ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Pre-surgery status determines inflammation levels post-elective surgery

[version 1; peer review: 1 approved with reservations, 1 not approved]
PUBLISHED 10 Sep 2015
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

In the present study we quantified a panel of systemic inflammation parameters in patients undergoing elective surgery with a view to evaluate pre-surgical inflammation status in relation to consequences post-surgery. The investigation revealed significantly decreased levels of plasma TNF-α, IL1-β, IL7, IL-8, MIP-1a and IL-1Ra in 79% of patients at 6 hrs post-surgery which have been designated by us a ‘hypo-responsive’ cases and the balance 21% of patients displayed significantly elevated levels of the above cytokines in plasma that have been designated a ‘hyper-responsive’ phenotype by us. Expression of HLA-DR, CD40, CD80, TLR-2, TLR-4 and CD36 on circulating monocytes as shown by multicolour flow-cytometry was significantly decreased post-surgery in hypo-responsive patients. Similarly, PBMCs of hypo-responsive cases responded very poorly in vitro when stimulated with toll-like receptor (TLR) agonists. There was an inverse association between levels of plasma inflammatory cytokines pre-surgery and hypo-responsive consequences post-surgery. Similarly, patients displaying the hyper-responsive phenotype were found to express very low levels of inflammatory cytokines pre-surgery. Taken together the current study offers two novel findings: a) a bimodal inflammatory response post-elective surgery viz., one major cohort displaying hypo-responsive state and another minor group  a hyper-responsive phenotype and b) pre-surgery inflammation status determining the direction of inflammation consequence post-surgery. These findings seem to offer laboratory tools for predicting onset of inflammation post-surgery – considering that SIRS and sepsis are consequences of surgery induced inflammation this study offers predictive indicators for clinical complications post-surgery.

Keywords

DAMPs, PAMPs, Sterile inflammation, Sepsis, SIRS, TLRs

Abbreviations

TNF, tumour necrosis factor; IL, interleukin; MIP, macrophage inflammatory protein; HLA-DR, human leukocyte antigen-DR; TLR, toll-like receptor; PBMC, peripheral blood mononuclear cells; SIRS, systemic inflammatory response syndrome.

Introduction

Sepsis and multiorgan failure (MOF) are the leading causes of death in surgical patients13. Several studies have described surgery induced systemic inflammatory response syndrome (SIRS)4,5 and compensatory anti-inflammatory response syndrome (CARS)69 as prevalent causes of these complications. A causal relationship of events such as induction of cytokine storm1012, immune cell activation and infiltration of activated immune cells13 with development of SIRS following surgery has been reported in a cohort of patients. Upregulated expression of toll-like receptors (TLRs) by activated monocytes/macrophages and hyper-reactivity of peripheral blood mononuclear cells to pathogen associated molecular patterns (PAMPs) have further been shown to be associated with this overwhelming inflammatory response post-injury14. Paradoxically there are also reports claiming downregulated expression of TLRs on circulatory monocytes as well as impaired responses to PAMPs in patients post-surgery15,16.

Existing literature does not offer clarity on factors that contribute to these diagonally opposite biological outcomes in patients post-surgery. We hypothesised that the pre-surgery status of patients could determine post-surgery consequences – while previous studies have demonstrated immunodynamics and inflammation profiles post-surgery17 very little has been understood about the correlation between pre-operative inflammatory status and outcome post-injury. An association between lower pre-operative plasma IL-6 and early allograft dysfunction due to high systemic inflammation18 and higher pre-operative systemic inflammation has been demonstrated with increased risk of infection post-surgery19,20. These reports however suffer from lack of robust and comprehensive measurement of cellular and molecular parameters of inflammation and the current study was designed to fill this lacuna.

Here we report the quantification of plasma cytokines, expression of monocyte surface receptors such as TLRs, scavenger receptors, HLA-DR and other co-stimulatory molecules in patients before and after elective surgery. Our results revealed downregulation of specific inflammatory mediators in 6 hrs post-surgery plasma in most of the patients while the rest displayed distinct increased levels of plasma mediators. Increased as well as decreased levels of plasma inflammatory molecules correlated with surface expression of monocyte receptors such as TLRs, scavenger receptor CD36, HLA-DR and co-stimulatory molecules. Further, our findings demonstrate an inverse association between pre-surgical status and inflammation profile post-surgery viz., patients with relatively higher basal levels of plasma cytokines and monocyte surface receptors developed a hypo-inflammatory response while patients with relatively lower basal levels of plasma cytokines and monocyte surface receptors developed a hyper-inflammatory response post-surgery.

Materials and methods

Reagents

Lipopolysaccharide from Escherichia coli serotype O55:B5 (cat. No. L2880-100MG) and PAM3CSK4 (cat. No. IMG-2201) were purchased from Sigma-Aldrich and Imgenex India Pvt. Ltd. respectively. RBC lysis (cat. No. 00-4333-57), cell fixation (cat. No. 00-8222-49) and permeabilization (cat. No. 00-8333-56) buffers were purchased from eBiosciences. Bio-Plex Pro Assays-27 plex kit was purchased from Bio-Rad (cat. No. M500KCAF0Y). DNA isolation kit (QIAamp DNA Mini kit [250]; cat. No. 51306) was purchased from Qiagen. Q-PCR SYBR mix (2X Brilliant III STBR Green QPCR Master Mix, cat. No. 600882-51) was purchased from Agilent Technologies.

Antibodies

Panel-1
Name of antibodyFluorescent conjugateManufacturerCatalog no.Raised inClassAmount used/50ul blood
Ant-human CD14FITCeBiosciences11-0149-42MouseMonoclonal0.5μg
Anti-human CD66bAPCeBiosciences17-066-42MouseMonoclonal0.06μg
Anti-human TNF-αPE-Cy7Life technologiesA18506MouseMonoclonal1μg
Panel-2
Name of antibodyFluorescence conjugateManufacturerCatalog no.Raised inClassAmount used/50ul blood
Anti-human CD14APC-Cy7BD Biosciences557831MouseMonoclonal5μl
Anti-human TLR2PE-Cy7eBiosciences25-9024-82MouseMonoclonal0.25μg
Anti-human TLR4APCeBiosciences17-9917-42MouseMonoclonal0.5μg
Anti-human CD36FITCeBiosciences11-0369-42MouseMonoclonal0.125μg
Panel-3
Name of antibodyFluorescence conjugateManufacturerCatalog no.Raised inClassAmount used/50ul blood
Anti-human CD14APC-Cy7BD Biosciences557831MouseMonoclonal5μl
Anti-human HLA-DRPE-Cy7eBiosciences25-9952-42MouseMonoclonal0.06μg
Anti-human CD40APCeBiosciences17-0409-42MouseMonoclonal0.03μg
Anti-human CD80FITCeBiosciences11-0809-42MouseMonoclonal0.5μg

Selection of patients and ethics approval

Patients admitted for gastrointestinal and general surgery in the Department of General & Laparoscopic surgery, Neelachal Hospital Pvt. Ltd. Bhubaneswar between September 2013 and October 2014 were recruited for this study. All of the surgeries included in this study were cases of elective surgery. A total of 19 patients between the age of 18 years and 75 years were included. Inclusion criterion was surgical interventions with a minimum incision of 3 inches. Pregnant women, terminally ill patients and patients admitted for emergency surgery or accidental trauma cases were excluded from the study. Details of patients, type of anaesthesia used, duration of surgery, duration of hospital stay, pre-surgical total blood cell counts etc. are shown in Table 1. Total 23 healthy volunteers who were not on any medication since two weeks prior to blood collection participated in this study. The project protocol was approved by the human ethics committee of Institute of Life Sciences (no. 28/HEC/13) and the IRB committee. Written informed consent was obtained from each of the patients for voluntary participation in the study.

Table 1. Demographics and baseline characteristics.

Data are presented as mean of 23 healthy controls and 19 surgery patients. Patients were categorized into two groups on the basis of post-operative inflammatory responses viz., ‘hypo-responsive’ and ‘hyper-responsive’. Values represent the mean ± SEM, with median and middle quartiles indicated in parentheses. RBCs, red blood cells.

Healthy control
(n=23)
Hypo-responsive
(n=15)
Hyper-responsive
(n=4)
P value
HC vs
Hypo
HC vs
Hyper
Hypo vs
Hyper
Age (years)30±0.92 (29,
27–38)
41±3.3 (43,
33–51)
45.5±11.9 (43.5,
25–68)
*p<0.05nsns
Sex (male/female)14/910/54/0NANANA
Type of anaesthesia
(general/regional)
NA8/73/1NANANA
Duration of surgery
(minutes)
NA106.4±15.5 (95,
53.7–137.5)
112.5±14.3 (105,
90–142.5)
NANAns
Duration of hospital stay
(days)
NA4.4±0.48 (4, 3–5)4.2±0.63 (4,
3.2–5.5)
NANAns
SurvivalNA100%100%NANAns
Pre-surgery blood cell
numbers
Total leukocytes (×1000/ul
blood)
8.8±0.38 (8.9,
8.09–11.7)
7.2±0.69 (6.4,
5.6–9)
6.3±2 (6, 2.5–11)nsnsns
Lymphocytes (×1000/ul
blood)
2.7±0.13 (2.8,
2.2–3.8)
1.9±0.16 (1.8,
1.5–2.4)
1.3±0.4 (1.3,
0.59–2.1)
**p<0.01**p<0.01ns
Monocytes (×1000/ul
blood)
0.11±0.0 (0.12,
0.08–0.18)
0.1±0.01 (0.08,
0.07–0.17)
0.10±0.03 (0.11,
0.04–0.18)
nsnsns
Neutrophils (×1000/ul
blood)
5.5±0.29 (5.6,
4.7–8.1)
4.9±0.56 (4.3,
3.4–6.1)
4.63±1.64 (4.24,
1.68–7.95)
nsnsns
Eosinophils (×1000/ul
blood)
0.46±0.09 (0.32,
0.16–1.6)
0.35±0.07 (0.27,
0.19–0.5)
0.19±0.06 (0.23,
0.06–0.27)
nsnsns
Basophils (×1000/ul blood) 0.01±0.00 (0.01,
0.01–0.02)
0.05±0.01 (0.05,
0.02–0.05)
0.37±0.01 (0.02,
0.02–0.07)
***p<.001*p<0.05ns
RBCs (×1000/ul blood)4.8±0.1 (4.9,
4.5–5.7)
4.5±0.11 (4.5,
4.2–4.8)
3.8±0.95 (4.6,
1.8–5)
nsnsns
Platelets (×1000/ul blood)242.9±11.4 (245,
220–254)
112.4±13.7 (108,
63–147)
123.3±30.9 (146.5,
57.7–165.5)
***p<.001*p<0.05ns
Haemoglobin (g/dl)13.4±0.28 (13.8,
12.4–16.4)
12±0.45 (11.5,
10.7–12.9)
9.2±2.2 (11.4,
4.8–11.5)
ns*p<0.05ns

Values represent the mean ± SEM, with median and middle quartiles indicated in parentheses

Blood sampling

Blood was collected in ACD 15% (V/V) containing tubes. Sampling was done in two batches - initially 8 subjects were selected and sampled twice, immediately before anaesthesia (0hps) and 6 hrs after completion of surgery (6hps). After analyzing the data, 11 more patients were included and sampling was done thrice for this cohort; immediately before anaesthesia (0hps), 6 hrs and 24 hrs after completion of surgery (6hps and 24hps respectively). Whole blood was aliquoted and used immediately for complete blood count (CBC), for conducting ex vivo stimulations and analysis by flow-cytometry. Plasma was isolated from the rest of the sample by centrifugation and was stored at -80°C for conducting further assays.

Complete blood count

Two hundred microliters of whole blood was used for complete blood count (CBC) in haematology analyzer (Sysmex XS800i).

Ex vivo stimulations and flow cytometry analysis

Fifty microliters of freshly collected blood samples were stimulated with TLR ligands; PAM3CSK4 and LPS (10ng/ml for both) for 2 hrs at 37°C. Cells were fixed, permeabilized (following manufacturer’s instructions) and stained with antibodies to CD14-(FITC), CD66b-(APC) and TNF-α-(PE-Cy7) (antibody panel-1). Another aliquot (50ul) was used for multicolour immune staining with antibodies to CD14-(APC-Cy7), TLR2-(PE-Cy7), TLR4-(APC) and CD36-(FITC) (antibody panel-2) and CD14-(APC-Cy7), HLA-DR-(PE-Cy7), CD40-(APC) and CD80-(FITC) (antibody panel-3). After staining RBCs were lysed with RBC lysis buffer following manufacturer’s protocol. Stained cells (with antibody panels -1, 2 and 3) were acquired and analyzed by flow cytometry using BD FACS LSR Fortessa; data were analysed using BD FACS Diva software (version 7.0). To nullify day to day variations flow-cytometer settings were maintained uniform by performing bead based instrument settings following the protocol provided by BD Biosciences. To get rid of false positive or false negative events, gating was done using fluorescence minus one (FMO) controls. Monocyte expression of intracellular cytokines was shown as mean fluorescence intensity (MFI) whereas expression of surface markers was scored as percentage of positive cells.

Measurement of plasma cytokines

Plasma cytokines were measured by Bio-plex Pro Assays-27 plex following the manufacturer’s instructions and the final reading was taken in Bio-plex 200 system from Bio-rad.

Estimation of plasma mitochondrial DNA copy number

Isolation of plasma DNA. 100μl of plasma was mixed with 100μl of PBS and centrifuged at 700×g for 5 minutes at 4°C. Upper 190μl volume was collected without agitating the lower portion and centrifuged at 18000×g for 15 minutes at 4°C. From this upper 170μl was transferred into a new tube and plasma DNA was eluted using QIAamp DNA Mini kit following manufacturer’s instructions. Preparation of standard curve: mitochondrial cytochrome-b gene (mtCyt-b) was amplified from eluted DNA by end-point PCR using following primer set; forward 5’CCACCCCATCCAACATCTCC3’ and reverse 5’CTCGAGTGATGTGGGCGATT3’. Concentration of PCR product (copy number/ng of DNA) was calculated and standards (109 to 1 copy number/μl) were prepared by log10 dilution. Standards were amplified for the same gene (mtcyt-b) by real-time quantitative PCR (RT qPCR) and standard curve was prepared by plotting DNA copy number and cT value in X and Y-axis respectively. Calculation of mitochondrial DNA copy number: cT values of mtCyt-b for plasma DNA samples were obtained by RT qPCR. Real copy number of mtDNA was calculated from reference standard curve by using observed cT values. Protocol was adapted from Kiichi Nakahira et al.21.

Statistical analysis

GraphPad Prism (version 5.01) software was used for statistical analysis and results of all experiments were expressed as mean±SEM. Comparisons between groups were made by nonparametric unpaired Student’s t-test (Mann-Whitney test) for Table 1, nonparametric paired Student’s t-test (Wilcoxon matched pairs test) for Supplementary Figure 2 and Supplementary Figure 3 and one way ANOVA choosing nonparametric paired test (Friedman test) for rest of the figures. P values were analysed by two-tailed test and P<0.05 was considered as significant (at 95% confidence intervals).

Results

Dataset 1.Complete blood count raw data.
Absolute numbers of peripheral blood immune cells in healthy controls (n=23) and patients at 0, 6 and 24 hrs post-surgery (n=19) scored by haematology analyzer. TLC, total leukocyte count; RBC, red blood cells.
Dataset 2.Mitochondrial cytochrome-b raw data.
Absolute copy number of mtcyt-b in plasma of healthy controls (n=23) and patients at 0 and 6 hrs post-surgery (n=19) scored by real time qPCR are presented.
Dataset 3.Flow-cytometry .FCS files and analyzed data files.

Bi-modal consequence of inflammation in patients undergoing elective surgery

Effect of surgery on systemic inflammatory responses was studied by estimating 27 different plasma biomarkers in patients pre- and post-surgery. Eighteen out of 27 mediators tested revealed levels detectable by the assay (Supplementary Table 1). Four of the 19 patients displayed hyper-inflammation as shown by increased plasma levels of TNF-α, IL-1β, IL-ra, IL-7, IL-8 and MIP1a in comparison to pre-surgery levels while in the remaining 15 patients all the 6 inflammatory molecules decreased consistently within 6 hrs post-surgery (Figure 1). Comparison of plasma parameters pre-surgery with post-surgery levels allowed us to differentiate bimodal inflammation consequences in patients after surgery. The dichotomy of inflammatory cytokine response between the two groups persisted at 24 hrs post-surgery also (Supplementary Figure 1). For conceptual clarity the expression ‘hypo-responsive’ and ‘hyper-response’ will be used in the manuscript to classify the former and later groups of patients. Other plasma molecules did not show persistent bimodal inflammatory response post-surgery (Supplementary Table 1). Age, type of anaesthesia used, duration of surgery or hospital stay and several blood cell parameters were comparable between the two groups (Table 1).

e3a4f650-0318-4d00-a823-209c44836c33_figure1.gif

Figure 1. Surgical trauma alters levels of plasma inflammatory mediators differentially.

Cytokine contents (pg/ml) in plasma collected from patients at 0 and 6 hrs post-surgery were measured by bead based multiplex immunoassay. Percent changes in 6hps plasma cytokines (with respect to 0hps) were calculated and values were plotted individually. Data points above and below the X-axis indicate increased and decreased levels of cytokines respectively. Results are presented as separate data points for 19 patients among whom 15 showed decreased and 4 showed increased levels of TNF-α, IL-1β, IL-1Ra, IL-7, IL-8 and MIP-1a at 6hps plasma.

Expression of pathogen recognition surface receptors on circulating monocytes post-surgery

The following receptors on monocytes were scored by multicolour flow-cytometry pre- and post-surgery in all patients: toll-like receptors TLR2 and TLR4, CD-36 a scavenger receptor, co-stimulatory molecules CD40 and CD80, and HLA-DR. Expression levels of all the above listed receptors were significantly decreased (P<0.05 to P<0.01) in hypo-responsive patients at 6 hrs post-surgery, very similar to inflammatory plasma cytokine levels in this group (Figure 2). There was however no significant change in any of the receptor levels in hyper-responsive patients (Figure 2).

e3a4f650-0318-4d00-a823-209c44836c33_figure2.gif

Figure 2. Effect of surgery on expression of monocyte surface receptors.

Whole blood collected from patients at 0, 6 and 24 hrs post-surgery was stained with fluorescent conjugated anti-human antibodies for CD14, HLA-DR, CD40, CD80, TLR4, TLR2 and CD36 in two different panels as mentioned in materials and methods section. Percentage of HLA-DR+, CD40+, CD80+, TLR4+, TLR2+ and MFI of CD36 on CD14+ monocytes derived by flow-cytometric analysis is shown. Values are presented as mean±SEM of 7 hypo-responsive and 4 hyper-responsive individuals. Dotted black lines indicate mean values of respective parameters for healthy controls (n=16). Statistical comparisons were performed among all time points by one way ANOVA (*P<0.05 and **P<0.01).

Activation of PBMCs by TLR2 and TLR4 agonists is impaired in hypo-responsive patients

Decreased plasma cytokines as well as receptors on monocytes 6 hrs post-surgery in hypo-responsive patients as shown above indicated an intrinsic defect in responding to TLR agonists. This was experimentally tested by stimulating whole blood with LPS, a TLR4 agonist and PAM3CSK4, a TLR2 agonist at different time points post-surgery and scoring intracellular TNFα in circulating monocytes (Ly6G-CD14+). The results are shown in Figure 3 – circulatory monocytes of hypo-responsive patients tested 6 hrs post-surgery responded significantly less to LPS (P<0.05) as well as PAM3CSK4 (non significant) when compared with stimulation of their cells pre-surgery –the decreased activation was more prominent to LPS than to PAM3CSK4 (Figure 3). The impaired responses recovered to pre-surgery levels at 24 hrs post-surgery. There was no effect in hyper-responsive patients in terms of response to TLR ligands. The response to both TLR2 and TLR4 agonists were comparable pre- and post-surgery in these patients.

e3a4f650-0318-4d00-a823-209c44836c33_figure3.gif

Figure 3. Effect of surgery on PAMP induced cytokine production by peripheral blood monocytes in vitro.

Whole blood samples collected from patients at 0, 6 and 24 hrs post-surgery were stimulated with LPS (10ng/ml) (A) and PAM3CSK4 (10ng/ml) (B) for 2 hrs in presence of brefeldin-A (1X). Cells were surface stained for CD14 and CD66b followed by fixation, permeabilization and intracellular staining for TNF-α. MFI of TNF-α in CD14+CD66b- gated monocytes was measured by flow-cytometry and values were presented as mean±SEM of hypo-responsive (n=7, left panel) and hyper-responsive (n=4, right panel) individuals separately. Statistical comparisons were performed among all time points using one way ANOVA (*P<0.05).

Pre-surgery plasma cytokines and monocyte receptor expression determine post-surgery inflammation status

Plasma levels of 27 host molecules in normal healthy controls were compared with patients before undergoing surgery. Figure 4a reveals that levels of IL-1β, IL-8, MIP-1a and TNF-α are significantly higher (P<0.05 to P<0.001) in hypo-responsive patients when compared with healthy controls. The levels between hyper-responsive group and healthy controls were however comparable. Similarly pre-surgery expression of CD36, CD40, CD80 and HLA-DR on circulating monocytes were significantly more (P<0.05 to P<0.001) on hypo-responsive patients when compared with controls and there was no significant difference between healthy controls and hyper-responsive cases. These observations suggest that hyper- or hypo-inflammation observed post-elective surgery is determined by pre-existing plasma levels of inflammatory molecules and pathogen responsive surface receptors on monocytes.

e3a4f650-0318-4d00-a823-209c44836c33_figure4.gif

Figure 4. Levels of plasma inflammatory mediators and monocyte surface receptors in healthy controls and patients pre-surgery.

Plasma levels (pg/ml) of TNF-α, IL-1β, IL-1Ra, IL-7, IL-8 and MIP-1a in healthy controls (n=23) and both hypo (n=15) and hyper-responsive (n=4) patients pre-surgery measured by bead based multiplex immunoassay are shown (A). Surface expression of HLA-DR, CD40, CD80, TLR4, TLR2 (percent of positive cells) and CD36 (MFI) on CD14+ peripheral blood monocytes collected from healthy controls (n=16) and both hypo (n=15) and hyper-responsive (n=4) patients pre-surgery was scored by flow-cytometry (B). Values are presented as mean±SEM and statistical significance for hypo and hyper-responsive individuals with respect to healthy controls was tested by t-Test (*P<0.05, **p<0.01 and ***P<0.001).

Circulating mitochondrial DNAs in elective surgery patients are decreased irrespective of inflammation status post-surgery

Absolute copy number of mtDNA in 0 and 6 hrs post-operative plasma were scored to check role of endogenous danger molecules ‘DAMPs’ post-surgery. DNA was isolated from equal volume of plasma samples and copy number of mitochondrial cytochrome-b DNA was scored by real-time quantitative PCR. Results showed significant decrease (P<0.01) in copy number of mtcyt-b DNA in 6 hrs post-surgery plasma of hypo-responsive individuals. Although not statistically significant hyper-responsive individuals also followed the same trend (Supplementary Figure 3).

Discussion

Inflammation status post-surgery has been a contentious issue - some patients display features of high inflammation and signs of SIRS and others display hypo-responsive or immune paralysis phenotypes. The current study was undertaken to investigate if pre-operative inflammation status would contribute and determine post-operative inflammatory responses in patients undergoing elective surgery. The study design excluded patients undergoing surgery post trauma which could by itself contribute to induction of inflammation before surgery. The results revealed a characteristic bimodal host inflammatory response following elective surgery. The majority of patients with relatively higher pre-existing systemic inflammation displayed lower inflammation parameters post-surgery and, conversely, a small cohort of patients with decreased levels of inflammation before surgery responded vigorously with significantly elevated inflammatory molecules. A comparative analysis of 27 plasma inflammatory biomarkers revealed downregulation of cytokines such as TNF-α, IL-1β, IL-7 and IL-8, chemokines MIP-1a and the antagonist of IL-1 cytokine, IL-1Ra in 79% of subjects whereas the same mediators were upregulated in 21% of subjects at 6 hrs post-surgery. In the former category of patients decreased levels of plasma mediators persisted at 24 hrs also while in the latter the levels increased further at the same time point. On the basis of these initial findings we designated patients with downregulated plasma inflammatory biomarkers as hypo-responsive and those with upregulated plasma inflammatory biomarkers as hyper-responsive individuals. Earlier investigators in our view may have missed such bimodal distribution of inflammation due to faulty analysis of data - most studies compute mean and deviation of each of the parameters pre- and post-surgery without taking cognisance of shift in inflammation parameters in each of the patients.

Factors such as age, sex, type of anaesthesia used, duration of surgery, degree of surgical injury etc. were all comparable between hypo-responsive and hyper-responsive patients. However TLRs that contribute significantly to induction of inflammation by PAMPs and DAMPs were significantly decreased on circulating monocytes in hypo-responsive patients and were either unaltered or marginally increased on monocytes of hyper-responsive individuals at different time points post-surgery. Expression of HLA-DR and co-stimulatory molecules (CD80 and CD86) on monocytes were downregulated in hypo-responsive patients, an observation similar to other reports22,23. Expression of monocyte CD36, a dominant scavenger receptor involved in phagocytosis was significantly downregulated only in hypo-responsive patients. The study of receptors on monocytes and plasma levels of cytokines are only suggestive of hypo- or hyper-inflammation status and its validation would depend on demonstration of response of immune cells to stimulation by PAMPs and DAMPs tested ex vivo – stimulation of whole blood with TLR-2 and TLR-4 agonists revealed significantly decreased induction of TNF-α by monocytes collected from hypo-responsive individuals indicating immunoparalysis.

Further, although previous studies have revealed a positive association of elevated plasma mtDNA with excessive inflammation in critically ill surgery patients21,24,25 we observed reduced copy number of plasma mtDNA in both hypo- and hyper-responsive individuals following surgery. This may be indicative of the fact that increased plasma cytokines along with high copy number of mtDNA are responsible for post-surgical complications while in uncomplicated situations although the plasma cytokines increase the host system takes control over excessive inflammation by reducing the number of plasma mtDNA.

Taken together our data revealed that basal pre-surgery levels of plasma TNF-α, IL-1β, IL-7, IL-8, MIP-1a and monocyte expression of TLR-2, TLR-4 and CD80 etc. are significantly elevated in hypo-responsive patients as compared to hyper-responsive counterparts. These findings also explain several earlier reports on immuneparalysis as well as hyper-inflammation – a paradoxically opposite scenario in cohorts of patients post-surgery1820.

Our observations of bimodal response in patients post-surgery also provides us a model to categorise patients undergoing elective surgery as ‘immune paralysis’ prone vs ‘hyper-Inflammation’ prone. We propose that surgical trauma predominantly and essentially leads to hypo-responsiveness and tolerance critical for regulating innate immune activation for uneventful recovery post-surgery and that failure to do so in a small cohort of patients could result in persistent hyper-inflammation leading to susceptibility to SIRS or sepsis and that pre-existing inflammation status before surgery could play a critical role in determining the clinical outcome. It is however not clear currently from this study if patients who displayed hyper-inflammation phenotype post-surgery would have developed SIRS and/or sepsis since the patients were not followed beyond 24 hrs. It is a major limitation of this study in our view but we are currently addressing this issue and its validation could result in development of robust biomarkers for predicting outcome of surgery. The results of this study hopefully will lead to similar analysis in different surgical cohorts by other investigators. Further, the ability to predict inflammation outcome could also assist in decision making before administering immunosuppressive drugs post-surgery.

Data availability

F1000Research: Dataset 1. Complete blood count raw data, 10.5256/f1000research.6991.d10160326

F1000Research: Dataset 2. Mitochondrial cytochrome-b raw data, 10.5256/f1000research.6991.d10160427

F1000Research: Dataset 3. Flow-cytometry .FCS files and analyzed data files, 10.5256/f1000research.6991.d10161228

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 10 Sep 2015
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Barman P, Mukherjee R, Mohapatra J and Ravindran B. Pre-surgery status determines inflammation levels post-elective surgery [version 1; peer review: 1 approved with reservations, 1 not approved]. F1000Research 2015, 4:766 (https://doi.org/10.12688/f1000research.6991.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 10 Sep 2015
Views
12
Cite
Reviewer Report 11 Apr 2017
Rami A Namas, Department of Surgery, University of Pittsburgh, Pittsburgh, PA, 15213, USA 
Approved with Reservations
VIEWS 12
The manuscript entitled "Pre-surgery status determines inflammation levels post-elective surgery" presents a single center prospective observational study that evaluates the impact of systemic inflammation prior to elective surgery and its correlation with outcomes post-surgery.
General remarks:
The research ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Namas RA. Reviewer Report For: Pre-surgery status determines inflammation levels post-elective surgery [version 1; peer review: 1 approved with reservations, 1 not approved]. F1000Research 2015, 4:766 (https://doi.org/10.5256/f1000research.7528.r21176)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
16
Cite
Reviewer Report 03 Apr 2017
Michael Bauer, Center for Sepsis Control & Care (CSCC), Department of Anesthesiology & Critical Care, Jena University Hospital, Jena, Germany 
Not Approved
VIEWS 16
Barman et al. report data on the impact of “pre-surgery status” on post-operative surrogates of the inflammatory response to surgery. The overall concept to assess pre-existing health status as a confounder for post-operative inflammation is not completely new and the ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Bauer M. Reviewer Report For: Pre-surgery status determines inflammation levels post-elective surgery [version 1; peer review: 1 approved with reservations, 1 not approved]. F1000Research 2015, 4:766 (https://doi.org/10.5256/f1000research.7528.r21476)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 10 Sep 2015
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.