ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal

[version 1; peer review: 2 approved with reservations]
PUBLISHED 22 Dec 2017
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Background: Anopheles gambiae larvae traditionally thrive in non-polluted environments. We previously documented the presence of the larvae in heavy metal polluted urban aquatic environments and the associated biological cost. The goal of this study was to unravel the molecular dynamics involved in the adaptation of the mosquitoes to the heavy metals.
Methods: Total RNA was extracted from third instar larvae of both cadmium treated populations and untreated control populations. The RNA concentrations were normalized and complementary DNAs were prepared. Then annealing control primer (ACP) technology was applied to establish transcriptional responses in An. gambiae larvae following several generational (n=90) chronic exposures to cadmium. Differentially expressed genes were determined by their differential banding patterns on an agarose gel. Gel extraction and purification was then carried out on the DEGs and these were later cloned and sequenced to establish the specific transcripts.   
Results: We identified 14 differentially expressed transcripts in response to the cadmium exposure in the larvae. Most (11) of the transcripts were up-regulated in response to the cadmium exposure and were putatively functionally associated with metabolism, transport and protein synthesis processes. The transcripts included ATP-binding cassette transporter, eupolytin, ribosomal RNA, translation initiation factor, THO complex, lysosomal alpha-mannosidase, sodium-independent sulfate anion transporter and myotubularin related protein 2. The down-regulated transcripts were functionally associated with signal transduction and proteolytic activity and included Protein G12, adenylate cyclase and endoplasmic reticulum metallopeptidase.
Conclusions: Our findings shed light on pathways functionally associated with the adaptation to heavy metals that can be targeted in integrated vector control programs, and potential An. gambiae larvae biomarkers for assessment of environmental stress or contamination.

Keywords

Anopheles gambiae larvae, differentially expressed genes, cadmium, heavy metal tolerance

Introduction

Heavy metal pollution has become a global environmental problem and severely threatens biological diversity and human health. Our studies on adaptation to heavy metals have documented presence of the mosquitoes in polluted habitats (Mireji et al., 2008) with growing evidence that this adaptation comes at a biological cost to the mosquito (Mireji et al., 2010b). Similar biological costs to adaptations have also been observed elsewhere in Culex pipiens L responses to cadmium, copper, lead and mercury (El-Sheikh et al., 2010). To date, molecular dynamics underpinning heavy metal tolerance in insects have been tied to transcripts and genes associated functionally with immunity (Sorvari et al., 2007) and defense and repair mechanisms such as glutathione transferases and heat shock proteins (Liao & Freedman, 1998; Kim et al., 2000; Stohs et al., 2001). We have previously putatively implicated metallothioneins, alpha-tubulin and cytochrome p450 genes associated with defense, repair and pyrethroid metabolism mechanisms in insects with heavy metal tolerance, using single gene assessment approaches with Anopheles gambiae mosquito larvae (Mireji et al., 2010b; Mireji et al., 2006; Musasia et al., 2013). Here, we have emulated ab initio relatively higher throughput annealing control primer (ACP) transcriptional profiling, to identify:

  • 1) Pathways functionally associated with heavy metal adaptation observed in the field and their associated biological costs (Mireji et al., 2008; Mireji et al., 2010b); and

  • 2) Potential An. gambiae larvae biomarkers that can be applied for assessment of environmental stress or contamination.

Methods

Sample insects

Anopheles gambiae s.s mosquitoes that had been collected from the Mbita field station (00.025’S, 34.013’E), Homa Bay County in Kenya were used for the study. The colony was kept in the Animal Rearing and Quarantine Unit (ARQU) at the International Centre of Insect Physiology and Ecology (ICIPE), Nairobi, Kenya. Larval stages of Anopheles gambiae s.s. were selected for tolerance to cadmium heavy metal through chronic exposures of Maximun Acceptable Toxicant Concentration (MATC) that had been empirically determined (Mireji et al., 2010a). Cadmium metal tolerant strains and control (untreated) strains of the mosquito were raised separately and in triplicates. All subsequent generations of the mosquito were subjected to chronic exposures of cadmium metal as described in Mireji et al., (2010a). Standard Operating Procedure (SOP) for the rearing of Anopheles mosquitoes was followed for colony maintenance (Ford & Green, 1972). Cadmium used in our study was applied as Cadmium Chloride (CdCl2) 99.99% pure (Fisher Scientific LLC, Fair Lawn, NJ, U.S.A).

RNA isolation

Total RNA was extracted from the third instar larvae of experimental and control An. gambiae populations using Trizol (Invitrogen). Quantification of the extracted RNA was done using the micro-spectrophotometer Genequant pro (Amersham Pharmacia Ltd., Bucks, UK). In addition, DNaseI digestion was carried out to remove any residual DNA that could present in the extracted RNA. Total RNA that was isolated and stored at -80°C.

GeneFishingâ„¢ Reverse Transcription

The total RNA extracted from experimental and control An. gambiae populations were normalized to same concentrations and directly used for the synthesis of first strand complementary DNA (cDNA) using reverse transcriptase (Hwang et al., 2003). Reverse transcription was carried out in a final reaction volume of 20µl containing 2µg of the purified mRNA at 42°C for 1.5 hours. The components of the reaction were: 4µl of 5X reaction buffer (Promega, Madison, WI, U.S.A), 2µl of 10µmol cDNA synthesis dT-ACP 1 primer (5’- CGTGAATGCTGCGACTACGATIIIII(T)18-3’), 5µl dNTPS- 2mM each, 0.5µl RNase inhibitor(40U/µl, Promega) and 1µl Moloney murine leukemia virus reverse transcriptase (200U/µl, Promega). The synthesized first strand cDNA was diluted by adding 80µl ultra-purified water. Storage was at -20°C awaiting PCR procedure.

ACP based- GeneFishingâ„¢ PCR

Annealing control primer based PCR using the GeneFishing TM DEG kit from Seegene, Seoul, South Korea (Kim et al., 2004), was used to determine differentially expressed genes in the heavy metal treated group and the control population.

Synthesis of the second strand cDNA and PCR was carried out in a single tube. The second strand was synthesized in one cycle of first stage PCR at 50°C, in a final reaction volume of 20µl. The components in the reaction tubes included 3–5µl of diluted first strand cDNA, 1µl 10Mm dT-ACP2 reverse primer (5’-CTGTGAATGCTGCGACTACGATIIIII(T)15-3’), 10µl 2x master mix (Seegene, Seoul, South Korea) and 1µl 10µM arbitrary ACP (forward primer).

PCR procedures for the synthesis of the second strand were completed in one cycle, at 94°C for 1 min then 50°C for 3min and 72°C for 1 min.

The second stage of the PCR protocol consisted of 40 cycles at 94°C for 40s, 65°C for 40s, 72°C for 40s and the final extension for 10 min at 72°C. 2% agarose gel electrophoresis with ethidium bromide staining was used for separation of the PCR products.

Gel extraction

Differentially expressed bands in the control and cadmium exposed population subjected to the same primer set were excised from the agarose gel using a scapel under Ultra Violet illumination. The gel slices were then purified using the QIAquick® gel extraction kit (QIAGEN, Inc., Valencia, CA), following the instructions from the manufacturer.

Cloning

Gel-purified PCR products were directly cloned into a pGEMT Easy vector (Invitrogen, Carlsbad, CA, USA), using JM109 competent cells. Colonies were grown at 37°C for 18 hours on Luria broth agar plates, containing ampicillin, X-gal and IPTG for blue/white colony screening. Cloned plasmids were then purified using the GeneJET™ Miniprep kit (Fermentus, Thermo Fisher Scientific Inc.), as per the instructions from the manufacturer.

Sequencing

Sequencing was done with ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using M13 primers. The sequences were edited using VecScreen and BioEdit software. Edited sequences were analyzed by searching for similarities in VectorBase against the Anopheles gambiae PEST strain transcripts sequences, AgamP4.6 geneset using the BLASTn search program (Altschul et al., 1990)

Results

We successfully implemented the ACP system to identify differentially expressed genes (DEGs) in larvae chronically exposed to cadmium, as previously demonstrated in blastocyst experiments (Cui et al., 2005; Hwang et al., 2004; Hwang et al., 2005). Our differential banding patterns of the cDNA representation of DEGs is summarized in Figure 1. Fourteen DEGs were identified after chronic exposure of An. gambiae larvae to cadmium heavy metal (Table 1). Most (11) of the differentially expressed genes were induced in cadmium exposed relative to the cadmium un-exposed controls. Our BLAST (REF) results revealed that the cadmium induced transcripts were clustered into metabolism (AGAP008584-RA, AGAP001249-RA and AGAP009563-RA), transport (AGAP012302-RA and AGAP002638-RA) and protein synthesis (AGAP028915-RA, AGAP004750-RA, AGAP028391-RA, AGAP003870-RA, AGAP028907-RA, AGAP028818-RA and AGAP028899-RA) processes.

44b0edc9-3d20-4cef-a4d6-e8cba04fb8b2_figure1.gif

Figure 1. Differential cDNA banding patterns in cadmium treated and control population of mosquito larvae.

The arrows indicate the DEGs observed using ACP 75, ACP 76 and ACP 78 primer set. Number 1 represents Cadmium population while 2 represents control population. M= 50bp molecular marker. High intensity of a band represents an up-regulation of a particular gene in cadmium or control population.

Table 1. Blastn results from VectorBase.

Sequence data obtained was blasted against Anopheles gambiae PEST strain transcript sequences, AgamP4.6 geneset in May 2017.

GeneGene nameDescription of gene productE-Value% IDExpression
pattern
AGAP002638-RAABCH1ATP-binding cassette transporter
(ABC transporter) family H member 1
377.5Up
AGAP001249-RAEupolytin3e-3198.7Up
AGAP028915-RASSU_rRNA_eukaryoticEukaryotic small subunit ribosomal RNA8e-7998.2Up
AGAP004750-RATranslation initiation factor 4G6.487Up
AGAP028915-RASSU_rRNA_eukaryoticEukaryotic small subunit ribosomal RNA8e-7899.4Up
AGAP006187-RAProtein G126.8100Down
AGAP003078-RAEndoplasmic reticulum metallopeptidase 11.580.6Down
AGAP028391-RAlsu rRNA3e-103100Up
AGAP028915-RASSU_rRNA_eukaryoticEukaryotic small subunit ribosomal RNA4e-4996.6Up
AGAP028915-RASSU_rRNA_eukaryoticEukaryotic small subunit ribosomal RNA5e-8198.8Up
AGAP003870-RAThoc7THO complex subunit 76.487Up
AGAP008584-RALysosomal alpha-mannosidase3.490.5Up
AGAP010252-RARpL2360S ribosomal protein L234e-12100Up
AGAP028907-RASSU_rRNA_eukaryoticEukaryotic small subunit ribosomal RNA3e-0691.2Up
AGAP028818-RA5_8S_rRNA5.8S ribosomal RNA3e-3798.9Up
AGAP028899-RASSU_rRNA_eukaryoticEukaryotic small subunit ribosomal RNA2e-08100Up
AGAP009563-RAMyotubularin related protein 20.7491.3Up
AGAP002262-RAAdenylate cyclase 89.6100Down
AGAP012302-RASodium-independent sulfate anion
transporter
0.3688.9Up

Three of the DEGs identified were suppressed in the cadmium exposed larvae and these included AGAP006187-RA, AGAP002262-RA and AGAP003078-RA.

Dataset 1.Sequence data obtained after sequence analysis using the BioEdit software.
http://dx.doi.org/10.5256/f1000research.13062.d187045 The sequences were subsequently taken through a BLAST search. The results of the sequence analysis are shown on the manuscript.
Dataset 2.Sample of the colony PCR experiment.
http://dx.doi.org/10.5256/f1000research.13062.d187046 The gel photo of a colony PCR of 20 samples that was carried out after blue/white colony screening using M13 primers.

Discussion

We identified ATP-binding cassette transporters belonging to the superfamily of membrane proteins that are present in all living organisms (Dean & Annilo, 2005). They are normally associated with movement of substrates such as amino acids, peptides, sugars, metals, inorganic ions, lipids, lipopolysaccharides and xenobiotics across biological membranes (Dawson & Locher, 2006; Hollenstein et al., 2007a). The ABC transporters have been shown to affect development, metabolism and insecticide resistance in insects (Borycz et al., 2008; Dow & Davies, 2006; Ricardo & Lehmann, 2009; Vache et al., 2007). The silencing of the ABCH1 gene has been shown to result in the death of larvae and pupae (Guo et al., 2015). Therefore, induction of the ABC transporters may suggest that they are involved in cadmium transport through membranes to reduce toxicity of cadmium metal to the larvae in their environment.

The induction of the eupolytin gene may have a role in the activation of defense molecules. In a study involving the ground beetle Eupolyphaga sinensis, eupolytin-1 gene encoding a protease was shown to be involved in the activation of plasminogen and hydrolysis of fibrinogen (Yang et al., 2011).

Ribosomal genes are involved in protein synthesis and upregulation of the various arrays of ribosomal RNAs in this study, which suggests their role in enhancing the survival of An. gambiae in the heavy metal polluted environment by the transcription and translation of genes which are important in the adaptation of the larvae to xenobiotics.

The nuclear structure referred to as THO complex is usually conserved in all kingdoms, and it has an important role in the packing of pre-mRNA molecules into RNA-protein assemblies which are termed mRNPs (Köhler & Hurt, 2007). A study carried out recently has shown that the THO complex is required for efficient expression of some genes, ensuring genetic stability thereby preventing transcription-associated recombination (Gewartowski et al., 2012). The expression of the THO complex is suggestive of its role in expressing defense genes that enhance survival of larvae in a Cadmium polluted environment.

Suppression of AGAP006187-RA, AGAP002262-RA and AGAP003078-RA transcripts that included G- Proteins couple receptors to adenylyl cyclase stimulation indicated increasing levels of cAMP and a cascade of events that constitute the signal transduction pathway that drive cellular responses. Metallopeptidases are a ubiquitous and diverse group of enzymes containing both endopeptidases and exopeptidases. Although they vary widely at the sequence, structural, and functional levels, they all require a metal ion for catalytic activity (Rawlings & Salvesen, 2013). The suppression of these important genes involved in signal transduction and proteolytic activity would account for the larval mortality rates that are usually observed in larvae raised in the cadmium heavy metal environment.

Our findings shed light on the adaptation of the An. gambiae mosquito to heavy metals by differentially expressing particular genes in response to a toxicant impact. A study to determine differentially expressed genes in cadmium-exposed sebastes schlegeli unraveled genes related to pathogenesis, extrinsic stresses, and catalytic metabolites (Woo & Yum, 2014). Previous studies have indicated that metallothionein and α-tubulin genes that are present in insects can be used as potential biomarkers (Hare, 1992; Klerks & Weis, 1987; Mattingly et al., 2001; Roesijadi, 1994). Metallothionein was assessed through C. quinquefasciatus mosquito larvae for Copper, Cadmium and Zinc aquatic environmental levels (Sarkar et al., 2004). Therefore, the genes identified might be useful in the development of potential biomarkers that can be used to assess the level of environmental pollution of heavy metal origin in An. gambiae mosquitoes.

Conclusions

We were able to identify genes that are differentially expressed due to chronic exposure of An. gambiae larvae to cadmium metal using the ACP-based PCR method. However, application of more sensitive techniques like those used in proteomics would generate more data.

Data availability

Dataset 1: Sequence data obtained after sequence analysis using the BioEdit software. The sequences were subsequently taken through a BLAST search. The results of the sequence analysis are shown on the manuscript. DOI, 10.5256/f1000research.13062.d187045 (Muturi et al., 2017a).

Dataset 2: Sample of the colony PCR experiment. The gel photo of a colony PCR of 20 samples that was carried out after blue/white colony screening using M13 primers. DOI, 10.5256/f1000research.13062.d187046 (Muturi et al., 2017b).

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 22 Dec 2017
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Muturi CN, Rono MK, Masiga DK et al. Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal [version 1; peer review: 2 approved with reservations]. F1000Research 2017, 6:2173 (https://doi.org/10.12688/f1000research.13062.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 22 Dec 2017
Views
17
Cite
Reviewer Report 29 May 2018
Shüné V. Oliver,  Centre for Emerging, Zoonotic and Parasitic Diseases Centre for Emerging, Zoonotic and Parasitic Diseases, National Institute for Communicable Diseases, Johannesburg, South Africa 
Approved with Reservations
VIEWS 17
This manuscript is technically sound, and presents a worthwhile body of research. I would recommend accepting. However, there is one major correction that must be made before accepting. Please give details about the assessment of RNA integrity. Without this, the ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Oliver SV. Reviewer Report For: Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal [version 1; peer review: 2 approved with reservations]. F1000Research 2017, 6:2173 (https://doi.org/10.5256/f1000research.14161.r34199)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 11 Jun 2018
    Catherine Ngambi, Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya
    11 Jun 2018
    Author Response
    Thanks so much for your positive review of the manuscript.

    I am sorry, I had not given the data about the RNA integrity but had only stated that I ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 11 Jun 2018
    Catherine Ngambi, Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya
    11 Jun 2018
    Author Response
    Thanks so much for your positive review of the manuscript.

    I am sorry, I had not given the data about the RNA integrity but had only stated that I ... Continue reading
Views
22
Cite
Reviewer Report 29 Jan 2018
David Essumang, Department of Chemistry, University of Cape Coast, Cape Coast, Ghana 
Approved with Reservations
VIEWS 22
The main work is outside my expertise and I was struggling to make some meaningful contribution. The bulk of the work is in molecular experimentation and I have limited knowledge in their methods. However, my major concern with the entomological ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Essumang D. Reviewer Report For: Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal [version 1; peer review: 2 approved with reservations]. F1000Research 2017, 6:2173 (https://doi.org/10.5256/f1000research.14161.r29393)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 02 Feb 2018
    Catherine Ngambi, Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya
    02 Feb 2018
    Author Response
    Thanks so much for you review on my article. I appreciate.
    I wanted to respond to the question raised about the number of generations that mosquitoes were exposed to cadmium ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 02 Feb 2018
    Catherine Ngambi, Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya
    02 Feb 2018
    Author Response
    Thanks so much for you review on my article. I appreciate.
    I wanted to respond to the question raised about the number of generations that mosquitoes were exposed to cadmium ... Continue reading

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 22 Dec 2017
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.