondrial;8;4.224376319;-0.75590183;0.024464784;-1.008466385;-0.90382141;0.21602768;0.231624465;"SS2U010704;SS2U013739;SS2U013933;SS2U013934;SS2U038895;SS2U041427;SS2U047273;SS2U058407
123;39S ribosomal protein L22 mitochondrial;3;5.244309686;-0.516914069;-0.058946198;-0.97044511;-1.263009161;0.407946904;0.121512861;"SS2U016291;SS2U050145;SS2U054934
124;39S ribosomal protein L23 mitochondrial;3;5.197030096;-0.555859684;0.19229398;-0.345522864;-0.39427692;0.326068291;0.791610133;"SS2U008492;SS2U013708;SS2U057159
125;39S ribosomal protein L27 mitochondrial;3;4.99338042;-0.704390323;0.08497137;-0.761488498;-1.06680453;0.214798302;0.164372349;"SS2U038771;SS2U053259;SS2U054678
126;39S ribosomal protein L28 mitochondrial;2;5.300619754;-0.729310668;-0.063198979;-0.601530912;-0.931788269;0.175912764;0.34163887;"SS2U008947;SS2U056040
127;39S ribosomal protein L3 mitochondrial;4;6.266283074;-0.527294063;-0.052400825;-0.866063251;-1.314892154;0.362884154;0.088288292;"SS2U013236;SS2U024727;SS2U031652;SS2U057424
128;39S ribosomal protein L30 mitochondrial;1;4.735344317;-0.754210073;0.143856598;-0.914041748;-1.123315398;0.190623113;0.088956851;SS2U051550
129;39S ribosomal protein L32 mitochondrial;1;4.917150465;-1.207786973;-0.033537429;-1.060099337;-1.582610093;0.065286136;0.04801013;SS2U053873
130;39S ribosomal protein L33 mitochondrial;2;4.092306614;-0.468501766;-0.185186067;-0.280945789;-0.347189797;0.389837556;0.966087757;"SS2U037885;SS2U051385
131;39S ribosomal protein L34 mitochondrial;4;5.34001297;-0.466183609;-0.139518328;-0.88384886;-1.113991936;0.405474401;0.159190878;"SS2U001799;SS2U013652;SS2U027329;SS2U055779
132;39S ribosomal protein L35 mitochondrial;4;4.200381326;-0.696453539;-0.116528193;-0.511421101;-0.967129586;0.19414407;0.368588042;"SS2U005254;SS2U025138;SS2U033600;SS2U058807
133;39S ribosomal protein L36 mitochondrial;3;5.417134086;-0.256032107;-0.052635576;-0.859917079;-1.382752996;0.712641469;0.090561601;"SS2U028768;SS2U043854;SS2U049454
134;39S ribosomal protein L37 mitochondrial;3;6.317582597;-0.438880049;-0.180490262;-0.759362953;-1.155591025;0.457823217;0.20864797;"SS2U035367;SS2U039089;SS2U055924
135;39S ribosomal protein L38 mitochondrial;2;6.321815641;-0.517264645;0.036483579;-0.779815842;-1.037346626;0.38455226;0.213215093;"SS2U048951;SS2U054937
136;39S ribosomal protein L39 mitochondrial;2;6.006336765;-0.220292173;-0.151526374;-0.576115522;-0.219385077;0.739930234;0.869481224;"SS2U017884;SS2U056150
137;39S ribosomal protein L4 mitochondrial;5;5.929808321;-0.673821958;-0.052850131;-0.706406445;-1.038526809;0.23991553;0.267829139;"SS2U006279;SS2U021272;SS2U040354;SS2U048841;SS2U055172
138;39S ribosomal protein L40 mitochondrial;3;4.859063827;-0.344024423;-0.135593088;-0.392436379;-0.54347843;0.526771416;0.819677819;"SS2U013862;SS2U044032;SS2U056037
139;39S ribosomal protein L41 mitochondrial;5;5.298867234;-0.708500843;-0.085491762;-0.775445792;-0.879812344;0.207942093;0.349510887;"SS2U011136;SS2U038797;SS2U046510;SS2U053454;SS2U057739
140;39S ribosomal protein L42 mitochondrial;2;5.285781179;-0.893074076;0.075815787;-0.937984443;-1.144050318;0.143209077;0.12555562;"SS2U056691;SS2U056792
141;39S ribosomal protein L43 mitochondrial;3;5.075688659;-0.667868471;0.148598192;-0.760248287;-0.613131701;0.288868875;0.478151198;"SS2U013477;SS2U029916;SS2U045833
142;39S ribosomal protein L44 mitochondrial;3;4.947761995;-0.716080827;0.087785557;-0.697400642;-0.919080401;0.207518175;0.270779186;"SS2U021189;SS2U049856;SS2U052421
143;39S ribosomal protein L45 mitochondrial;3;5.479839444;0.061910215;-0.048939014;-0.119973616;-0.123651644;0.92581635;0.999257081;"SS2U002125;SS2U053436;SS2U055391
144;39S ribosomal protein L46 mitochondrial;1;2.969432085;-0.013139161;-0.084036457;0.024065176;0.042482158;0.985731307;0.999257081;SS2U051887
145;39S ribosomal protein L47 mitochondrial;4;5.452598664;-1.185380073;0.070689257;-1.134445672;-1.432367081;0.064657979;0.045025455;"SS2U030480;SS2U038270;SS2U041538;SS2U056898
146;39S ribosomal protein L48 mitochondrial;3;4.562146376;-0.700946297;0.039715687;-0.579842882;-0.591631592;0.229378559;0.657349377;"SS2U008519;SS2U048537;SS2U048878
147;39S ribosomal protein L49 mitochondrial;2;4.486326516;-0.182048214;-0.153526508;-0.605490848;-0.623873269;0.774390104;0.66134273;"SS2U006675;SS2U057613
148;39S ribosomal protein L51 mitochondrial;8;5.411348966;-0.161927305;-0.114885415;-0.537744091;-0.543240147;0.800370964;0.756957796;"SS2U010367;SS2U010368;SS2U028986;SS2U031642;SS2U033957;SS2U038559;SS2U050380;SS2U058545
149;39S ribosomal protein L52 mitochondrial;3;4.596197253;-1.120718106;-0.01630417;-0.965513726;-1.393877698;0.093655822;0.113195853;"SS2U034174;SS2U049566;SS2U050758
150;39S ribosomal protein L54 mitochondrial;1;4.507962555;-0.882959802;0.169780439;-0.646385989;-0.809712967;0.152396943;0.39864786;SS2U057626
151;39S ribosomal protein L55 mitochondrial;3;3.975908127;-1.000802122;0.142481288;-1.122761166;-1.279517915;0.147679878;0.10775621;"SS2U012610;SS2U024044;SS2U056943
152;39S ribosomal protein L9 mitochondrial;5;4.362588472;-0.642033502;-0.06748024;-0.714157114;-0.671702207;0.236172797;0.502755469;"SS2U012626;SS2U014974;SS2U016892;SS2U034354;SS2U058394
153;4-aminobutyrate aminotransferase mitochondrial;6;5.857306038;0.369779204;-0.085999639;0.270261912;1.541498659;0.559388013;0.016387721;"SS2U007540;SS2U008525;SS2U020940;SS2U047088;SS2U055984;SS2U058364
154;4-hydroxyphenylpyruvate dioxygenase;7;7.471477059;0.009531085;0.143571144;0.226343226;0.172558698;0.989876121;0.99256856;"SS2U002649;SS2U008845;SS2U009556;SS2U037434;SS2U040342;SS2U049835;SS2U050804
155;4-hydroxyphenylpyruvate dioxygenase-like protein;3;4.71279424;-0.451320374;0.038749918;0.392310753;1.346344415;0.428541857;0.048726422;"SS2U020097;SS2U030418;SS2U046989
156;40S ribosomal protein S10;18;11.30119868;-0.566245133;0.095781669;-0.772424828;-0.422849583;0.372617733;0.586833208;"SS2U000915;SS2U001018;SS2U001035;SS2U005235;SS2U011689;SS2U015412;SS2U025130;SS2U026413;SS2U028704;SS2U028731;SS2U029920;SS2U029957;SS2U031431;SS2U031475;SS2U040262;SS2U054485;SS2U056994;SS2U058977
157;40S ribosomal protein S11;13;11.0846024;-0.714603036;0.032796699;-0.929564137;-1.145767719;0.241069703;0.150685771;"SS2U000933;SS2U001073;SS2U010369;SS2U015637;SS2U015638;SS2U020360;SS2U021165;SS2U030511;SS2U034197;SS2U034201;SS2U036659;SS2U036660;SS2U059274
158;40S ribosomal protein S12;9;11.50626806;-0.334301272;-0.045802339;-0.582038243;-0.868060664;0.585264586;0.434742481;"SS2U001002;SS2U027522;SS2U031125;SS2U031427;SS2U039231;SS2U042211;SS2U043295;SS2U058547;SS2U059037
159;40S ribosomal protein S13;9;11.20602473;-0.77640495;0.116190573;-0.833889481;-1.075463592;0.221767046;0.212906649;"SS2U001145;SS2U018056;SS2U026393;SS2U027172;SS2U028645;SS2U055478;SS2U055880;SS2U057723;SS2U058887
160;40S ribosomal protein S14;14;11.6862451;-0.517183985;-0.094925952;-0.668505245;-0.971394564;0.420996535;0.424075674;"SS2U000838;SS2U001032;SS2U001200;SS2U001201;SS2U012807;SS2U019292;SS2U027247;SS2U029947;SS2U030989;SS2U031546;SS2U053538;SS2U059039;SS2U059101;SS2U059333
161;40S ribosomal protein S15;13;10.6650474;-0.968285907;0.077580942;-0.916051548;-1.145702001;0.134577942;0.164055802;"SS2U001080;SS2U001182;SS2U005067;SS2U025502;SS2U028966;SS2U030990;SS2U033876;SS2U038535;SS2U041663;SS2U042894;SS2U050373;SS2U058602;SS2U058711
162;40S ribosomal protein S15a;5;10.68823035;-0.921118946;0.091858973;-1.159601613;-1.337547735;0.161434355;0.065963864;"SS2U001020;SS2U012306;SS2U013337;SS2U026939;SS2U058636
163;40S ribosomal protein S16;5;10.99852905;-0.890572891;0.048703209;-0.876047848;-1.232254279;0.144650498;0.116624185;"SS2U023651;SS2U028709;SS2U029680;SS2U046325;SS2U059130
164;40S ribosomal protein S17;10;10.62790481;-1.081216954;0.108655709;-1.065323677;-1.243372535;0.117402108;0.122056163;"SS2U015615;SS2U020183;SS2U024386;SS2U026931;SS2U028761;SS2U030994;SS2U036835;SS2U057787;SS2U058292;SS2U058643
165;40S ribosomal protein S18;10;11.00126195;-0.530087872;-0.112187095;-0.815517814;-0.842611783;0.382362706;0.413820925;"SS2U005896;SS2U012455;SS2U027303;SS2U027709;SS2U030953;SS2U032080;SS2U033153;SS2U034242;SS2U058858;SS2U059099
166;40S ribosomal protein S19;9;10.74680263;-0.936461633;0.172100213;-0.62120229;-1.059116276;0.124884688;0.206324332;"SS2U000506;SS2U001777;SS2U005689;SS2U026127;SS2U027732;SS2U029997;SS2U033408;SS2U039901;SS2U059236
167;40S ribosomal protein S2;12;13.3847466;-0.287685533;-0.089449389;-0.595023422;-0.693171185;0.673412751;0.658997786;"SS2U000853;SS2U001028;SS2U001064;SS2U001203;SS2U014886;SS2U016679;SS2U028691;SS2U031477;SS2U031879;SS2U042709;SS2U057652;SS2U059318
168;40S ribosomal protein S20;14;11.51310408;-1.123606917;0.086666863;-1.189320125;-1.401474341;0.105911486;0.065727435;"SS2U001023;SS2U001131;SS2U026123;SS2U028798;SS2U029926;SS2U030006;SS2U030034;SS2U030589;SS2U030988;SS2U031410;SS2U037864;SS2U051707;SS2U056297;SS2U058931
169;40S ribosomal protein S21;5;9.971255377;-0.712505946;-0.019844534;-1.170637268;-1.55730588;0.312892033;0.065228362;"SS2U001052;SS2U014999;SS2U033246;SS2U039140;SS2U057712
170;40S ribosomal protein S23;11;11.31397637;-0.62420653;0.140513699;-0.670928697;-0.658783095;0.292343658;0.4633711;"SS2U001117;SS2U009858;SS2U027752;SS2U029936;SS2U029974;SS2U030924;SS2U045936;SS2U048393;SS2U051471;SS2U058281;SS2U058827
171;40S ribosomal protein S24;14;11.37506593;-1.169912602;0.121603689;-0.871035686;-0.299725983;0.086170964;0.555260754;"SS2U001017;SS2U001129;SS2U001222;SS2U004012;SS2U005215;SS2U005677;SS2U012452;SS2U028677;SS2U029617;SS2U029956;SS2U030015;SS2U030178;SS2U052351;SS2U059182
172;40S ribosomal protein S25;14;11.71240098;-0.826317538;0.036346673;-0.943810767;-1.152731321;0.181797936;0.143163093;"SS2U001009;SS2U001019;SS2U008283;SS2U013619;SS2U016816;SS2U019939;SS2U019940;SS2U028548;SS2U030986;SS2U030992;SS2U042904;SS2U045466;SS2U058771;SS2U059219
173;40S ribosomal protein S26;9;11.41527369;-0.575362998;-0.151154802;-0.864244981;-1.146714206;0.375915742;0.262527727;"SS2U000816;SS2U001158;SS2U006441;SS2U006442;SS2U009452;SS2U021415;SS2U026934;SS2U047178;SS2U057120
174;40S ribosomal protein S27;11;11.17324708;-0.764529982;0.093747649;-0.882059351;-0.893653496;0.218528292;0.267892782;"SS2U007314;SS2U017540;SS2U026091;SS2U041457;SS2U043906;SS2U050402;SS2U057917;SS2U058259;SS2U058404;SS2U058885;SS2U058968
175;40S ribosomal protein S27-like;1;4.587840422;-0.824602768;-0.090280476;-0.411274883;1.892297561;0.228831776;0.000928931;SS2U057231
176;40S ribosomal protein S27a;8;11.56338817;-0.267112495;-0.116238839;-0.513869872;-0.622574573;0.674158364;0.730477039;"SS2U001433;SS2U004552;SS2U006860;SS2U013941;SS2U026930;SS2U031015;SS2U058980;SS2U059069
177;40S ribosomal protein S28;6;10.04924555;-0.685973088;0.018269227;-0.895847397;-1.170987091;0.281203681;0.17274397;"SS2U004476;SS2U005237;SS2U006868;SS2U013735;SS2U039927;SS2U057533
178;40S ribosomal protein S29;5;8.400378395;-0.486077579;0.083067968;-0.93534242;-1.034503195;0.499379778;0.242774046;"SS2U018512;SS2U027553;SS2U029914;SS2U042705;SS2U057853
179;40S ribosomal protein S3;14;11.60495338;-0.247658451;-0.214130542;-0.643792538;-0.859085889;0.694284351;0.488188213;"SS2U015493;SS2U016401;SS2U016417;SS2U017934;SS2U024171;SS2U024176;SS2U026025;SS2U033044;SS2U043900;SS2U054205;SS2U056275;SS2U058313;SS2U059092;SS2U059150
180;40S ribosomal protein S3-B;2;8.670060843;-5.306182618;-0.21914068;-3.9385762;-5.364323587;0.004981796;0.000497716;"SS2U024172;SS2U024242
181;40S ribosomal protein S30;6;10.32704619;-0.900386129;0.13805772;-0.847054792;-1.14204532;0.148006414;0.142776116;"SS2U004199;SS2U008473;SS2U009203;SS2U058163;SS2U058348;SS2U058857
182;40S ribosomal protein S3a;12;12.11875446;-0.323021095;-0.150127867;-0.651026828;-0.891754628;0.607795262;0.4503829;"SS2U000581;SS2U000914;SS2U001005;SS2U001074;SS2U021468;SS2U026568;SS2U026578;SS2U029723;SS2U029903;SS2U029962;SS2U041592;SS2U059300
183;40S ribosomal protein S4;10;11.81082293;-0.129648843;-0.10193833;-0.487885183;-0.616590274;0.845018766;0.723157116;"SS2U000435;SS2U000538;SS2U000921;SS2U000946;SS2U012729;SS2U027223;SS2U034080;SS2U047630;SS2U059246;SS2U059273
184;40S ribosomal protein S4 X isoform;3;8.250730069;0.338488034;-0.738463477;-0.305519637;-0.202058701;0.732107145;0.904496173;"SS2U013110;SS2U019290;SS2U036013
185;40S ribosomal protein S5;9;11.84212606;-0.307513461;-0.090244577;-0.531700762;-0.764342416;0.600901576;0.544437508;"SS2U000891;SS2U005512;SS2U025584;SS2U026048;SS2U026119;SS2U037589;SS2U053399;SS2U059230;SS2U059285
186;40S ribosomal protein S5a;7;7.634660321;-1.370832398;0.22819518;-2.011796235;-1.755119853;0.142001566;0.021179957;"SS2U001172;SS2U001205;SS2U003625;SS2U004951;SS2U010119;SS2U029949;SS2U049428
187;40S ribosomal protein S6;18;11.682397;-0.530257435;0.057048154;-0.81526032;-1.000421449;0.373338492;0.213371025;"SS2U000643;SS2U000644;SS2U000990;SS2U001115;SS2U001175;SS2U017514;SS2U020757;SS2U022066;SS2U023709;SS2U025536;SS2U026532;SS2U031843;SS2U033480;SS2U040727;SS2U040728;SS2U042826;SS2U059014;SS2U059029
188;40S ribosomal protein S7;10;10.83095385;-1.147907883;0.169981044;-1.105844186;-1.331483239;0.095429058;0.075697682;"SS2U000929;SS2U001085;SS2U001086;SS2U004603;SS2U017677;SS2U021443;SS2U022969;SS2U024798;SS2U045464;SS2U059278
189;40S ribosomal protein S8;11;11.60920508;-0.722684205;0.014943405;-0.817533938;-0.976004299;0.228831776;0.26544142;"SS2U001103;SS2U005588;SS2U005694;SS2U005892;SS2U019368;SS2U024534;SS2U029942;SS2U030975;SS2U030981;SS2U058718;SS2U059167
190;40S ribosomal protein S9;11;11.26481092;-0.62540428;-0.031252622;-0.791210032;-1.249100646;0.279233281;0.121333019;"SS2U001140;SS2U007081;SS2U012819;SS2U017419;SS2U019001;SS2U019002;SS2U030908;SS2U037501;SS2U048823;SS2U051332;SS2U059144
191;40S ribosomal protein SA;18;12.35384398;-0.206283857;-0.222297206;-0.728850128;-0.987533501;0.761525808;0.372771604;"SS2U010721;SS2U017034;SS2U023665;SS2U026750;SS2U026916;SS2U028646;SS2U028757;SS2U028805;SS2U030605;SS2U032474;SS2U035469;SS2U040825;SS2U042018;SS2U045438;SS2U050706;SS2U051930;SS2U059016;SS2U059073
192;45 kDa calcium-binding protein;3;4.552469539;0.380431642;-0.100520917;0.323487542;0.478385078;0.480260573;0.756485728;"SS2U036129;SS2U040294;SS2U050497
193;4F2 cell-surface antigen heavy chain;6;6.586196068;-0.285362074;0.3519648;0.338529986;1.377429948;0.618092793;0.046251512;"SS2U003595;SS2U015795;SS2U052061;SS2U055316;SS2U057504;SS2U057936
194;5'-3' exoribonuclease 1;2;4.436416467;0.407581376;-0.199090334;0.150193469;-0.189220305;0.486565928;0.957589653;"SS2U025174;SS2U041460
195;5'-3' exoribonuclease 2;6;7.803360787;0.377284377;-0.231776892;-0.17399318;-0.987660924;0.47893134;0.336932189;"SS2U011779;SS2U041060;SS2U047319;SS2U047944;SS2U052560;SS2U053918
196;5'-AMP-activated protein kinase catalytic subunit alpha-1;3;4.039945533;0.517418396;-0.194877035;0.185694805;0.139632619;0.350173999;0.955733822;"SS2U028935;SS2U028953;SS2U038415
197;5'-AMP-activated protein kinase catalytic subunit alpha-2;1;1.899343997;1.148852501;0.32207873;2.290360785;4.515671059;0.159590239;1.46E-10;SS2U004328
198;5'-AMP-activated protein kinase subunit beta-1;5;6.429101503;-0.248146707;0.045858315;-0.445789558;-0.775663619;0.682145835;0.476871638;"SS2U016017;SS2U017648;SS2U017924;SS2U054450;SS2U055631
199;5'-AMP-activated protein kinase subunit gamma-1;3;4.130341499;0.702971288;-0.263262424;0.317340069;0.146820115;0.246955196;0.890770079;"SS2U032396;SS2U043720;SS2U046156
This is a portion of the data; to view all the data, please download the file.
Dataset 1.Parameters and multiple testing corrected p-values for expression analysis.
The file is tab-delimited and the columns are; “Unigene.Description”: the annotation for that gene/paralog group. “NR.contigs”: number of contigs with this annotation. “logCPM”: count per million, log-scale. "logFC.morph": Mean fold change between the morphs, log-scale. "logFC.T163", "logFC.T200", "logFC.T433": Mean fold change for each timepoints compared to timepoint 141, log-scale. "FDR.morph": P-value for morph difference, multiple testing corrected. "FDR.time": P-value for time differences, multiple testing corrected. "Contigs": SalmonDB id for the contigs with the specific annotation109.
Gene_Type;Gene;Morph;Relative_age;Biological_replicate;cDNA_No;Ct_value;Sample;Batch
Reference;Actb;AC;161;1;3;15.96261883;Whole_embryo;c
Reference;Actb;AC;161;2;3;16.32308578;Whole_embryo;c
Reference;Actb;AC;200;1;3;16.3116312;Whole_embryo;c
Reference;Actb;AC;200;2;3;16.69984245;Whole_embryo;c
Reference;Actb;SB;161;1;3;15.91931581;Whole_embryo;c
Reference;Actb;SB;161;2;3;15.95784521;Whole_embryo;c
Reference;Actb;SB;200;1;3;17.22946262;Whole_embryo;c
Reference;Actb;SB;200;2;3;16.48554039;Whole_embryo;c
Reference;Ub2l3;AC;161;1;3;19.2323761;Whole_embryo;c
Reference;Ub2l3;AC;161;2;3;19.53557777;Whole_embryo;c
Reference;Ub2l3;AC;200;1;3;19.7100153;Whole_embryo;c
Reference;Ub2l3;AC;200;2;3;20.06556892;Whole_embryo;c
Reference;Ub2l3;SB;161;1;3;18.85280609;Whole_embryo;c
Reference;Ub2l3;SB;161;2;3;18.97263432;Whole_embryo;c
Reference;Ub2l3;SB;200;1;3;20.86740685;Whole_embryo;c
Reference;Ub2l3;SB;200;2;3;19.65790176;Whole_embryo;c
Reference;Ef1a;AC;161;1;3;16.76741409;Whole_embryo;c
Reference;Ef1a;AC;161;2;3;16.88599777;Whole_embryo;c
Reference;Ef1a;AC;200;1;3;17.02689171;Whole_embryo;c
Reference;Ef1a;AC;200;2;3;17.05676842;Whole_embryo;c
Reference;Ef1a;SB;161;1;3;16.1616497;Whole_embryo;c
Reference;Ef1a;SB;161;2;3;16.08823395;Whole_embryo;c
Reference;Ef1a;SB;200;1;3;17.47857857;Whole_embryo;c
Reference;Ef1a;SB;200;2;3;16.80790234;Whole_embryo;c
Reference;Actb;AC;161;1;4;15.44944715;Whole_embryo;c
Reference;Actb;AC;161;2;4;15.68050861;Whole_embryo;c
Reference;Actb;AC;200;1;4;15.74295759;Whole_embryo;c
Reference;Actb;AC;200;2;4;15.98812437;Whole_embryo;c
Reference;Actb;SB;161;1;4;15.04642916;Whole_embryo;c
Reference;Actb;SB;161;2;4;15.25384712;Whole_embryo;c
Reference;Actb;SB;200;1;4;16.69416809;Whole_embryo;c
Reference;Actb;SB;200;2;4;15.51182985;Whole_embryo;c
Reference;Ub2l3;AC;161;1;4;18.98914528;Whole_embryo;c
Reference;Ub2l3;AC;161;2;4;19.06344986;Whole_embryo;c
Reference;Ub2l3;AC;200;1;4;19.48450947;Whole_embryo;c
Reference;Ub2l3;AC;200;2;4;19.50106907;Whole_embryo;c
Reference;Ub2l3;SB;161;1;4;18.56895733;Whole_embryo;c
Reference;Ub2l3;SB;161;2;4;18.72522068;Whole_embryo;c
Reference;Ub2l3;SB;200;1;4;20.6594038;Whole_embryo;c
Reference;Ub2l3;SB;200;2;4;19.26242065;Whole_embryo;c
Reference;Ef1a;AC;161;1;4;16.48565102;Whole_embryo;c
Reference;Ef1a;AC;161;2;4;16.47541046;Whole_embryo;c
Reference;Ef1a;AC;200;1;4;16.72178936;Whole_embryo;c
Reference;Ef1a;AC;200;2;4;16.8230648;Whole_embryo;c
Reference;Ef1a;SB;161;1;4;15.88469839;Whole_embryo;c
Reference;Ef1a;SB;161;2;4;15.93828535;Whole_embryo;c
Reference;Ef1a;SB;200;1;4;17.21857929;Whole_embryo;c
Reference;Ef1a;SB;200;2;4;16.40386295;Whole_embryo;c
Candidate;Nattl;AC;161;1;3;24.30113316;Whole_embryo;c
Candidate;Nattl;AC;161;2;3;24.95383644;Whole_embryo;c
Candidate;Nattl;AC;200;1;3;23.1154232;Whole_embryo;c
Candidate;Nattl;AC;200;2;3;23.16105175;Whole_embryo;c
Candidate;Nattl;SB;161;1;3;21.88699722;Whole_embryo;c
Candidate;Nattl;SB;161;2;3;23.86600208;Whole_embryo;c
Candidate;Nattl;SB;200;1;3;21.4312315;Whole_embryo;c
Candidate;Nattl;SB;200;2;3;21.58208561;Whole_embryo;c
Candidate;Alp;AC;161;1;3;24.61887646;Whole_embryo;c
Candidate;Alp;AC;161;2;3;24.90855503;Whole_embryo;c
Candidate;Alp;AC;200;1;3;24.64563656;Whole_embryo;c
Candidate;Alp;AC;200;2;3;24.88164043;Whole_embryo;c
Candidate;Alp;SB;161;1;3;23.86744976;Whole_embryo;c
Candidate;Alp;SB;161;2;3;24.1090517;Whole_embryo;c
Candidate;Alp;SB;200;1;3;24.03513622;Whole_embryo;c
Candidate;Alp;SB;200;2;3;23.89897919;Whole_embryo;c
Candidate;Cgat2;AC;161;1;3;25.23556042;Whole_embryo;c
Candidate;Cgat2;AC;161;2;3;25.13300419;Whole_embryo;c
Candidate;Cgat2;AC;200;1;3;25.34113216;Whole_embryo;c
Candidate;Cgat2;AC;200;2;3;25.33448505;Whole_embryo;c
Candidate;Cgat2;SB;161;1;3;24.65633106;Whole_embryo;c
Candidate;Cgat2;SB;161;2;3;24.73155785;Whole_embryo;c
Candidate;Cgat2;SB;200;1;3;26.19965458;Whole_embryo;c
Candidate;Cgat2;SB;200;2;3;25.16437054;Whole_embryo;c
Candidate;Cox6b1;AC;161;1;4;26.7786026;Whole_embryo;c
Candidate;Cox6b1;AC;161;2;4;27.34981537;Whole_embryo;c
Candidate;Cox6b1;AC;200;1;4;26.94288731;Whole_embryo;c
Candidate;Cox6b1;AC;200;2;4;27.02507305;Whole_embryo;c
Candidate;Cox6b1;SB;161;1;4;26.77010155;Whole_embryo;c
Candidate;Cox6b1;SB;161;2;4;26.87522507;Whole_embryo;c
Candidate;Cox6b1;SB;200;1;4;26.58977795;Whole_embryo;c
Candidate;Cox6b1;SB;200;2;4;26.95159721;Whole_embryo;c
Candidate;Krtap4-3;AC;161;1;4;24.45112514;Whole_embryo;c
Candidate;Krtap4-3;AC;161;2;4;24.41178513;Whole_embryo;c
Candidate;Krtap4-3;AC;200;1;4;24.57724857;Whole_embryo;c
Candidate;Krtap4-3;AC;200;2;4;24.6350317;Whole_embryo;c
Candidate;Krtap4-3;SB;161;1;4;24.18867779;Whole_embryo;c
Candidate;Krtap4-3;SB;161;2;4;24.52984619;Whole_embryo;c
Candidate;Krtap4-3;SB;200;1;4;26.09012604;Whole_embryo;c
Candidate;Krtap4-3;SB;200;2;4;25.35136032;Whole_embryo;c
Candidate;Lyz;AC;161;1;3;25.649189;Whole_embryo;c
Candidate;Lyz;AC;161;2;3;25.93523693;Whole_embryo;c
Candidate;Lyz;AC;200;1;3;25.97491074;Whole_embryo;c
Candidate;Lyz;AC;200;2;3;26.36354256;Whole_embryo;c
Candidate;Lyz;SB;161;1;3;23.10821247;Whole_embryo;c
Candidate;Lyz;SB;161;2;3;23.59787178;Whole_embryo;c
Candidate;Lyz;SB;200;1;3;23.74123478;Whole_embryo;c
Candidate;Lyz;SB;200;2;3;23.9212904;Whole_embryo;c
Candidate;Ndub6;AC;161;1;4;20.99980164;Whole_embryo;c
Candidate;Ndub6;AC;161;2;4;21.25080109;Whole_embryo;c
Candidate;Ndub6;AC;200;1;4;21.03236389;Whole_embryo;c
Candidate;Ndub6;AC;200;2;4;21.15505123;Whole_embryo;c
Candidate;Ndub6;SB;161;1;4;20.56019783;Whole_embryo;c
Candidate;Ndub6;SB;161;2;4;20.64115429;Whole_embryo;c
Candidate;Ndub6;SB;200;1;4;21.33388996;Whole_embryo;c
Candidate;Ndub6;SB;200;2;4;20.87278366;Whole_embryo;c
Candidate;Parp6;AC;161;1;4;23.82729721;Whole_embryo;c
Candidate;Parp6;AC;161;2;4;23.62686062;Whole_embryo;c
Candidate;Parp6;AC;200;1;4;23.44495487;Whole_embryo;c
Candidate;Parp6;AC;200;2;4;24.04651356;Whole_embryo;c
Candidate;Parp6;SB;161;1;4;23.95689011;Whole_embryo;c
Candidate;Parp6;SB;161;2;4;23.98719311;Whole_embryo;c
Candidate;Parp6;SB;200;1;4;25.88320351;Whole_embryo;c
Candidate;Parp6;SB;200;2;4;23.96511269;Whole_embryo;c
Candidate;Ubl5;AC;161;1;3;20.95245171;Whole_embryo;c
Candidate;Ubl5;AC;161;2;3;21.51314068;Whole_embryo;c
Candidate;Ubl5;AC;200;1;3;21.69692421;Whole_embryo;c
Candidate;Ubl5;AC;200;2;3;21.88066006;Whole_embryo;c
Candidate;Ubl5;SB;161;1;3;20.72139168;Whole_embryo;c
Candidate;Ubl5;SB;161;2;3;20.6724329;Whole_embryo;c
Candidate;Ubl5;SB;200;1;3;21.8654623;Whole_embryo;c
Candidate;Ubl5;SB;200;2;3;21.64883995;Whole_embryo;c
Reference;Actb;AC;161;1;1;18.93461307;Whole_embryo;a
Reference;Actb;AC;161;2;1;17.01329973;Whole_embryo;a
Reference;Actb;AC;200;1;1;18.74925942;Whole_embryo;a
Reference;Actb;AC;200;2;1;17.38162289;Whole_embryo;a
Reference;Actb;AC;256;1;1;18.32057422;Whole_embryo;a
Reference;Actb;AC;256;2;1;18.25436369;Whole_embryo;a
Reference;Actb;AC;256;3;1;19.35329826;Whole_embryo;a
Reference;Actb;AC;315;1;1;17.83992698;Whole_embryo;a
Reference;Actb;AC;315;2;1;16.75994191;Whole_embryo;a
Reference;Actb;AC;315;3;1;17.49895169;Whole_embryo;a
Reference;Actb;PL;161;1;1;16.53899002;Whole_embryo;a
Reference;Actb;PL;161;2;1;16.014712;Whole_embryo;a
Reference;Actb;PL;161;3;1;16.62383843;Whole_embryo;a
Reference;Actb;PL;200;1;1;16.97808864;Whole_embryo;a
Reference;Actb;PL;200;2;1;17.30882522;Whole_embryo;a
Reference;Actb;PL;256;1;1;17.33051229;Whole_embryo;a
Reference;Actb;PL;256;2;1;18.05678958;Whole_embryo;a
Reference;Actb;PL;315;1;1;16.8715216;Whole_embryo;a
Reference;Actb;PL;315;2;1;17.2627397;Whole_embryo;a
Reference;Actb;PL;315;3;1;18.4954958;Whole_embryo;a
Reference;Actb;SB;161;1;1;18.10572111;Whole_embryo;a
Reference;Actb;SB;161;2;1;18.47548703;Whole_embryo;a
Reference;Actb;SB;200;1;1;19.51686616;Whole_embryo;a
Reference;Actb;SB;200;2;1;16.81035177;Whole_embryo;a
Reference;Actb;SB;256;1;1;16.57099441;Whole_embryo;a
Reference;Actb;SB;256;2;1;16.65354854;Whole_embryo;a
Reference;Actb;SB;256;3;1;16.74384742;Whole_embryo;a
Reference;Actb;SB;315;1;1;18.36778707;Whole_embryo;a
Reference;Actb;SB;315;2;1;16.24909757;Whole_embryo;a
Reference;Actb;SB;315;3;1;17.70580329;Whole_embryo;a
Reference;Actb;AC;161;1;1;17.90917178;Whole_embryo;b
Reference;Actb;AC;161;2;1;17.07442431;Whole_embryo;b
Reference;Actb;AC;200;1;1;18.11745198;Whole_embryo;b
Reference;Actb;AC;200;2;1;17.60052731;Whole_embryo;b
Reference;Actb;AC;315;1;1;16.81914311;Whole_embryo;b
Reference;Actb;AC;315;2;1;16.71034441;Whole_embryo;b
Reference;Actb;PL;161;1;1;16.66228787;Whole_embryo;b
Reference;Actb;PL;161;2;1;15.9647415;Whole_embryo;b
Reference;Actb;PL;161;3;1;16.5319537;Whole_embryo;b
Reference;Actb;PL;200;1;1;16.43611547;Whole_embryo;b
Reference;Actb;PL;200;2;1;16.13770159;Whole_embryo;b
Reference;Actb;PL;256;1;1;17.09882909;Whole_embryo;b
Reference;Actb;PL;256;2;1;17.18234183;Whole_embryo;b
Reference;Actb;PL;315;1;1;15.81195874;Whole_embryo;b
Reference;Actb;PL;315;2;1;16.2744054;Whole_embryo;b
Reference;Actb;SB;161;1;1;17.00400802;Whole_embryo;b
Reference;Actb;SB;161;2;1;16.56781516;Whole_embryo;b
Reference;Actb;SB;200;1;1;19.06980825;Whole_embryo;b
Reference;Actb;SB;200;2;1;17.14548894;Whole_embryo;b
Reference;Actb;SB;256;1;1;16.26166826;Whole_embryo;b
Reference;Actb;SB;256;2;1;16.40651416;Whole_embryo;b
Reference;Actb;SB;256;3;1;16.58124201;Whole_embryo;b
Reference;Actb;SB;315;1;1;17.83687183;Whole_embryo;b
Reference;Actb;SB;315;2;1;16.24142187;Whole_embryo;b
Reference;If5a1;AC;161;1;1;24.75698158;Whole_embryo;a
Reference;If5a1;AC;161;2;1;22.82441777;Whole_embryo;a
Reference;If5a1;AC;200;1;1;23.87932034;Whole_embryo;a
Reference;If5a1;AC;200;2;1;22.32171113;Whole_embryo;a
Reference;If5a1;AC;256;1;1;22.10594451;Whole_embryo;a
Reference;If5a1;AC;256;2;1;22.04629998;Whole_embryo;a
Reference;If5a1;AC;256;3;1;21.68510554;Whole_embryo;a
Reference;If5a1;AC;315;1;1;22.9018425;Whole_embryo;a
Reference;If5a1;AC;315;2;1;21.96694438;Whole_embryo;a
Reference;If5a1;AC;315;3;1;24.27062399;Whole_embryo;a
Reference;If5a1;PL;161;1;1;22.80112612;Whole_embryo;a
Reference;If5a1;PL;161;2;1;22.57955528;Whole_embryo;a
Reference;If5a1;PL;161;3;1;23.54804685;Whole_embryo;a
Reference;If5a1;PL;200;1;1;22.08827499;Whole_embryo;a
Reference;If5a1;PL;200;2;1;21.72163439;Whole_embryo;a
Reference;If5a1;PL;256;1;1;22.48477022;Whole_embryo;a
Reference;If5a1;PL;256;2;1;21.57767856;Whole_embryo;a
Reference;If5a1;PL;315;1;1;23.0637937;Whole_embryo;a
Reference;If5a1;PL;315;2;1;21.41490463;Whole_embryo;a
Reference;If5a1;PL;315;3;1;23.79193518;Whole_embryo;a
Reference;If5a1;SB;161;1;1;24.33332821;Whole_embryo;a
Reference;If5a1;SB;161;2;1;25.15546513;Whole_embryo;a
Reference;If5a1;SB;200;1;1;25.90748262;Whole_embryo;a
Reference;If5a1;SB;200;2;1;22.28793459;Whole_embryo;a
Reference;If5a1;SB;256;1;1;22.05466539;Whole_embryo;a
This is a portion of the data; to view all the data, please download the file.
Dataset 2.qPCR data for tests of expression in charr developing embryos and adult tissues.
“Gene Type”: Designates the reference and candidate genes. “Gene”: Name of the gene. “Morph”: Which charr type the sample came from. "Relative age": Developmental timepoint, and also indicates the samples from adult fish. "Biological replicate": The two or more biological replicates used. "cDNA No": Marks the cDNA isolation used. "Ct value": Estimate of gene expression. "Sample": Indicates the material used, whole embryos or distinct tissues. "Batch": Demarcates distinct collections of cDNA, applies only to nattl110.
Gene_Type;Gene;Morph;Relative_age;Biological_replicate;Ct_value;cDNA_No;Tissue
Reference;If5a1;AC;178;1;23.67264175;1;Pooled_heads
Reference;If5a1;SB;178;1;23.89719925;1;Pooled_heads
Reference;If5a1;PL;178;1;23.43337822;1;Pooled_heads
Reference;If5a1;LB;178;1;23.76682129;1;Pooled_heads
Reference;If5a1;AC;178;2;23.90053482;1;Pooled_heads
Reference;If5a1;SB;178;2;23.75086136;1;Pooled_heads
Reference;If5a1;PL;178;2;23.53201408;1;Pooled_heads
Reference;If5a1;LB;178;2;23.74039001;1;Pooled_heads
Reference;If5a1;AC;216;1;23.70517731;1;Pooled_heads
Reference;If5a1;SB;216;1;22.64871025;1;Pooled_heads
Reference;If5a1;PL;216;1;22.88567162;1;Pooled_heads
Reference;If5a1;LB;216;1;22.64291;1;Pooled_heads
Reference;If5a1;AC;216;2;23.10091476;1;Pooled_heads
Reference;If5a1;SB;216;2;22.47453308;1;Pooled_heads
Reference;If5a1;PL;216;2;22.3912973;1;Pooled_heads
Reference;If5a1;LB;216;2;22.60772491;1;Pooled_heads
Reference;Actb;AC;178;1;15.91521549;1;Pooled_heads
Reference;Actb;SB;178;1;15.83242464;1;Pooled_heads
Reference;Actb;PL;178;1;15.36369801;1;Pooled_heads
Reference;Actb;LB;178;1;15.46041203;1;Pooled_heads
Reference;Actb;AC;178;2;16.16721382;1;Pooled_heads
Reference;Actb;SB;178;2;15.57671585;1;Pooled_heads
Reference;Actb;PL;178;2;15.35849991;1;Pooled_heads
Reference;Actb;LB;178;2;15.59954109;1;Pooled_heads
Reference;Actb;AC;216;1;16.65059662;1;Pooled_heads
Reference;Actb;SB;216;1;15.450243;1;Pooled_heads
Reference;Actb;PL;216;1;15.78530502;1;Pooled_heads
Reference;Actb;LB;216;1;15.58950424;1;Pooled_heads
Reference;Actb;AC;216;2;15.99549103;1;Pooled_heads
Reference;Actb;SB;216;2;15.21378136;1;Pooled_heads
Reference;Actb;PL;216;2;15.38698196;1;Pooled_heads
Reference;Actb;LB;216;2;15.51268959;1;Pooled_heads
Candidate;Mvp;AC;178;1;22.9414444;1;Pooled_heads
Candidate;Mvp;SB;178;1;21.91384125;1;Pooled_heads
Candidate;Mvp;PL;178;1;22.16065979;1;Pooled_heads
Candidate;Mvp;LB;178;1;21.95458603;1;Pooled_heads
Candidate;Mvp;AC;178;2;23.06663322;1;Pooled_heads
Candidate;Mvp;SB;178;2;21.76210022;1;Pooled_heads
Candidate;Mvp;PL;178;2;22.28490448;1;Pooled_heads
Candidate;Mvp;LB;178;2;21.67274857;1;Pooled_heads
Candidate;Mvp;AC;216;1;23.39944839;1;Pooled_heads
Candidate;Mvp;SB;216;1;21.63397598;1;Pooled_heads
Candidate;Mvp;PL;216;1;22.65891266;1;Pooled_heads
Candidate;Mvp;LB;216;1;21.62683868;1;Pooled_heads
Candidate;Mvp;AC;216;2;23.40564346;1;Pooled_heads
Candidate;Mvp;SB;216;2;21.86926651;1;Pooled_heads
Candidate;Mvp;PL;216;2;22.54525375;1;Pooled_heads
Candidate;Mvp;LB;216;2;21.84273911;1;Pooled_heads
Candidate;Jup;AC;178;1;21.92790604;1;Pooled_heads
Candidate;Jup;SB;178;1;21.33343506;1;Pooled_heads
Candidate;Jup;PL;178;1;21.1556282;1;Pooled_heads
Candidate;Jup;LB;178;1;21.10895157;1;Pooled_heads
Candidate;Jup;AC;178;2;22.24541092;1;Pooled_heads
Candidate;Jup;SB;178;2;21.60882187;1;Pooled_heads
Candidate;Jup;PL;178;2;21.35161018;1;Pooled_heads
Candidate;Jup;LB;178;2;21.14461136;1;Pooled_heads
Candidate;Jup;AC;216;1;22.64751434;1;Pooled_heads
Candidate;Jup;SB;216;1;20.92277527;1;Pooled_heads
Candidate;Jup;PL;216;1;21.7883091;1;Pooled_heads
Candidate;Jup;LB;216;1;21.11831665;1;Pooled_heads
Candidate;Jup;AC;216;2;22.39131927;1;Pooled_heads
Candidate;Jup;SB;216;2;21.19046783;1;Pooled_heads
Candidate;Jup;PL;216;2;21.52971077;1;Pooled_heads
Candidate;Jup;LB;216;2;21.01268768;1;Pooled_heads
Candidate;Lsr;AC;178;1;25.98275757;1;Pooled_heads
Candidate;Lsr;SB;178;1;24.9202652;1;Pooled_heads
Candidate;Lsr;PL;178;1;25.09762383;1;Pooled_heads
Candidate;Lsr;LB;178;1;24.9207077;1;Pooled_heads
Candidate;Lsr;AC;178;2;26.35001755;1;Pooled_heads
Candidate;Lsr;SB;178;2;25.15621948;1;Pooled_heads
Candidate;Lsr;PL;178;2;25.43023682;1;Pooled_heads
Candidate;Lsr;LB;178;2;24.90939903;1;Pooled_heads
Candidate;Lsr;AC;216;1;26.66849518;1;Pooled_heads
Candidate;Lsr;SB;216;1;24.91859436;1;Pooled_heads
Candidate;Lsr;PL;216;1;25.9844017;1;Pooled_heads
Candidate;Lsr;LB;216;1;24.82223892;1;Pooled_heads
Candidate;Lsr;AC;216;2;26.38882828;1;Pooled_heads
Candidate;Lsr;SB;216;2;24.8479538;1;Pooled_heads
Candidate;Lsr;PL;216;2;25.85172272;1;Pooled_heads
Candidate;Lsr;LB;216;2;24.95061493;1;Pooled_heads
Candidate;Rarg;AC;178;1;22.7040844;1;Pooled_heads
Candidate;Rarg;SB;178;1;23.38894272;1;Pooled_heads
Candidate;Rarg;PL;178;1;22.54174995;1;Pooled_heads
Candidate;Rarg;LB;178;1;22.86488724;1;Pooled_heads
Candidate;Rarg;AC;178;2;22.75419617;1;Pooled_heads
Candidate;Rarg;SB;178;2;23.29712677;1;Pooled_heads
Candidate;Rarg;PL;178;2;22.55051804;1;Pooled_heads
Candidate;Rarg;LB;178;2;22.38739395;1;Pooled_heads
Candidate;Rarg;AC;216;1;23.37831879;1;Pooled_heads
Candidate;Rarg;SB;216;1;22.82614708;1;Pooled_heads
Candidate;Rarg;PL;216;1;23.13128662;1;Pooled_heads
Candidate;Rarg;LB;216;1;22.88451385;1;Pooled_heads
Candidate;Rarg;AC;216;2;23.13782501;1;Pooled_heads
Candidate;Rarg;SB;216;2;22.66239929;1;Pooled_heads
Candidate;Rarg;PL;216;2;22.64619446;1;Pooled_heads
Candidate;Rarg;LB;216;2;22.82075882;1;Pooled_heads
Candidate;Vdra;AC;178;1;23.1421032;1;Pooled_heads
Candidate;Vdra;SB;178;1;23.39729309;1;Pooled_heads
Candidate;Vdra;PL;178;1;23.35404778;1;Pooled_heads
Candidate;Vdra;LB;178;1;22.97281265;1;Pooled_heads
Candidate;Vdra;AC;178;2;23.66833305;1;Pooled_heads
Candidate;Vdra;SB;178;2;22.62556458;1;Pooled_heads
Candidate;Vdra;PL;178;2;23.14506531;1;Pooled_heads
Candidate;Vdra;LB;178;2;23.04750061;1;Pooled_heads
Candidate;Vdra;AC;216;1;24.61454391;1;Pooled_heads
Candidate;Vdra;SB;216;1;23.10774994;1;Pooled_heads
Candidate;Vdra;PL;216;1;23.93480873;1;Pooled_heads
Candidate;Vdra;LB;216;1;23.15319443;1;Pooled_heads
Candidate;Vdra;AC;216;2;24.06957245;1;Pooled_heads
Candidate;Vdra;SB;216;2;23.00084305;1;Pooled_heads
Candidate;Vdra;PL;216;2;23.61406326;1;Pooled_heads
Candidate;Vdra;LB;216;2;23.3383255;1;Pooled_heads
Candidate;Tgfbr2;AC;178;1;25.73878098;1;Pooled_heads
Candidate;Tgfbr2;SB;178;1;25.08353806;1;Pooled_heads
Candidate;Tgfbr2;PL;178;1;24.9316082;1;Pooled_heads
Candidate;Tgfbr2;LB;178;1;24.94442558;1;Pooled_heads
Candidate;Tgfbr2;AC;178;2;26.16744232;1;Pooled_heads
Candidate;Tgfbr2;SB;178;2;24.9635582;1;Pooled_heads
Candidate;Tgfbr2;PL;178;2;25.13551331;1;Pooled_heads
Candidate;Tgfbr2;LB;178;2;25.28170395;1;Pooled_heads
Candidate;Tgfbr2;AC;216;1;26.54673386;1;Pooled_heads
Candidate;Tgfbr2;SB;216;1;25.25802994;1;Pooled_heads
Candidate;Tgfbr2;PL;216;1;25.86025238;1;Pooled_heads
Candidate;Tgfbr2;LB;216;1;25.04957581;1;Pooled_heads
Candidate;Tgfbr2;AC;216;2;26.1955204;1;Pooled_heads
Candidate;Tgfbr2;SB;216;2;25.22771835;1;Pooled_heads
Candidate;Tgfbr2;PL;216;2;25.63209915;1;Pooled_heads
Candidate;Tgfbr2;LB;216;2;25.05401039;1;Pooled_heads
Reference;If5a1;AC;200;1;23.47161865;2;Pooled_heads
Reference;If5a1;SB;200;1;23.07133942;2;Pooled_heads
Reference;If5a1;PL;200;1;24.18017319;2;Pooled_heads
Reference;If5a1;LB;200;1;23.15392525;2;Pooled_heads
Reference;If5a1;AC;200;2;22.9918045;2;Pooled_heads
Reference;If5a1;SB;200;2;22.64175262;2;Pooled_heads
Reference;If5a1;PL;200;2;24.18965607;2;Pooled_heads
Reference;If5a1;LB;200;2;22.71433945;2;Pooled_heads
Reference;Actb;AC;200;1;15.71403885;2;Pooled_heads
Reference;Actb;SB;200;1;15.22663116;2;Pooled_heads
Reference;Actb;PL;200;1;16.10777283;2;Pooled_heads
Reference;Actb;LB;200;1;15.57907486;2;Pooled_heads
Reference;Actb;AC;200;2;15.3622036;2;Pooled_heads
Reference;Actb;SB;200;2;14.8659539;2;Pooled_heads
Reference;Actb;PL;200;2;16.25887726;2;Pooled_heads
Reference;Actb;LB;200;2;15.21011208;2;Pooled_heads
Candidate;Mvp;AC;200;1;22.99713516;2;Pooled_heads
Candidate;Mvp;SB;200;1;21.39568901;2;Pooled_heads
Candidate;Mvp;PL;200;1;23.18587112;2;Pooled_heads
Candidate;Mvp;LB;200;1;21.54834557;2;Pooled_heads
Candidate;Mvp;AC;200;2;22.25123024;2;Pooled_heads
Candidate;Mvp;SB;200;2;21.20922089;2;Pooled_heads
Candidate;Mvp;PL;200;2;23.15605545;2;Pooled_heads
Candidate;Mvp;LB;200;2;21.26544952;2;Pooled_heads
Candidate;Jup;AC;200;1;21.87226295;2;Pooled_heads
Candidate;Jup;SB;200;1;20.7249527;2;Pooled_heads
Candidate;Jup;PL;200;1;22.22583961;2;Pooled_heads
Candidate;Jup;LB;200;1;20.83753967;2;Pooled_heads
Candidate;Jup;AC;200;2;21.48207474;2;Pooled_heads
Candidate;Jup;SB;200;2;20.41962051;2;Pooled_heads
Candidate;Jup;PL;200;2;22.50665092;2;Pooled_heads
Candidate;Jup;LB;200;2;20.57951736;2;Pooled_heads
Candidate;Lsr;AC;200;1;26.31171608;2;Pooled_heads
Candidate;Lsr;SB;200;1;24.93918991;2;Pooled_heads
Candidate;Lsr;PL;200;1;26.90993881;2;Pooled_heads
Candidate;Lsr;LB;200;1;24.93612099;2;Pooled_heads
Candidate;Lsr;AC;200;2;25.51472092;2;Pooled_heads
Candidate;Lsr;SB;200;2;24.41723633;2;Pooled_heads
Candidate;Lsr;PL;200;2;26.69015884;2;Pooled_heads
Candidate;Lsr;LB;200;2;24.50409126;2;Pooled_heads
Candidate;Rarg;AC;200;1;22.87320137;2;Pooled_heads
Candidate;Rarg;SB;200;1;22.46928978;2;Pooled_heads
Candidate;Rarg;PL;200;1;23.59035873;2;Pooled_heads
Candidate;Rarg;LB;200;1;22.55023003;2;Pooled_heads
Candidate;Rarg;AC;200;2;22.26335907;2;Pooled_heads
Candidate;Rarg;SB;200;2;21.93601608;2;Pooled_heads
Candidate;Rarg;PL;200;2;22.93943024;2;Pooled_heads
Candidate;Rarg;LB;200;2;22.08405304;2;Pooled_heads
Candidate;Vdra;AC;200;1;23.80267143;2;Pooled_heads
Candidate;Vdra;SB;200;1;22.66882515;2;Pooled_heads
Candidate;Vdra;PL;200;1;24.12267303;2;Pooled_heads
Candidate;Vdra;LB;200;1;22.74294662;2;Pooled_heads
Candidate;Vdra;AC;200;2;23.35219193;2;Pooled_heads
Candidate;Vdra;SB;200;2;22.05793114;2;Pooled_heads
Candidate;Vdra;PL;200;2;24.28331299;2;Pooled_heads
Candidate;Vdra;LB;200;2;22.67995148;2;Pooled_heads
Candidate;Tgfbr2;AC;200;1;25.97596741;2;Pooled_heads
Candidate;Tgfbr2;SB;200;1;25.18391418;2;Pooled_heads
Candidate;Tgfbr2;PL;200;1;26.6747036;2;Pooled_heads
Candidate;Tgfbr2;LB;200;1;24.9662075;2;Pooled_heads
Candidate;Tgfbr2;AC;200;2;25.64708328;2;Pooled_heads
Candidate;Tgfbr2;SB;200;2;24.92686844;2;Pooled_heads
Candidate;Tgfbr2;PL;200;2;26.92587662;2;Pooled_heads
Candidate;Tgfbr2;LB;200;2;24.89536095;2;Pooled_heads
Reference;If5a1;AC;178;1;23.35324097;3;Pooled_heads
Reference;If5a1;SB;178;1;23.25496864;3;Pooled_heads
Reference;If5a1;PL;178;1;23.09447479;3;Pooled_heads
Reference;If5a1;LB;178;1;22.99862671;3;Pooled_heads
Reference;If5a1;AC;178;2;23.20590973;3;Pooled_heads
Reference;If5a1;SB;178;2;23.23107544;3;Pooled_heads
Reference;If5a1;PL;178;2;23.07160378;3;Pooled_heads
This is a portion of the data; to view all the data, please download the file.
Dataset 3.qPCR data for tests of expression in charr developing embryo heads.
“Gene Type”: Designates the reference and candidate genes. “Gene”: Name of the gene. “Morph”: Which charr type the sample came from. "Relative age": Developmental timepoint. "Biological replicate": The two or more biological replicates used. "cDNA No": Marks the cDNA isolation used. "Ct value": Estimate of gene expression. "Tissue": Indicates the material used111.

Discussion

We are interested in the predictability of evolution at the molecular level, especially whether there exist principles that influence the rewiring of developmental and regulatory systems4,76. One way to study this is to identify genetic and developmental effects affecting key traits in species or populations which exhibit parallel evolution. The aim of this study was to find expression and genetic differences separating the small benthic morph in Lake Thingvallavatn and aquaculture charr, with the long term objective being to reveal the genetic and molecular systems that associate with benthic morphology in charr. The transcriptome reflects the biology of these two morphs, their different histories and ecology. AC-charr will also be shaped by domestication, which may explain for instance the higher expression of metabolic genes in AC-charr.

Developmental transcriptome of Arctic charr morphs

As no reference genome is available for Arctic charr, we mapped reads to S. salar EST-contigs57 in order to estimate expression and identify candidate genetic polymorphisms. As many of the contigs are short or have overlapping annotations, we collapsed genes into paralogous genes when appropriate for the expression analysis. The main advantage was the reduced number of statistical tests (and hence an increase in statistical power). The downside is that paralog-specific expression patterns are masked, as the qPCR results of the natterin like gene family show (Figure 5 and S1 Figure). Recent rainbow trout data shows about 1/4 of paralogs from the latest whole genome duplication event retain the very similar expression patterns16 indicating that distinct expression patterns of paralogs is quite common77. In their analysis of the Arctic charr gill transcriptome, Norman et al. (2014)23,24 also used Illumina sequencing technology to evaluate expression. Their reads were longer (2x100 bp) than in this study (36 bp) enabling them to assemble contigs. They did not consider distinct paralogs in their approach and merged contigs based on sequence identity. Thus the complexity of Arctic charr transcriptome still remains unsolved. The data reflected differential deployment of several gene classes during Arctic charr development, which is most probably genetic in origin. We raised the embryos in a common garden, but their parents were wild so parental environments and transgenerational plasticity may also have contributed. Studies in salmonids and other fish have demonstrated large changes in expression during early development, including coordinated changes in many cellular and developmental systems19,7881. Several blood coagulation factors genes showed significant changes during charr development, and were also more highly expressed in the SB-charr. This might reflect differences in the rate of development of blood composition, or tissue composition, in the two morphs. While our main interest is on the derived and repeatedly evolved small benthic charr, the data can also reflect differences due to breeding. As was reasoned in the introduction we chose to compare SB to AC-charr. This proved useful, as the data revealed differential expression of several developmental genes and regulators with differential expression between benthic and limnetic charr51,52. Previously we found tight correlation of RNA-seq expression and qPCR estimates - using data from this very transcriptome51. Furthermore, we actually used the same morphs (AC and SB) and samples in a comparison of the developmental miRNA transcriptome – which reveal that expression of several miRNAs correlates with morph differences56.

Higher expression of lysozyme II C and natterin-like in SB-charr

Natural selection can shape variation in immunological genes. We decided to study further Lyz2 and the putative immunological nattl genes that had higher expression in SB. Note, because only two charr transcriptomes studied, it was impossible to polarize the changes. It was not possible to say that these genes are upregulated in SB or downregulated in AC charr. The substrate of lysozyme82 is the bacterial cell wall peptidoglycan and it acts directly on Gram-positive bacteria83. Lysozyme also promotes the degradation of the outer membrane and therefore indirectly acts also on Gram-negative bacteria84. Another gene that caught our attention was natterin-like. Natterins were first discovered from the venom gland of the tropical toxic fish species Thalassophryne nattereri70,71, and are found by sequence similarity in e.g. zebrafish, Atlantic salmon and here in Arctic charr. The Natterin proteins contain a mannose-binding lectin-like domain (Jacalin-domain). Mannose-binding lectins are pathogen recognition proteins (antibodies) and therefore are important for the acute phase response of fish85,86, thus we hypothesized that nattl genes in charr may have immune related functions. The data are consistent with this as the highest expression was found in skin and kidney. This putative immune functions needs to be verified. One can speculate that higher expression of Lyz2 and some Nattl paralogs in SB-charr reflect preparation of juveniles for bottom dwelling habitats, which may be rich in bacteria and challenging for immune systems. It would be interesting to study further the expression of these and other immunological genes implicated in this transcriptome, in natural charr populations and juveniles challenged with pathogens or in families of Aquaculture charr breed for pathogen resistance. An evolutionary question is, whether immunological genes are expected to show similar or less parallelism than others genes shaped by natural selection? The current data does not reflect on this question, but our population genetic work shows genetic variation in immunological genes (MHCIIα and cath2) does not correlate with the SB-charr ecotype in Iceland45.

In this study we collapsed contigs into paralog groups for the transcriptome analyses. The disadvantage of this approach is that differential expression of a paralog, can be masked by related genes that do not differ between groups. We looked at this by studying the expression of three paralogs of the natterin like genes in different morphs during Arctic charr development, and among tissues of adult AC-charr. The data suggest that the three nattl genes are expressed differentially between the morphs, thus it is not divergence in the expression of one paralog that explains the general nattl expression disparity in the transcriptome. Certainly, other scenarios could apply to other genes in the transcriptome.

Expression divergence in craniofacial genes in benthic morphs

A study of the skulls of post-hatching embryos and juveniles from Lake Thingvallavatn, showed that some elements of the developing head ossified earlier in SB than in PL-charr87. Morphometric analyses of developing heads (same stages as studied here) demonstrate differences in craniofacial elements between AC and SB-charr, along a limnetic vs. benthic axis74. Based on those developmental phenotypes we investigated further genes with roles in craniofacial development that were differentially expressed in the transcriptome. Our published data51,52 and the current data (7 out of 8 craniofacial candidates were confirmed by qPCR) demonstrate the utility of the SB and AC-charr developmental transcriptomes for identifying candidate genes with differential expression, even within specific structures like the head. All seven of the verified genes had consistently higher expression in the developing head of two benthic morphs (SB and LB), and lower in more limnetic fish (AC and PL). We must highlight the fact that three of these morphs (SB, LB and PL) are closely related and live in sympatry in Lake Thingvallavatn44.

We focused on a several craniofacial candidate genes including a few within, or transcriptionally connected to, the Tgf-β and Ahr signaling pathways8890. These are the Lsr, Cldn4, Jup, Scin, Vdra, Mvp and Tgfbr2, here described briefly. Adseverin (Scin) has roles in rearrangements of the actin cytoskeleton, chondrocyte differentiation and skeletal formation91,92. Lsr encodes a component of tri-cellular tight junctions93 and has been shown to be suppressed upon Tgf-β1 stimulation94 in a human cell line. Similarly, Cldn4, a tight junction protein with unknown role during embryonic morphogenesis, is a target of the Tgf-β and Ahr signaling pathways95,96. The Tgfbr2, encoding a receptor of Tgf-β, i involved in craniofacial morphogenesis97. Mvp is the predominant component of cytoplasmic ribonucleoprotein structures called vaults98, which is highly conserved across eukaryotes and are implicated in several processes from signal transmission and immune response99. Finally, higher expression of Vdra, encoding the vitamin D receptor A, was found in the heads of benthic charr. The receptor regulates mineral homeostasis, osteoblast differentiation and bone metabolism100. A related study from our group, building on this transcriptome, described in more detail the differential expression of these and other coexpressed genes in limnetic and benthic charr53.

To summarize, the results show that RNA-sequencing of Aquaculture charr with limnetic craniofacial morphology and small benthic charr can implicate candidate genes for qPCR analyses. Those studies52,53 have revealed genes that associate with limnetic and benthic divergence in craniofacial elements in sympatric charr morphs. It would be interesting if expression of these genes associates with benthic morphology in independently evolved charr populations, as was seen for certain mTOR-pathway genes in muscle of adult SB-charr47, or even in other species with similar trophic diversity.

Genetics differences between the AC and SB-morphs - possibly in mtDNA function

Previous studies on microsatellite markers documented the history of charr populations in Iceland and in particular the parallel evolution of SB-charr44. The data confirm genetic differences between SB and AC-charr. By comparing AC and SB-charr, that represents a small benthic resource morph that has evolved repeatedly in Icelandic stream and pond habitats44, we hoped to implicate genes and pathways involved in adaptation to these special habitats. The allele frequency differences and expression divergence observed in the transcriptome reflect neutral population genetic processes and/or selection during AC charr domestication or adaptation of SB-charr. Changes in the AC-charr are interesting as domestication over several decades led to rapid growth and increased size50. Morphometrics have not been used to compare the body or craniofacial shape of AC to other charr morphs, but domestication of O. mykiss has affected body shape and fin structure in particular101. By studying expression and allele frequencies in limnetic and benthic morphs from more locations, it may be possible to disentangle the role of drift and selection. We attempted to verify several SNPs, and focused mostly on variants in mtDNA because to us the data suggest interesting divergence between AC and SB charr in systems related to energy metabolism. First, there is 2X higher expression of respiratory electron transport chain components in AC compared to SB-charr and 100% more mitochondrial derived reads are found in the AC-charr samples. Note that the direction of divergence is unknown, i.e. whether expression was up in AC or down in SB. Second, many derived candidate-SNPs in genes related to mitochondrial function were at high frequency on the AC branch. For instance in S100A1, which has been implicated in mitochondrial regulation in cardiac tissue in humans102, but its expression is probably not exclusive to this tissue. Third, while the mitochondrial ribosomal genes generally evolve slowly, we do see derived variants at high frequency in the SB and large benthic charr in Lake Thingvallavatn. Specifically, m3411C>T in SB affects a position that is highly conserved among fish, and could affect function of the 16s rRNA. Earlier studies of mitochondrial markers in S. alpinus did not find large signals of divergence within Iceland40,42,45, probably because they studied other genes.

The mitochondrion is more than a powerhouse, it integrates metabolism, cell cycle and apoptosis103. The number of mitochondria and its functions are known to correlate with environmental attributes. For instance in Antarctic fishes under extreme cold, higher numbers of mitochondria are found in muscle and heart cells104. Our data suggest an expression difference between morphs that could reflect differences in total number of mitochondrion, the number of mtDNA copies per mitochondrion or cell, or difference in RNA expression from the mtDNA, possibly due to evolution of mtDNA related to diet and/or temperature105. The results suggest divergence (adaptive or neutral) in mitochondrial function due to the domestication of aquaculture charr and/or adaptation of the small benthic charr to its habitat. Increase in mitochondrial function in AC charr embryos could reflect higher basal metabolic rate in this aquaculture stock. Alternatively, lower metabolic rate in the SB charr would also be curious in the context of their ecology. Clearly further work is needed to map out the functional differences of mitochondrial related genes in AC charr, more SB populations and hopefully anadromous charr morphs (representing the ancestral state). The mtDNA signals could also be investigated in populations along ecological clines (e.g. temperature) or with respect to life history106.

Conclusions

The charr developmental transcriptome provides a starting point to investigate the molecular systems that associate with artificial selection during aquaculture breeding of charr or divergence among the highly polymorphic and rapidly evolving Arctic charr in Iceland. The data reveal differential expression of two immunological genes between morphs and of several craniofacial developmental genes, that may help sculpture benthic vs. limnetic heads. The genetic data suggest among other things differentiation in the charr mtDNA between the SB and AC-charr morphs. It must be acknowledged that it is not trivial to identify genes affecting variation in ecologically important phenotypes, like shape107,108. Our broad interest is in how natural selection tweaks genetic regulatory systems, for instance via genetic changes in regulatory sequences or post transcriptional modifiers relating to adaptations. Genetic changes affecting gene expression can be raw material for adaptation, but could also rise in frequency due to reverberations in regulatory cascades76. We plan to study the degree of developmental and population genetics parallelism of the small benthic charr, typically found in cold springs and small pond habitats in Iceland with lava substratum29,44. The availability of charr populations at different stages of divergence sets the stage for future genomic studies of the roles of genes, environment and plasticity for shaping this polymorphic species.

Data availability

The sequencing reads were deposited into the NCBI SRA archive under BioProject identifier PRJNA239766 and with accession numbers: SRX761559, SRX761571, SRX761575, SRX761577, SRX761451, SRX761461, SRX761490 and SRX761501.

All DNA sequences where deposited to Genbank as popsets under the accession numbers KP019972-KP020026.

F1000Research: Dataset 1. Parameters and multiple testing corrected p-values for expression analysis, 10.5256/f1000research.6402.d48005109

F1000Research: Dataset 2. qPCR data for tests of expression in charr developing embryos and adult tissues., 10.5256/f1000research.6402.d48006110

F1000Research: Dataset 3. qPCR data for tests of expression in charr developing embryo heads., 10.5256/f1000research.6402.d48007111

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 01 Jun 2015
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Gudbrandsson J, Ahi EP, Franzdottir SR et al. The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs [version 3; peer review: 2 approved, 1 approved with reservations]. F1000Research 2016, 4:136 (https://doi.org/10.12688/f1000research.6402.3)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 3
VERSION 3
PUBLISHED 02 Dec 2016
Revised
Views
21
Cite
Reviewer Report 20 Dec 2016
Örjan Östman, Department of Aquatic Resources, Swedish University of Agricultural Sciences, Uppsala, Sweden 
Approved
VIEWS 21
The authors have addressed all my comments and incorporated them into the manuscript. So my opinion of the study ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Östman Ö. Reviewer Report For: The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs [version 3; peer review: 2 approved, 1 approved with reservations]. F1000Research 2016, 4:136 (https://doi.org/10.5256/f1000research.10982.r18642)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 2
VERSION 2
PUBLISHED 25 Apr 2016
Revised
Views
25
Cite
Reviewer Report 30 Aug 2016
Örjan Östman, Department of Aquatic Resources, Swedish University of Agricultural Sciences, Uppsala, Sweden 
Approved with Reservations
VIEWS 25
The study by Gudbrandsson et al. reports a thorough analysis of differences in the transcriptome between different ‘morphs’ or ‘populations’ of artic charr. More specifically they have studied the transcriptome of eggs and larvae from a natural population of small ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Östman Ö. Reviewer Report For: The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs [version 3; peer review: 2 approved, 1 approved with reservations]. F1000Research 2016, 4:136 (https://doi.org/10.5256/f1000research.9044.r15587)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 02 Dec 2016
    Arnar Palsson, Institute of Life and Environmental Sciences, University of Iceland, Reykjavik, 101, Iceland
    02 Dec 2016
    Author Response
    The study by Gudbrandsson et al. reports a thorough analysis of differences in the transcriptome between different ‘morphs’ or ‘populations’ of artic charr. More specifically they have studied the transcriptome ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 02 Dec 2016
    Arnar Palsson, Institute of Life and Environmental Sciences, University of Iceland, Reykjavik, 101, Iceland
    02 Dec 2016
    Author Response
    The study by Gudbrandsson et al. reports a thorough analysis of differences in the transcriptome between different ‘morphs’ or ‘populations’ of artic charr. More specifically they have studied the transcriptome ... Continue reading
Views
30
Cite
Reviewer Report 25 May 2016
Daniel Macqueen, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen, UK 
Approved
VIEWS 30
Second review of Gudbrandsson et al. “The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs”.

Overview:

The authors have addressed the comments made by myself and Anne Dalziel. They have incorporated a range ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Macqueen D. Reviewer Report For: The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs [version 3; peer review: 2 approved, 1 approved with reservations]. F1000Research 2016, 4:136 (https://doi.org/10.5256/f1000research.9044.r13702)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 02 Dec 2016
    Arnar Palsson, Institute of Life and Environmental Sciences, University of Iceland, Reykjavik, 101, Iceland
    02 Dec 2016
    Author Response
    Overview:
    

The authors have addressed the comments made by myself and Anne Dalziel. They have incorporated a range of associated changes into version 2 of their paper. Readers ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 02 Dec 2016
    Arnar Palsson, Institute of Life and Environmental Sciences, University of Iceland, Reykjavik, 101, Iceland
    02 Dec 2016
    Author Response
    Overview:
    

The authors have addressed the comments made by myself and Anne Dalziel. They have incorporated a range of associated changes into version 2 of their paper. Readers ... Continue reading
Version 1
VERSION 1
PUBLISHED 01 Jun 2015
Views
49
Cite
Reviewer Report 09 Jul 2015
Anne Dalziel, Institute for Systems and Integrative Biology (IBIS), Department of Biology, Laval University, Quebec City, QC, Canada 
Approved with Reservations
VIEWS 49
In this paper “The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs” Gudbrandsson et al. have tested for differential gene expression at multiple developmental time-points among a number of Artic charr morpho-types from Lake Thingvallavatn (3 wild morphs, 1 ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Dalziel A. Reviewer Report For: The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs [version 3; peer review: 2 approved, 1 approved with reservations]. F1000Research 2016, 4:136 (https://doi.org/10.5256/f1000research.6869.r9419)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 25 Apr 2016
    Arnar Palsson, Institute of Life and Environmental Sciences, University of Iceland, Reykjavik, 101, Iceland
    25 Apr 2016
    Author Response
    Major Comments

        Introduction:‭

    ‬Requires some reorganization,‭ ‬clarification of what phenotypes have evolved in parallel among morphs,‭ ‬and how the authors separate the effects of domestication‭ (‬SB vs.‭ ‬AC‭) ‬from benthic/limnetic evolution‭
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 25 Apr 2016
    Arnar Palsson, Institute of Life and Environmental Sciences, University of Iceland, Reykjavik, 101, Iceland
    25 Apr 2016
    Author Response
    Major Comments

        Introduction:‭

    ‬Requires some reorganization,‭ ‬clarification of what phenotypes have evolved in parallel among morphs,‭ ‬and how the authors separate the effects of domestication‭ (‬SB vs.‭ ‬AC‭) ‬from benthic/limnetic evolution‭
    ... Continue reading
Views
67
Cite
Reviewer Report 07 Jul 2015
Daniel Macqueen, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen, UK 
Approved with Reservations
VIEWS 67
Review of Gudbrandsson et al. “The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs”.

The work is founded on the solid premise that rapidly evolving phenotypes in nature can be underpinned by changes at the transcriptome level. The model system ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Macqueen D. Reviewer Report For: The developmental transcriptome of contrasting Arctic charr (Salvelinus alpinus) morphs [version 3; peer review: 2 approved, 1 approved with reservations]. F1000Research 2016, 4:136 (https://doi.org/10.5256/f1000research.6869.r8970)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 25 Apr 2016
    Arnar Palsson, Institute of Life and Environmental Sciences, University of Iceland, Reykjavik, 101, Iceland
    25 Apr 2016
    Author Response
    Main comments‭ & ‬caveats

        RNAseq study design.‭ ‬ I sympathize with the fact that the authors are trying to publish Illumina data that was generated in‭ ‬2009,‭ ‬since‭ (‬obviously‭) ‬the technology
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 25 Apr 2016
    Arnar Palsson, Institute of Life and Environmental Sciences, University of Iceland, Reykjavik, 101, Iceland
    25 Apr 2016
    Author Response
    Main comments‭ & ‬caveats

        RNAseq study design.‭ ‬ I sympathize with the fact that the authors are trying to publish Illumina data that was generated in‭ ‬2009,‭ ‬since‭ (‬obviously‭) ‬the technology
    ... Continue reading

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 01 Jun 2015
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.