Keywords
protein transfer, membrane fusion, cell-cell communication, flagellum, cilium, Trypanosoma, lattice light sheet microscopy, structured illumination microscopy
protein transfer, membrane fusion, cell-cell communication, flagellum, cilium, Trypanosoma, lattice light sheet microscopy, structured illumination microscopy
Intercellular bridges enabling the direct exchange of macromolecules between cells have been described in a diverse set of multicellular and unicellular organisms. These include plasmodesmata in plants, septal pores in fungi and gap junctions and tunnelling nanotubes in animal cells1–5. Plasmodesmata permit the transfer of transcription factors and mRNAs, triggering developmental programs in neighbouring cells6. In contrast, only small molecules up to 1 kDa can pass through gap junctions. Tunnelling nanotubes (TNT) are dynamic, ultrathin membranous structures that have been observed to form de novo when mammalian cells were mixed in culture5. They have been implicated in tissue repair, development and electrical coupling of cells and permit the transfer of whole organelles such as lysosomes or mitochondria, over distances up to several cell diameters7–11.
Recently it was shown that green fluorescent protein (GFP) can be transferred from cancer cells to epithelial cells and it was postulated that this happens through a transient membrane fusion between the cells12. Intercellular bridges can also be hijacked by pathogens to infect new host cells. TNTs can be involved in the spread of HIV and prions, and plasmodesmata are used by several viruses to spread through the host plant13–15. Prokaryotes are also capable of direct exchange of macromolecules via intercellular bridges. Bacillus subtilis has been reported to exchange proteins and non-conjugative plasmids through TNT-like structures16. In addition, the social bacterium Myxococcus xanthus can exchange outer membrane proteins by transient outer membrane fusion17,18. In summary, targeted exchange of macromolecules by direct cell-cell contact seems to be a widespread in nature. To date, however, no intercellular bridges have been described in protozoa.
Trypanosoma brucei is a unicellular eukaryote that causes human sleeping sickness and nagana in domestic animals. The parasite depends on tsetse flies for its transmission. Tsetse flies feed exclusively on mammalian blood and, in the process, can acquire parasites from infected hosts and transmit their progeny to new hosts. In the course of transmission, trypanosomes progress through several distinct life-cycle stages in the bloodstream of their mammalian host and in the alimentary tract of the fly (reviewed in 19). All life-cycle stages are extracellular and all are equipped with a single flagellum containing a canonical 9+2 axoneme and an extra-axonemal structure called the paraflagellar rod20. In addition to its function in motility, the trypanosome flagellum appears to serve as a sensory organelle21–23.
Trypanosomes can interact with each other as well as with their hosts. In the mammalian bloodstream they extrude extracellular vesicles originating from the flagellar membrane; these can transfer virulence factors from one trypanosome strain to the other and contribute to trypanosome pathogenesis24. Bloodstream form trypanosomes also communicate with each other by a quorum-sensing mechanism that favours chronic infection and host survival25,26. Proliferative slender bloodstream forms release a soluble factor that promotes their differentiation to non-proliferative stumpy forms. The chemical identity of this factor is unknown, but it can be mimicked by cell-permeable cyclic AMP or AMP analogues25,27. Stumpy forms are pre-adapted to survive transmission to the tsetse fly and to differentiate to the next stage of the life cycle, the procyclic form, in the insect midgut28,29. Several years ago it was shown that procyclic trypanosomes exhibit social motility when cultured on a semi-solid surface, in a manner reminiscent of social swarming by bacteria30. This unexpected behaviour shows that procyclic trypanosomes also have the ability to communicate with each other, but the basis of this is largely unknown23. In order to complete transmission via the tsetse, parasites must migrate from the midgut to the salivary glands. This constitutes a population bottleneck and only very small numbers of trypanosomes make this transition31. Once in the glands the parasites attach to the salivary gland epithelium and proliferate as epimastigote forms32. Attachment is mediated by extensive outgrowths of the trypanosome flagellar membrane, which interdigitates between outgrowths of host epithelial cell membranes. The life cycle is completed by an asymmetric division in which one of the progeny is a metacyclic form that can be transmitted to a new mammalian host33.
Trypanosoma brucei can undergo genetic exchange in the tsetse fly as a non-essential part of its life cycle34,35. Both interclonal and intraclonal mating have been reported34,36. Meiotic markers are expressed by trypanosomes in the salivary glands37 and flies co-infected with trypanosomes expressing either red or green fluorescent proteins can give rise to double-positive “yellow” cells in this compartment35. The current model of mating is that cells in the salivary glands undergo meiosis and produce haploid gametes that first interact via their flagella, then fuse together completely38, but the actual fusion event has not been visualised so far. We report here that procyclic form trypanosomes are able to fuse their flagellar membranes, resulting in the exchange of flagellar and cytoplasmic proteins. No transfer of nuclei or DNA was observed. Flagellar membrane fusion is a transient event and the cells lose the transferred fluorescent protein over time. We postulate that the direct protein transfer reported here is a new form of cell-cell communication and that the detection of double-positive trypanosomes in the fly may not always be related to genetic exchange. Furthermore, the relatedness of the trypanosome flagellum to cilia of higher eukaryotes raises the possibility that intercellular protein transfer by this mechanism might be more widespread in eukaryotic organisms.
We initially tagged trypanosomes with different colours in order to study genetic exchange in tsetse flies. For this purpose plasmids encoding different fluorescent proteins (GFP and DsRED) were integrated into defined loci on chromosomes 6 and 10 (see Materials and methods). When flies were co-infected with these tagged procyclic forms, we observed that the growth rates of individual clones differed and one clone/colour overgrew the other. To identify pairs with similar growth rates in culture, pairs of red and green procyclic forms were mixed and their relative numbers monitored by fluorescence microscopy. Unexpectedly, we observed that approximately 1% of the cells were positive for both fluorescent proteins and appeared yellow in merged images. After repeating this experiment several times we discovered that the transfer of cells to fresh medium with fresh FBS led to robust and reproducible production of yellow cells. While most yellow cells observed after 24 hours were single cells with no interacting partner, some were in intimate contact, forming characteristic pairs (Figures 1A & B). This is in contrast to dividing cells, which have two clearly separate flagella and joined posterior ends20. Yellow cells apparently connected by their anterior ends could also be observed (Figure 1C).
A: Double-positive trypanosome after 24 hours co-culture (WT). B: Interacting double-positive trypanosome pair found after 24 hours co-culture (Δproc). C: Double-positive trypanosomes connected at their anterior ends (Δproc). The scale bar indicates 10μm. DsRed tends to accumulate in the nuclei of cells that synthesise it, probably because of its propensity to form tetramers.
Procyclic form trypanosomes are covered by several million copies of glycophosphatidylinositol (GPI)-anchored surface glycoproteins known as EP and GPEET procyclins39. To see if these proteins were required for the formation of yellow cells we used a procyclin null mutant (Δproc;40) tagged with either GFP or DsRED. Mixed cultures of the mutant gave rise to double-positive cells at even higher frequencies than wild-type trypanosomes, reaching 5–7% of the population after 24 hours (Figure S1). No morphological differences could be observed between the procyclin knockout and wild-type parasites or the pairs that they formed. Because of the increased frequency of double-positive cells we used this mutant for some of the experiments reported here. Addition of the chelating agents EDTA or EGTA abolished the formation of yellow cells, indicating a requirement for extracellular calcium (Figure S1).
Since yellow cells are used as a read-out for mating36,41, we initially thought that trypanosomes had undergone some form of genetic exchange, although this has never been documented for procyclic forms. The parasites were tagged with different selectable markers (rendering them resistant to blasticidin and G418, respectively), either at the same locus on the diploid copies of a chromosome or at different chromosomal loci. However, despite repeated attempts, we were never able to isolate genetic hybrids that were resistant to both drugs.
To better investigate how double-positive cells arose we performed time-lapse microscopy using wild-type trypanosomes expressing cytoplasmic DsRED or GFP, together with a GFP-tagged version of Histone 2B to visualize the nucleus. In order to track cells for extended periods we cultured them for 4 hours in medium without FBS, which causes them to adhere to the surface of the culture flask (see Materials and methods). These experiments revealed that the trypanosomes exchanged cytoplasmic proteins in both directions. The interacting cells became double positive within 10 minutes (the interval between images) and they could separate again (Figure 2, Video 1 and Video 2). Some cells stayed connected for more than 7 hours (Video 1), while others separated within 20 minutes (Video 2). Neither cell-cell fusion nor nuclear exchange was observed, arguing against this phenomenon being mating.
Still images from time-lapse fluorescent microscopy of a mixed culture of wild type trypanosomes expressing Histone2B-GFP/cytosolic DsRED or Histone2B-GFP/cytosolic GFP. The time interval between images is indicated at the right corner of the image; the scale bar indicates 10μm; arrows indicate interacting cells. A: First image taken after one hour, the cells are clearly separate and only positive for one fluorescent protein in the cytoplasm. Second image 20 minutes later (1:20), cells are in contact and have become positive for DsRED and GFP. Third image, 7 hours and 20 minutes later (8:40), the cells have separated again. (Video 1) B: First image taken after 8 hours 50 minutes, cells are only positive for one fluorescent protein in the cytoplasm. Second image, cells have become double-positive (09:10). Third image, 20 minutes later the cells have separated again (09:30). (Video 2).
If proteins, but not DNA are exchanged between two cells, it would be expected that they lose one fluorescent protein once they separate. To test this we enriched for double-positive cells and monitored how long they retained both colours. After one round of FACS 26% of trypanosomes in the culture were double-positive (Figure 3). Cells expressing GFP only were sorted as a control. Cell numbers and the percentage of yellow cells were determined every day. While the cell number more then doubled within the first 24 hours, the percentage of yellow cells decreased only slightly, indicating that the yellow cells still proliferated and were not simply overgrown by single positive cells (Figure 3). After 3 days, however, the percentage of yellow trypanosomes returned to background level, consistent with turnover of the transferred proteins.
The experiments described above show that procyclic form trypanosomes are capable of exchanging soluble proteins that are mainly present in the cytoplasm. To test whether surface proteins could also be exchanged we first used cells tagged with a GFP-procyclin fusion protein. In trypanosomes, newly synthesised GPI-anchored proteins gain access to the cell surface via the flagellar pocket. This is an invagination of the plasma membrane where the flagellum emerges from the cell body, and is the only known site of endo- and exocytosis. On exiting the pocket GPI-anchored proteins are distributed along the flagellum to the cell surface42. In cells expressing GFP-procyclin the flagellar pocket is seen as an intensely fluorescent signal (Figure 4A). When trypanosomes expressing cytoplasmic DsRED and GFP-procyclin were mixed together, we observed that DsRED was equally distributed between two interacting cells, but GFP-procyclin was only transferred to the flagellum of the recipient and not the rest of the cell surface (Figure 4A). These results indicate that proteins on the outer leaflet of the plasma membrane can be transferred between cells, but transfer appears to be restricted to the flagellum.
A: Interacting pair of trypanosomes expressing either DsRED (Δproc) or the GPI anchored surface protein EP-GFP (WT). B: Interacting pair of trypanosomes expressing the flagellar protein calflagin44-GFP (WT) or calflagin44-Cherry (WT). C: Interacting pair of trypanosomes expressing either cytoplasmic DsRED (Δproc) or the nucleoside transporter NT10-GFP (WT), which localises to the surface of the cell body, but not to the flagellum. The scale bar indicates 10μm.
Calflagin-44 is an acylated protein that is anchored to the flagellar membrane43. To obtain more information on the involvement of the flagellum we generated stable transformants expressing calflagin-GFP and calflagin-mCherry fusion proteins. These were correctly localised to the flagellum, but the protein was sometimes also detected in the cell body, possibly due to its overexpression. When trypanosomes expressing calflagin-GFP and calflagin–mCherry were co-cultured, interacting pairs had both proteins in their flagella, but calflagins in the cell bodies were not exchanged (Figure 4B). Based on these results we hypothesised that surface proteins that were excluded from the flagellum would not be exchanged. To test this we mixed cells expressing DsRED with trypanosomes expressing a GFP-tagged version of the nucleoside transporter NT10, which is restricted to the cell body44. Interacting pairs from this mixture had DsRED distributed equally between the two cells while NT10-GFP remained only on one cell (Figure 4C and Figure S2). Taken together, these data suggest that the flagellum is the primary site of interaction and protein exchange. In this context it is important to note that soluble GFP and DsRED are able to cross the diffusion barrier of the flagellar transition zone and are therefore present in the flagellar matrix as well as in the cytoplasm.
RNA-binding proteins play a major role in regulating gene expression in trypanosomes. They can alter the stability or translational efficiency of individual mRNAs or mRNA cohorts45, or they can silence them by RNA interference46. To test if RNA-binding proteins could be exchanged between cells we used a tagged form of Argonaute (Ago) with GFP fused to its N-terminus (GFP-Ago). Cytoplasmic proteins >75kDa are normally excluded from flagella and cilia unless they contain targeting signals47–49. One rationale for choosing the GFP-Ago fusion was that the protein is 130 kDa and should therefore require active transport; the second rationale was that it is a catalytic component of the RNA-induced silencing complex. When cells expressed GFP-Ago, the protein was detected in the flagellum as well as in the cytoplasm (Figure 5A). Moreover, when these cells were mixed with cells expressing DsRED, bidirectional exchange of both proteins was observed (Figure 5B). In summary, trypanosomes have the capacity to transport Ago into the flagellum and to transfer it to another cell. This transfer could potentially reprogram gene expression in the recipient cell by transferring small interfering RNAs.
To investigate protein exchange with higher temporal resolution, we performed time-lapse imaging with a lattice light sheet microscope50 using an image acquisition interval of one minute. Again we mixed trypanosomes expressing cytoplasmic GFP or calflagin-mCherry. The exchange of calflagin-mCherry occurred in less than a minute (Figure 6), while it took approximately 2–3 minutes until GFP was equally distributed between two cells (Figure 6 and Video 3). These experiments further demonstrated that interacting pairs were still moving, indicating that the motility function of the flagellum was not impaired (Video 3). Furthermore, complete divisions of interacting cells could be observed (Video 4). While some interacting trypanosomes stayed together for an extended period of time, other interactions were very transient. The shortest interaction we observed was for 1–2 minutes (Video 5).
Still images from lattice light sheet fluorescence microscopy time-lapse video (Video 3) of trypanosomes expressing either GFP (Δproc) or calflagin44-mCherry (WT). The time interval is indicated at the left upper corner of the image. The scale bar is 10μm. First image (00:10): cells are only positive for one fluorescent protein. Second image one minute later (00:11), calflagin44-mCherry is present on both cells, but GFP is detected only weakly in the second cell. Third image: two minutes later (00:13), GFP is equally distributed in both interacting cells.
The fact that trypanosomes exchange proteins anchored to the outer surface of the flagellar membrane (EP procyclin) or the inner surface (calflagin), suggested either fusion of these membranes or a short-range exchange of vesicles had taken place. To distinguish between these possibilities we performed electron microscopy (EM). Since only a few percent of a mixed population is double-positive, and only some of the cells interact at a given time-point, we again enriched for yellow cells by FACS. Using scanning EM we observed the same characteristic pairs of trypanosomes seen by fluorescence microscopy (Figure 7A). The flagella of these pairs appeared thicker than the flagella of single cells, which could be compatible with fusion along their entire length. From these images alone, however, we could not conclude unambiguously that the membranes were fused; it remained possible that they were merely in very close contact. To better characterise the interaction between flagellar membranes we performed transmission EM (Figure 7B and Figure S3). These images demonstrated unequivocally that pairs of cells shared a flagellum with two axonemes and two paraflagellar rods bounded by a single membrane (Figure 7B and Figure S3A). This differs from what happens during cell division, in which the trypanosomes produce a separate new flagellum posterior to the old one. Thus, the most plausible explanation is that the two flagella have fused. We also documented examples of triple and quadruple fusions (Figures S3B & S3C), albeit at a much lower frequency.
A: Scanning electron microscopy of interacting trypanosomes (Δproc). The scale bar indicates 10μm. B: Transmission electron microscopy of fused flagella (Δproc). The scale bar indicates 0.5μm for the upper image and 1.5μm for the lower image; arrows indicate the cell-body (CB) and the flagellum (F). C: Structured illumination microscopy (SIM) of interacting trypanosomes with fused flagella. Trypanosomes were tagged with either DsRED (Δproc) or calflagin44-GFP (WT). The scale bar indicates 10μm.
Structured Illumination Microscopy (SIM) provides a resolution doubling when compared to diffraction limited imaging and complements scanning EM data by delivering information on protein exchange. We therefore applied this method to co-cultures of trypanosomes expressing cytoplasmic DsRED or calfalgin-GFP. This confirmed that large parts of the flagella fuse into a single structure in double-positive cells (Figure 7C). Once again, fusion of multiple cells could be observed (Figure S4A). Pairs with a second flagellum forming on one cell, double-positive cells undergoing cytokinesis and fused cells giving rise to daughter cells were also seen (Figures S4B & C). Taken together, these data suggest that flagellar fusion is a guided process that is part of normal cell functions.
Our results demonstrate that procyclic culture form trypanosomes can use their flagella as conduits for exchanging proteins with other individuals in a population. Cells that become double-positive for GFP and DsRED revert to being single-positive over a period of 72 hours, in agreement with the observation that no DNA is transferred and that these cells are not genetic hybrids. Protein exchange entails fusion of the flagellar membrane, which can be partial or along the entire length. In common with the fusion of plasma membranes between myoblasts51 or of synaptic vesicles with the plasma membrane of neurons in multicellular organisms52, flagellar fusion in trypanosomes is calcium-dependent.
Protein exchange between trypanosomes is bidirectional and can occur in under a minute. This limit of temporal resolution in our experiments was dictated by the need to capture many fields of view in order to observe rare fusion events in a population across time. There are several indications that flagellar fusion does not impair cell function and that it can be reversed. Live imaging revealed that paired cells are motile; pairs can remain together for hours, and even give rise to progeny while in this state, or they can separate within a minute. Thus, the double-positive cells observed 24 hours after mixing could be the result of a transient fusion or they could be daughter cells of previously fused trypanosomes.
Wild-type cells that are double-positive usually occur at extremely low frequencies in co-cultures (≈1%), implying that only a small proportion of the population is fusion competent at any one time. These numbers might be an under-estimate, however, if interactions are more fleeting and less protein is transferred between cells. Furthermore, protein exchange between two green cells or two red cells would not be detected. The percentage of double-positive cells increased when cells were washed and supplied with fresh serum, suggesting that factors that inhibit fusion accumulate in the medium. It is not clear whether both cells need to be in a fusion-competent state or if one cell suffices. In the course of live imaging we noted that paired cells seemed to attract additional cells to fuse (Video 1) and examples of 3 or more fused flagella were observed by transmission EM and SIM (Figure S3 and Figure S4). Many proteins, including several potential signal transducers, are localized to different flagellar domains22,53. The Δproc mutant fused more readily than the wild type, which might reflect increased accessibility of components on the flagellar surface. Extracellular vesicles produced by bloodstream form trypanosomes have a sparser variant surface glycoprotein coat than the cell surface, and it was hypothesised that this might influence their fusogenic properties24.
The trypanosome flagellum has a different lipid and protein composition than the cell body, providing a certain selectivity of exchanged proteins21,53,54. Both soluble and membrane-associated proteins can be translocated between cells provided that they gain access to the flagellum. In contrast, a polytopic membrane protein that is restricted to the surface of the cell body is not transferred between trypanosomes. Although we do not know why trypanosomes exchange cell contents, several possibilities spring to mind. Direct transfer would prevent proteins being diluted or destroyed in the extracellular milieu and might also prevent activation of an antimicrobial response by the host. Sampling each other's proteins and metabolites might enable cells within a population to synchronise. Alternatively, healthy cells might rescue damaged or stressed cells by providing missing components. In this context, two recent publications have shown that tight cell-cell interactions55 or nanotubes56 can enable two bacterial species to exchange missing nutrients. Although double-positive cells seem to proliferate normally after protein exchange, implying that the interaction is relatively benign, we cannot exclude that this mechanism is used by one trypanosome to exploit resources of the other or even to deliver harmful cargo to a competing cell. A further possibility is that exchange might deliver signals for differentiation. Even if protein exchange is transient, it might be sufficient to reprogram the recipient cell. For example, it was shown that inducing expression of a single RNA-binding protein, RBP6, in procyclic (midgut) forms is enough to drive their differentiation to the life-cycle stages normally found in the salivary glands57.
The flagellar proteome of procyclic forms of T. brucei contains a variety of metabolic enzymes, peptidases, heat shock proteins and RNA-binding proteins, all of which have the potential to be exchanged upon fusion53. It has not been established whether mRNA is present in the flagellum, but poly(A)-binding protein 1 has been detected in the flagellar proteome53. Furthermore, when Ago is exchanged between cells, small interfering RNAs (siRNAs) might be carried over as cargo. At present, however, siRNAs cannot be visualised directly by in situ hybridisation, because of issues with sensitivity and specificity.
To date, we have not detected double-positive procyclic (midgut) forms in tsetse flies. GFP and its derivatives appear to be mildly toxic for procyclic forms in vivo and trypanosomes expressing it are often overgrown during co-infections40. This could potentially bias the outcome. It is also possible that we observe an extreme form of flagellar fusion in culture and that many interactions between procyclic forms might be too brief and the amount of exchanged protein too low to be detected unequivocally in vivo. Double-positive trypanosomes definitely occur in the salivary glands of tsetse, and have been construed as evidence of mating35,36,41. The expression of meiotic markers by trypanosomes in the glands37 makes it highly likely that this is indeed the site where genetic hybrids form. Nevertheless, several factors make it challenging to distinguish between mating and protein exchange. Since salivary gland forms of T. brucei cannot be cultured, it is impossible to follow double-positive cells over a longer period of time to monitor loss or retention of fluorescent proteins. The low frequency of mixed salivary gland infections and low abundance of yellow cells also make these studies extremely labour intensive. Several previous observations could indicate that a proportion of double-positive cells in the fly are not genetic hybrids. The current model of genetic exchange in trypanosomes involves meiosis and the formation of haploid gametes, which subsequently fuse together38. When flies were co-infected with cells coding for the meiotic marker HOP1 fused to YFP and cells expressing mRFP, trypanosomes positive for both proteins could be detected, indicating that protein exchange occurred before the formation and fusion of gametes (as also mentioned by the authors of the study;37). Double-positive Leishmania major cells have also been detected during co-infections of sand flies, which again has been taken as evidence of genetic exchange58. It was not possible to isolate their progeny, however, and an alternative explanation might be that these cells had only exchanged proteins, but not DNA.
The list of functions attributed to flagella, in addition to motility, is constantly expanding. Nanotubular structures budding from the flagellar membrane of bloodstream form trypanosomes give rise to extracellular vesicles that are able to transfer proteins between cells24. Protein transfer by extracellular vesicles might reflect a broader form of communication within the trypanosome population, while the protein exchange by flagellar fusion described here could be used for direct, contact-dependent communication between two cells. In addition ectosomes released from the flagella of Chlamydomonas rheinhardtii enable daughter cells to hatch from their mother cell59. The flagella of T. brucei, Leishmania spp, and Chlamydomonas are related to the cilia of higher eukaryotic cells and many proteins involved in intraflagellar transport (IFT) are conserved60. IFT seems to have additional functions that extend to cells without cilia; it has been linked to exocytosis61, and IFT proteins have been localised to the synapse between T cells and antigen-presenting cells62. Very recently a new type of microtubule-based nanotube was described63; this is dependent on IFT proteins for its function in the Drosophila germline. It was proposed that this structure provides selectivity for receptor-ligand interactions, but it was not reported whether membrane fusion occurred or if proteins were transferred from one cell to the other. In this context it is worth noting that attachment of trypanosomes in the salivary glands involves remodeling of both the host epithelial membranes and the parasite flagellar membrane, indicating that the flagellum may be capable of transmitting and receiving signals to and from the host cells. We consider it worth exploring if other flagellated parasites, as well as the sensory cilia of higher eukaryotes also possess the ability to mediate protein exchange between cells.
Unless otherwise specified, chemicals were obtained from Sigma-Aldrich, Switzerland. Oligonucleotide primers were synthesised by Microsynth AG (Balgach, Switzerland). Enzymes were purchased from New England Biolabs.
Procyclic forms of T. b. brucei AnTat 1.164 and genetically manipulated derivatives were used in this study. The deletion mutant Δproc40 was described previously. Trypanosomes were cultured at 27°C in SDM-79 (Amimed, Cat. No. 9-04V01M) supplemented with 10% heat inactivated foetal bovine serum65.
Conditions for double-positive cells: 5 × 106 cells expressing DsRED were mixed with 5 × 106 cells expressing GFP and centrifuged at 1300g for 6 minutes in a 15ml Falcon tube. The cells were resuspended in 10ml phosphate-buffered saline and centrifuged again. The washed trypanosomes were resuspended in 2.5ml SDM-79 with 10% fresh FBS and cultured overnight at 27°C in one well of a six-well plate. The cells tend to adhere weakly to the bottom of the well, so before analysis they were gently flushed loose with a 1ml pipette.
Stable transformation of procyclic form trypanosomes was performed as described66. To clone the plasmids pG-EGFP-Blast-ΔLII and pG-DsRED-Blast-ΔLII, pG-EGFP-ΔLII67 and pG-DsRED-ΔLII68 were digested with the restriction enzymes NheI and ClaI to cut out the neomycin resistance gene. The blasticidin resistance gene was amplified by PCR using the primers NheIBlast (GCTAGCTAGCATGGCCAAGCCT) and ClaBlast (CCATCGATACTCACAGCGACTA) and pC-EP2-ΔLII-Blast as template40 the product was digested with NheI and ClaI and ligated into pG-EGFP-ΔLII and pG-DsRED-ΔLII.
The mCherry coding region was amplified by PCR using the plasmid CWP1:mCherry (a gift from Adrian Hehl, Zürich University) as a template and the primers mCherryfor (TTACCGGTCATGGTGAGCAAGGGCG) and mCherryrev (TTGGATCCCGGGCTTGTACAGCTCGTCCATG). The PCR product was digested with BamHI and AgeI and ligated into BamHI/AgeI digested pG-EGFP-ΔLII, replacing EGFP by mCherry. To change the selectable marker of pG-mCherry-ΔLII from neomycin-resistance to phleomycin-resistance the plasmid G-BIL4-phleo was digested with XbaI and NotI to excise the phleomycin resistance gene. The phleomycin resistance gene was then ligated into the XbaI/NotI-digested pG-mCherry-ΔLII.
To tag Calflagin44 at its C-terminus with EGFP or mCherry, the coding region of Cal44 was amplified by PCR using the primers Cal44for (ATAAGCTTATGGGTTGCTCTGCATCG) and Cal44rev (ATGTCGACGATTACCTTCATTTGCTCC) and genomic DNA as the template. The PCR product was cloned into the pGEM-T Easy Vector System (Promega), subsequently excised with HindIII and SalI, then ligated into HindIII/SalI digested pG-EGFP-Blast-ΔLII and pG-mCherry-Phleo-ΔLII. To tag Ago1 at its N-terminus the Ago1 coding region was amplified by PCR using the primers Ago1SmaFor (CCCGGGATGTCTGACTGGGAAC) and Ago1SmaRev (CCCGGGTTATAGATAATGCATTGTTG) and the product was cloned into the pGEM-T Easy Vector System (Promega). The plasmids pGEM-Ago1 and pG-EGFP-ΔLIIγ69 were digested with the restriction enzyme SmaI and the coding region of Ago1 was ligated into pG-EGFP-ΔLIIγ, correct integration was confirmed by sequencing.
The constructs pG-H2B-GFP-ΔLII and pG-NT10-GFP-ΔLII were described previously44,69.
Cells were washed in phosphate buffered saline (PBS), spread on a microscope slide and mounted with Moviol. Images were taken with a Leica DFC360FX monochrome CCD (charge-coupled-device) camera mounted on a Leica DM5500 B microscope with a 100x oil immersion objective and analysed using LAS AF 1.0 software (Leica).
Structured illumination microscopy (SIM) was performed as described in 70. Cells were fixed for 20 minutes at room temperature with 4% paraformaldehyde and 0.5% glutaraldehyde. For each axial plane of a 3D stack, raw SIM images were acquired at five phase steps spaced by 2π/5 of the illumination pattern period, and this process was repeated with the excitation pattern rotated by ±120° with respect to the first orientation. The axial stepping size was set to 160 nm. The raw data was reconstructed into the 3D super-resolution image based on the algorithm described in 71. In our study, when the result was Fourier transformed back to real space, we applied a gamma apodization function A(k)=1–(k/kmax)γ, with γ = 0.4, rather than the traditional triangle apodization A(k)=1–k/kmax71, where kmax is the maximum support of the expanded optical transfer function (OTF). Therefore, the higher spatial frequencies were not suppressed more than necessary. Furthermore, we strictly follow the azimuthally dependent maximum support kmax(θ) to define the endpoint of the apodization function. All of these provided a better suppression of the ringing artifacts associated with Fourier transformation. After reconstruction, SIM images achieve 110 nm lateral, 350 nm axial resolution.
Trypanosomes (Δproc) expressing either DsRED or GFP were washed in PBS and co-cultured in SDM-79 with 10% fresh FBS for 8 hours at a density of 107 cells/ml. Then the cells were transferred into PBS containing 2% FBS at a density of 1.5×107 cells/ml for sorting. Sorting was performed with a BD FACS ARIA III (BD Biosciences) equipped with a 130μm nozzle running with 10 psi pressure, flow liquid was PBS. The software used was BD FACS DIVA 6.0 (BD Biosciences). To detect GFP a 488nm blue laser with a 530/30nm bandpass filter was used, to detect DsRED a 561 yellow-green laser with a 610/20 bandpass filter was used. Double-positive cells were sorted into SDM-79 10% FBS.
Flow cytometry was performed with living cells in PBS, 104 cells were analysed using a FACSCalibur (BD Biosciences) and analysed with CellQuest Pro (version 5.1.1).
Transmission electron microscopy. Trypanosomes were washed briefly in PBS, then fixed in 2.5% glutaraldehyde in 100 mM sodium cacodylate buffer (pH7.3) for 2 hours at room temperature, followed by post-fixation in 2% OsO4 in cacodylate buffer, pH 7.3. After three washes in distilled water, samples were pre-stained in saturated uranyl acetate solution in distilled water for 30 min at room temperature, extensively washed in distilled water, and dehydrated by stepwise incubation in ethanol (30%-50%-70%-90%-100%). Parasites were then embedded in EPON812 resin as described previously72. Following polymerisation of the resin at 60°C for 24 h, sections of 80 mm thickness were cut on a ultramicrotome (Reichert & Jung, Vienna, Austria), placed onto 300 mesh formvar-carbon-coated nickel grids (Plano, Wetzlar, Germany), and sections were stained with uranyl acetate and lead citrate40. Specimens were viewed on a Phillips 400 TEM operating at 60 kV.
Scanning electron microscopy. Trypanosomes were washed briefly in PBS, then fixed in 2.5% glutaraldehyde in 100 mM sodium cacodylate buffer, pH 7.3, for 2 hours at room temperature, followed by post-fixation in 2% OsO4 in cacodylate buffer, pH 7.3. They were then extensively washed in water, dehydrated by stepwise incubation in ethanol (30%-50%-70%-90%-100%), and two short washes in 50µl hexamethyl-disilazane. Trypanosomes were then taken up in a small volume of hexamethyl-disilazane, and were allowed to settle down on glass coverslips and were air-dried under a fume hood. They were then sputter-coated with gold73 and inspected on a JEOL 840 scanning electron microscope operating at 25 kV.
To immobilise the trypanosomes approximately 3×106 cells of each clone were mixed and centrifuged for 6 minutes at 1300g. The cell pellet was washed with 10 ml PBS and centrifuged again using the same parameters as above. The cells were resuspended in 1 ml SDM-79 without FBS and incubated for 4 hours at 27°C in a glass bottom culture dish (Willco Wells, the Netherlands). During this time the trypanosomes adhered to the bottom of the dish and were immobilised. After 4h 100μl FBS was added to the cells and the time-lapse imaging was started immediately using a Nikon TE2000E-PFS microscope with a 60x objective. DIC and fluorescent images were taken every 10 minutes for 24 hours.
The 4D lattice light sheet measurements were performed using a microscope described previously50. This system illuminates the sample with a massively parallel array of coherently interfering beams comprising a non-diffracting 2D optical lattice. This creates a coherent, spatially structured light sheet that is then dithered to create uniform excitation in a ~600 nm thick plane across the entire field of view. In order to capture the statistically rare fusion events in trypanosome samples, 3D images were acquired from 15 fields of view every 60 seconds for a total duration of 9h12min. Raw data were deconvolved via a 3D iterative Lucy-Richardson algorithm in Matlab version 2013b (The Mathworks, Natick, MA) utilizing an experimentally measured point spread function using 100 nm fluorescent beads (Fluospheres, ThermoFisher Cat #: F8803). Movies were generated using ImageJ (Version 1.49m).
F1000Research: Dataset 1. Raw data for Figure 1, 10.5256/f1000research.8249.s12006774
Click here to access the data.
F1000Research: Dataset 2. Raw data for Figure 4, 10.5256/f1000research.8249.s12006875
Click here to access the data.
F1000Research: Dataset 3. Raw data for Figure 5, 10.5256/f1000research.8249.s12006976
Click here to access the data.
F1000Research: Dataset 4. Raw data for Figure 7C, 10.5256/f1000research.8249.s12007077
Click here to access the data.
F1000Research: Dataset 5. Raw data for Figure S2, 10.5256/f1000research.8249.s12007178
Click here to access the data.
F1000Research: Dataset 6. Raw data for Figure S4, 10.5256/f1000research.8249.s12007279
Click here to access the data.
F1000Research: Dataset 7. Raw data for Video 1, 10.5256/f1000research.8249.s12007580
Click here to access the data.
F1000Research: Dataset 8. Raw data for Video 2, 10.5256/f1000research.8249.s12007781
Click here to access the data.
Access to additional time-lapse imaging data may be arranged by contacting the corresponding author.
Figshare: Time-lapse imaging of wild-type trypanosomes expressing histone 2B-GFP together with cytosolic GFP or DsRED. doi: 10.6084/m9.figshare.3126292.v182
Figshare: Time-lapse imaging of wild-type trypanosomes expressing histone 2B-GFP together with cytosolic GFP or DsRED. doi: 10.6084/m9.figshare.3126352.v183
Figshare: Time-lapse imaging of trypanosomes expressing cytoplasmic GFP (Δproc) or calflagin-mCherry (WT). doi: 10.6084/m9.figshare.3126355.v184
Figshare: Time-lapse imaging of trypanosomes expressing cytoplasmic GFP (Δproc) or calflagin-mCherry (WT). doi: 10.6084/m9.figshare.3126412.v185
Figshare: Time-lapse imaging of trypanosomes expressing cytoplasmic GFP (Δproc) or calflagin-mCherry (WT). doi: 10.6084/m9.figshare.3126415.v186
Conceived and designed the experiments: SI CF IR EB
Performed the experiments: SI, CF, CvS, AH, LD WL
Analysed the data: SI, CF, IR
Wrote the paper: IR, SI
Work in IR’s laboratory was funded by the HHMI Senior International Scholars Program (grant no. 55007650), the Swiss National Science Foundation (grant no. 31003A-144142) and the Canton of Bern. WRL, DL and EB are funded by the Howard Hughes Medical Institute. We also gratefully acknowledge the Janelia Research Campus visitor program.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Arunasalam Naguleswaran, Gaby Schumann and Kent Hill are thanked for reading the manuscript and for providing insightful comments.
Views | Downloads | |
---|---|---|
F1000Research | - | - |
PubMed Central
Data from PMC are received and updated monthly.
|
- | - |
References
1. Ott C, Elia N, Jeong SY, Insinna C, et al.: Primary cilia utilize glycoprotein-dependent adhesion mechanisms to stabilize long-lasting cilia-cilia contacts.Cilia. 2012; 1 (1): 3 PubMed Abstract | Publisher Full TextCompeting Interests: No competing interests were disclosed.
Competing Interests: No competing interests were disclosed.
Alongside their report, reviewers assign a status to the article:
Invited Reviewers | ||
---|---|---|
1 | 2 | |
Version 1 14 Apr 16 |
read | read |
Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list:
Sign up for content alerts and receive a weekly or monthly email with all newly published articles
Already registered? Sign in
The email address should be the one you originally registered with F1000.
You registered with F1000 via Google, so we cannot reset your password.
To sign in, please click here.
If you still need help with your Google account password, please click here.
You registered with F1000 via Facebook, so we cannot reset your password.
To sign in, please click here.
If you still need help with your Facebook account password, please click here.
If your email address is registered with us, we will email you instructions to reset your password.
If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance.
Comments on this article Comments (1)