The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet

Dewi Irawati Soeria Santoso; Nurul Paramita; Ani Retno Prijanti; Thressia Hendrawan; Swandito Wicaksono

doi:10.12688/f1000research.15127.1

Home Browse The effect of aerobic exercise on relative leukocyte telomere length...

ALL Metrics

-

Views

-

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet

[version 1; peer review: 2 approved with reservations]

Dewi Irawati Soeria Santoso¹, Nurul Paramita ¹, Ani Retno Prijanti², Thressia Hendrawan³, Swandito Wicaksono³

Dewi Irawati Soeria Santoso¹, Nurul Paramita ¹, [...] Ani Retno Prijanti², Thressia Hendrawan³, Swandito Wicaksono³

PUBLISHED 27 Jul 2018

Author details Author details

¹ Department of Medical Physiology, Faculty of Medicine, Universitas Indonesia, Jakarta Pusat, 10430, Indonesia
² Department of Medical Biochemistry and Molecular Biology, Faculty of Medicine, Universitas Indonesia, Jakarta Pusat, 10430, Indonesia
³ Master Program in Biomedical Sciences, Faculty of Medicine, Universitas Indonesia, Jakarta Pusat, 10430, Indonesia

Dewi Irawati Soeria Santoso
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Nurul Paramita
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Ani Retno Prijanti
Roles: Conceptualization, Data Curation, Formal Analysis, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Thressia Hendrawan
Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Visualization, Writing – Original Draft Preparation

Swandito Wicaksono
Roles: Conceptualization, Funding Acquisition, Investigation, Resources, Software

OPEN PEER REVIEW

REVIEWER STATUS

Abstract

Background: There is an increasing number of studies showing that physical activity and aerobic exercise have a positive effect on telomere length. Some studies also show that dynamics of telomere length is influenced by various environmental factors such as lifestyle and diet. However, the association between exercise and diet with telomere length is still questionable. The aim of this study was to examine the effects of aerobic physical exercise on relative telomere length changes in high fat-diet condition in rat animal models.
Methods: This study was an in vivo experimental study using twelve Sprague-Dawley male white rats (12-month-old). Subjects were evenly and randomly divided into two groups (n=6): (1) high fat-diet fed control group; (2) high fat-diet fed and aerobic exercise treatment group. Aerobic exercise was conducted using animal treadmill with intensity of 20 m/min, 5 days/week. At weeks 4 and 8, relative telomere length was compared with week 0 control group, using q-RT-PCR.
Results: Lengthening of relative telomere length was observed in both control and treatment groups at weeks 4 and 8, when compared to week 0 control group. The lengthening in the control group was much greater than the treatment group.
Conclusions: Excessive increase of relative telomere length was seen in high fat-diet conditions. Aerobic exercise for 8 weeks suppresses excessive increase of relative telomere length in high fat-diet conditions.

Keywords

aerobic exercise, telomere length, high fat-diet

Corresponding author: Nurul Paramita

Competing interests: No competing interests were disclosed.

Grant information: This research was funded by Hibah Publikasi Internasional Terindeks untuk Tugas Akhir (PITTA) 2017.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2018 Santoso DIS et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

How to cite: Santoso DIS, Paramita N, Prijanti AR et al. The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet [version 1; peer review: 2 approved with reservations]. F1000Research 2018, 7:1143 (https://doi.org/10.12688/f1000research.15127.1) First published: 27 Jul 2018, 7:1143 (https://doi.org/10.12688/f1000research.15127.1) Latest published: 27 Jul 2018, 7:1143 (https://doi.org/10.12688/f1000research.15127.1)

Introduction

Obesity is a global problem that is associated with high mortality and morbidity. Several studies has shown that obesity increases the risk of cardiovascular disease, renal impairment, diabetes, and even certain cancers^1–3. Meanwhile, the World Health Organization (WHO) showed that in the last 4 decades obesity rates have increased 10 times worldwide³. This phenomenon is worrisome because there is an increasing number of people who have a high risk of developing various diseases associated with obesity.

Some studies show that there is a strong association between the incidence of obesity with the level of physical activity and high fat diet intake. Individuals with low physical activity levels are known to have a higher risk of developing obesity^4,5. Physical activity is also known to have a role on lowering blood glucose levels, improving homeostasis in people with diabetes mellitus, decreasing production of oxidative stress, lowering triglyceride levels in the body, increasing endogenous antioxidants, and can also maintain telomere length, thus reducing cardiovascular metabolic disease risk^6–8.

The role of physical activity in decreasing the risk of cardiovascular metabolic mortality and morbidity is thought to be mediated by maintaining the length of telomeres⁹. A study performed by Goglin et al. demonstrates the association between telomere shortening and increased 5-year mortality in patients with acute coronary syndromes. This study also showed that a decrease in telomere shortening rate would be followed by a decrease in mortality rate¹⁰.

The rate of shortening of the telomere can be suppressed through a healthy lifestyle such as healthy diet and physical activity^9,11. Certain types of food have been shown to have a correlation with telomere length. A Mediterranean-rich diet of olive oil (38% of total energy as fat) has been observed to maintain telomere length¹². In contrast, a high western type diet of sugar and red meat is associated with shortening of the telomere¹².

The aim of this study was to explore the effect of aerobic physical exercise on telomere length under high fat-diet conditions to provide information for further research.

Methods

Experimental animals

Twelve male Sprague-Dawley rats (Rattus norvegicus), weighing 250–450g, aged 12–13 months, were obtained from Central Animal Facility (Bogor Agricultural University) and divided into two groups: control and trained high fat diet. They were acclimatized for 1 week in a controlled room temperature of 24+1°C, with a 12-hour light/dark cycle, and access to food pellets and filtered water ad libitum to adapt to the new environment. They were housed in plastic cages (50×34×25 cm), two animals in each cage. All protocols used in this experiment received approval from the Ethical Animal Care and Use Committee of Faculty of Medicine Universitas Indonesia with approval number 164/UN2.F1/ETIK/2017.

Study design

Before the beginning of the study all rats were acclimatized with high fat-diet for 10 weeks, consisting of 19% fat, 24% protein, and 47.77% carbohydrate. After 10 weeks of acclimatization, the rats were evenly and randomly assigned using a random number into two groups (n=6 per group): (1) the control group (without aerobic exercise) and (2) the treatment group (with aerobic physical exercise). The treatment group received aerobic exercise for 8 weeks. During 8 weeks of intervention, both treatment and control groups were still given a high-fat diet.

Aerobic exercise was conducted using an animal treadmill, with a speed of 20 m/min for 20 minutes, 5 days/week, every morning around 6 am until 8 am. The intervention was carried out at the Biochemistry and Molecular Laboratory, Faculty of Medicine, Universitas Indonesia. All aerobic exercise protocols were supervised by experienced researchers.

Data collection

Blood was collected from both groups after an overnight fasting. All animals were anesthetized intraperitoneally with a ketamine-xylazine (KX) solution before blood was taken. Approximately 1 ml of whole blood was taken from the sinus orbitalis on week 0, week 4 and week 8. Genomic DNA in leukocytes was extracted from peripheral blood. DNA isolation were then performed using DNA isolation kit (GeneAll® ExgeneTM Clinic SV mini). Relative telomere length from isolated DNA were measured on a real-time PCR detection system using a Quantitative PCR method. Kit used for qPCR were pipettes (and tips), optical PCR plates and caps, and master mix. The type of taq used was AmpliTaq Gold DNA polymerase. The model number/name of the PCR machine was Applied Biosystems 7300. The cycling conditions used were 10 min at 95°C, followed by 40 cycles of 95°C for 15 sec, 60°C for 1 min, followed by a dissociation (or melt) curve. The primer sequences were as follows:

Telo F: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGG TTTGGGTT
Telo R: GGCTTGCCTTACCCTTACCCTTACCC TTACCCTTACCCT
36B4 F: ACTGGTCTAGGACCCGAGAAG
36B4 R: TCAATGGTGCCTCTGGAGATT

The primers were obtained from rodent (GenScript®). Relative telomere length was calculated using the formula of 2^-ΔΔ^Ct13.

Statistical analysis

All statistical analysis was performed using SPSS 20 for Windows. Because the distribution of data is not normal, the data was assessed using a nonparametric Kruskal-Wallis test.

Results

The characteristics of the animals are shown in Table 1. All the animals were in good condition throughout the length of study. There was no significant difference in age, body weight, Lee index and telomere length between control and treatment groups.

Table 1. Characteristics of the animals.

	Control Group	Treatment Group
Age (months)	12-13	12-13
Body weight (g)	370.5 ± 51.32	352.5 ± 30.95
Body Mass Index (Lee Index)	307.34 ± 8.66	318.71 ± 10.34
Telomere length at baseline (week 0)	0.993 (0.302 – 3.026)	0.971 (0.493 – 5.059)

There was an increase in relative telomere length at weeks 4 and 8 compared to week 0 in both groups. At week 4, the relative telomere length of the control group (2.231) did not differ much with the treatment group (1.802) when compared to week 0 of control group. At week 8, there was a progressive increase of relative telomere length in both groups compared to week 0 and week 4. Relative telomere length increase in week 8 of the control group was much higher (178.62) compared to week 8 treatment group (74.86) (Figure 1; Table 2).

Figure 1. Comparison of relative telomere length in leukocytes of rats fed a high fat-diet at weeks 0, 4 and 8 between control group (no aerobic exercise) and treatment group (aerobic exercise).

Table 2. Comparison of relative telomere length in leukocytes of rats fed with high-fet diet at week 0, 4 and 8 between control group (no aerobic exercise) and treatment group (aerobic exercise).

Median (minimum-maximum).

	Control Group	Treatment Group	Kruskal-Wallis test (p-value)
Week 0	0.993 (0.302-3.026)	0.971 (0.493-5.059)	0.749
Week 4	2.321 (0.633-9.344)	1.802 (0.912-9.721)	0.873
Week 8	178.621 (95.158-812.49)	74.864 (36.218-295.895)	0.055

Dataset 1.Raw data including the relative telomere length for control and treatment groups at week 0, 4 and 8, and 2-ΔΔCt calculations.

http://dx.doi.org/10.5256/f1000research.15127.d211681

Discussion

One important structures located at the ends of the linear chromosomes is the telomere. In human cells, they are composed of TTAGGG repeats and a number of proteins. Their function is to protect the integrity and stability of the DNA¹⁴.

Many studies showed that telomere length is influenced by a number of factors^9,12,15. Sedentary lifestyle, high blood glucose levels, and increased percentage of body fat have a negative influence on telomere length. The underlying mechanism have been suggested as being mediated through oxidative stress and inflammation¹⁶.

Exercise as a lifestyle intervention has been associated with longer leukocytes telomere length¹⁵. A study by Cherkas on 2401 subject showed that telomere length has a direct relation with increased level of physical activity¹⁷. An observation of physical activity and telomere length by Du et al. on 7813 adult women concluded that moderate and vigorous intensity activity increased telomere length compared with least active women¹⁸. Ludlow et al. studied the effect of physical activity on telomere length in three different groups: sedentary, moderate and overtraining. The result showed a positive effect on telomere length in the moderate group¹⁹.

To date, to our knowledge, very few studies have investigated the relative effect of a specific diet on telomere length. Cassidy et al. found that total fat intake was only inversely associated with leukocytes telomere length and higher polyunsaturated fatty acids (PUFA) intake, specifically linoleic acid intake, was inversely associated with leukocytes telomere length¹¹. Li et al. found that there was no difference in telomere length between consumption of fish oil-rich diet and soy oil-rich diet²⁰. Kiecolt-Glaser et al. compared telomere length between subjects with n-6 PUFA and n-3 PUFA supplementation. They found that telomere length is longer in subject with omega 3 or n-3 PUFA supplementation (high in fish oil) compared to n-6 PUFA supplementation²¹.

Results from our current study showed a lengthening of relative telomere length in both groups in week 4 and week 8. This was in contrast with studies showing telomeres usually shortened with age⁹., but there are also studies which indicate that in vivo, telomere may shorten or elongate, and leukocyte telomere length may fluctuates within months^22,23.

In general, preserved telomere length and lengthening of telomere are considered as something good because it is thought to play an important role in extending the biological age of cells^12,21,24.

Nevertheless, studies have also shown that telomere lengthening can be an initial response that arises after exposure to low doses of various carcinogenic chemicals in vitro and in experimental animals²³. Zhang et al. concluded from their study that subject with longer telomere length had a higher risk of getting lung cancer, and this was especially true for men²⁵.

The positive associations between high fat-diet conditions and telomere length is difficult to explain because a high fat-diet is associated with increased risk of various diseases. Telomeres generally shorten with age, thus, the discovery of telomer elongation in the provision of high-fat diet can be regarded as something that deviates from normal condition. Therefore, the positive associations between high fat-diet conditions and telomere length observed in this study are notable.

Telomere will shorten at each cell division. Telomeres that elongate excessively in both groups in this study may indicate a prolonged period before apoptosis, and this could indicates a change from normal cell function. Currently, the implications of excessive telomere lengthening are still unknown. Our result shows that aerobic exercise can act as a barrier to progressive changes that occur in the relative telomere length caused by a high-fat diet condition. Modulation of oxidative stress in the body is one possible mechanism that may explain how aerobic exercise resist relative telomere changes. Aerobic exercise upregulate genes that encode various antioxidant enzymes. Several studies shows that regular physical exercise increase the body's endogenous antioxidant activity and thus increase body’s resistance to oxidation events^15,26.

Conclusions

Our study showed that exposure to a high fat-diet plays an important role to the emergence of altered telomere length, and aerobic exercise could reduce the progression of the alteration in length. Our results support the hypothesis that leukocyte telomere length is associated with daily dietary intake and physical activities. Further investigation is still needed to explore the mechanism and implications of telomere length changes found in this study.

Data availability

Dataset 1: Raw data including the relative telomere length for control and treatment groups at week 0, 4 and 8, and 2^-ΔΔ^Ct calculations. DOI, 10.5256/f1000research.15127.d211681²⁷.

Competing interests

No competing interests were disclosed.

Grant information

This research was funded by Hibah Publikasi Internasional Terindeks untuk Tugas Akhir (PITTA) 2017.

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Faculty Opinions recommended

References

1. Arroyo-Johnson C, Mincey KD: Obesity Epidemiology Worldwide. Gastroenterol Clin North Am. 2016; 45(4): 571–9. PubMed Abstract | Publisher Full Text | Free Full Text
2. Prospective Studies Collaboration, Whitlock G, Lewington S, et al.: Body-mass index and cause-specific mortality in 900 000 adults: collaborative analyses of 57 prospective studies. Lancet. 2009; 373(9669): 1083–96. PubMed Abstract | Publisher Full Text | Free Full Text
3. Berrington de Gonzalez A, Hartge P, Cerhan JR, et al.: Body-mass index and mortality among 1.46 million white adults. N Engl J Med. 2010; 363(23): 2211–9. PubMed Abstract | Publisher Full Text | Free Full Text
4. Rachmi CN, Li M, Baur LA: Overweight and obesity in Indonesia: prevalence and risk factors-a literature review. Public Health. 2017; 147: 20–9. PubMed Abstract | Publisher Full Text
5. Rauner A, Mess F, Woll A: The relationship between physical activity, physical fitness and overweight in adolescents: a systematic review of studies published in or after 2000. BMC Pediatr. 2013; 13: 19. PubMed Abstract | Publisher Full Text | Free Full Text
6. Colberg SR, Sigal RJ, Fernhall B, et al.: Exercise and type 2 diabetes: the American College of Sports Medicine and the American Diabetes Association: joint position statement. Diabetes Care. 2010; 33(12): e147–67. PubMed Abstract | Publisher Full Text | Free Full Text
7. Saßenroth D, Meyer A, Salewsky B, et al.: Sports and Exercise at Different Ages and Leukocyte Telomere Length in Later Life--Data from the Berlin Aging Study II (BASE-II). Saretzki G, editor. PLoS One. 2015; 10(12): e0142131. PubMed Abstract | Publisher Full Text | Free Full Text
8. Botha M, Grace L, Bugarith K, et al.: The impact of voluntary exercise on relative telomere length in a rat model of developmental stress. BMC Res Notes. 2012; 5(1): 697. PubMed Abstract | Publisher Full Text | Free Full Text
9. Denham J, O’Brien BJ, Charchar FJ: Telomere Length Maintenance and Cardio-Metabolic Disease Prevention Through Exercise Training. Sports Med. 2016; 46(9): 1213–37. PubMed Abstract | Publisher Full Text
10. Goglin SE, Farzaneh-Far R, Epel ES, et al.: Change in Leukocyte Telomere Length Predicts Mortality in Patients with Stable Coronary Heart Disease from the Heart and Soul Study. Wellinger RJ, editor. PLoS One. 2016; 11(10): e0160748. PubMed Abstract | Publisher Full Text | Free Full Text
11. Cassidy A, De Vivo I, Liu Y, et al.: Associations between diet, lifestyle factors, and telomere length in women. Am J Clin Nutr. 2010; 91(5): 1273–80. PubMed Abstract | Publisher Full Text | Free Full Text
12. Freitas-Simoes TM, Ros E, Sala-Vila A: Nutrients, foods, dietary patterns and telomere length: Update of epidemiological studies and randomized trials. Metabolism. 2016; 65(4): 406–15. PubMed Abstract | Publisher Full Text
13. Cawthon RM: Telomere measurement by quantitative PCR. Nucleic Acids Res. 2002; 30(10): e47. PubMed Abstract | Publisher Full Text | Free Full Text
14. O’Sullivan RJ, Karlseder J: Telomeres: protecting chromosomes against genome instability. Nat Rev Mol Cell Biol. 2010; 11(3): 171–81. PubMed Abstract | Publisher Full Text | Free Full Text
15. Arsenis NC, You T, Ogawa EF, et al.: Physical activity and telomere length: Impact of aging and potential mechanisms of action. Oncotarget. 2017; 8(27): 45008–19. PubMed Abstract | Publisher Full Text | Free Full Text
16. Kim S, Parks CG, DeRoo LA, et al.: Obesity and weight gain in adulthood and telomere length. Cancer Epidemiol Biomarkers Prev. 2009; 18(3): 816–20. PubMed Abstract | Publisher Full Text | Free Full Text
17. Cherkas LF, Hunkin JL, Kato BS, et al.: The association between physical activity in leisure time and leukocyte telomere length. Arch Intern Med. 2008; 168(2): 154–8. PubMed Abstract | Publisher Full Text
18. Du M, Prescott J, Kraft P, et al.: Physical activity, sedentary behavior, and leukocyte telomere length in women. Am J Epidemiol. 2012; 175(5): 414–22. PubMed Abstract | Publisher Full Text | Free Full Text
19. Ludlow AT, Zimmerman JB, Witkowski S, et al.: Relationship between physical activity level, telomere length, and telomerase activity. Med Sci Sports Exerc. 2008; 40(10): 1764–71, [cited 2018 May 10]. PubMed Abstract | Publisher Full Text | Free Full Text
20. Li Y, Zhao F, Wu Q, et al.: Fish oil diet may reduce inflammatory levels in the liver of middle-aged rats. Sci Rep. 2017; 7(1): 6241, [cited 2018 May 14]. PubMed Abstract | Publisher Full Text | Free Full Text
21. Kiecolt-Glaser JK, Epel ES, Belury MA, et al.: Omega-3 fatty acids, oxidative stress, and leukocyte telomere length: A randomized controlled trial. Brain Behav Immun. 2013; 28: 16–24. PubMed Abstract | Publisher Full Text | Free Full Text
22. Shin JY, Choi YY, Jeon HS, et al.: Low-dose persistent organic pollutants increased telomere length in peripheral leukocytes of healthy Koreans. Mutagenesis. 2010; 25(5): 511–6. PubMed Abstract | Publisher Full Text
23. Duan X, Yang Y, Wang S, et al.: Changes in the expression of genes involved in cell cycle regulation and the relative telomere length in the process of canceration induced by omethoate. Tumour Biol. 2017; 39(7): 1010428317719782. PubMed Abstract | Publisher Full Text
24. Roake CM, Artandi SE: DNA repair: Telomere-lengthening mechanism revealed. Nature. 2016; 539(7627): 35–6. PubMed Abstract | Publisher Full Text
25. Zhang C, Doherty JA, Burgess S, et al.: Genetic determinants of telomere length and risk of common cancers: a Mendelian randomization study. Hum Mol Genet. 2015; 24(18): 5356–66. PubMed Abstract | Publisher Full Text | Free Full Text
26. Powers SK, Radak Z, Ji LL: Exercise-induced oxidative stress: past, present and future. J Physiol. 2016; 594(18): 5081–92. PubMed Abstract | Publisher Full Text | Free Full Text
27. Santoso DIS, Paramita N, Prijanti AR, et al.: Dataset 1 in: The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.15127.d211681

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 27 Jul 2018

Author details Author details

¹ Department of Medical Physiology, Faculty of Medicine, Universitas Indonesia, Jakarta Pusat, 10430, Indonesia
² Department of Medical Biochemistry and Molecular Biology, Faculty of Medicine, Universitas Indonesia, Jakarta Pusat, 10430, Indonesia
³ Master Program in Biomedical Sciences, Faculty of Medicine, Universitas Indonesia, Jakarta Pusat, 10430, Indonesia

Dewi Irawati Soeria Santoso
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Nurul Paramita
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Ani Retno Prijanti
Roles: Conceptualization, Data Curation, Formal Analysis, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Thressia Hendrawan
Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Visualization, Writing – Original Draft Preparation

Swandito Wicaksono
Roles: Conceptualization, Funding Acquisition, Investigation, Resources, Software

Competing interests

No competing interests were disclosed.

Grant information

This research was funded by Hibah Publikasi Internasional Terindeks untuk Tugas Akhir (PITTA) 2017.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (1)

version 1

Published: 27 Jul 2018, 7:1143

https://doi.org/10.12688/f1000research.15127.1

Copyright

© 2018 Santoso DIS et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

0

SEE MORE DETAILS

CITE

how to cite this article

Santoso DIS, Paramita N, Prijanti AR et al. The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet [version 1; peer review: 2 approved with reservations]. F1000Research 2018, 7:1143 (https://doi.org/10.12688/f1000research.15127.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 27 Jul 2018

Views

11

Reviewer Report 27 Nov 2018

Andrew T. Ludlow, University of Michigan, Ann Arbor, MI, USA

Approved with Reservations

https://doi.org/10.5256/f1000research.16480.r40574

Santoso et al. explore the relationship between a high fat diet, aerobic exercise and telomere length. In this small-scale animal research study, the authors make the unexpected observation that after 8 weeks of high fat diet, telomeres are elongated in ... Continue reading

Santoso et al. explore the relationship between a high fat diet, aerobic exercise and telomere length. In this small-scale animal research study, the authors make the unexpected observation that after 8 weeks of high fat diet, telomeres are elongated in circulating blood cells (leukocytes). They observed in aerobically trained animals that the apparent telomere elongation was significantly attenuated compared to a sedentary control. These interesting findings observations call into question the strict dogmatic view that telomere shortening is the rule in pathology. Human epidemiological studies have reported similar discrepancies, where telomere shortening is not always observed in pathological scenarios but rather telomere elongation can also be apparent in disease situations. While these observations are provocative, I have several concerns with the sample size, the model organism, the method used to measure telomere length, and the interpretation of the data.

This study is very positive in terms that it points out the need to perform longitudinal analysis of telomere biology in both human and model organism studies. Repeat sampling will be critical to moving the field of telomere biology and environmental/lifestyle impacts forward. For instance, what happens to telomere biology or cell biology after 12 weeks on a high fat diet following the apparent rapid and massive telomere elongation event at 8 weeks?

The negatives of this study are the model organism of choice, the measurement biochemistry, the data analysis, and the lack of mechanistic insights provided by the authors.

1. Sample size, model organism, and statistical treatment of the data.

While the effect observed in this study is large, the sample size is small. Further the authors utilize a repeated-measures design and do not analyze the data as such. Each rat’s telomere length was measured three times. Thus, change in telomere length per individual rat should be reported between each time point and analyzed via a repeated measures analysis. Further, with the assay of choice, 6 animals would be borderline powered enough to detect a meaningful change. What were the authors expectations in terms of a priori predictions on the magnitude of change in telomere length?

Are the rats inbred or outbred? This needs to be reported in the document.

Translatability of findings to humans. Rats use a different life history/ life course strategy to promote survival of the species. These animals grow quickly, have a small body size, do not suppress telomerase, reproduce young, and are cancer susceptible while humans grow slowly, have a large body size, suppress telomerase, reproduce late in life, and are cancer resistant. Thus, could this extreme lengthening be due to evolutionary differences between humans and the chosen model organism? That is, humans might not have a similar response compared to rodents.

2. Assay choice.

The Cawthon method or T/S ratio to determine relative telomere length is a valid assay when performed by certain labs, but it can have issues. A critical validation step in the assay that I did not see in the online data is the reference DNA sample. Did the authors have a reference sample of known telomere length that was run on each plate to ensure their assay was performing as expected? This should have been done on each plate and the inter and intra plate coefficient of variation should be reported for the assay in general. This is critical to be sure the findings are not erroneous. The authors could purchase a cell line with a known telomere length, isolate DNA and repeat the T/S ratio on all samples (both known and unknowns/experimental) to ensure the measurement is correct.

I would have expected higher T values across the board. Rats have 25-40 kb telomeres and a single copy of 36B4. Thus, the ratio of telomere copy to 36B4 copy should have been more like 2 or 3, not 1.

3. Interpretation concerns.

What is known about rapid telomere elongation to my knowledge is as follows:
E. Blackburn’s group showed that yeast mutants for telomerase RNA result in ultra-elongated telomeres rapidly and impair cellular survival. Further, some mutants acted as a ‘time-bomb’ and killed cells later in life (slow on set of telomere elongation ¹). In human cancer cells telomere elongation induces cell differentiation and less aggressive tumors ². Another line of evidence from the L. Harrington lab is that telomere elongation reduced cell survival after radiation treatment ³. From epidemiological evidence, telomere trajectory in CVD can be maintained, shorten or elongated in follow up ⁴. Whether or not these changes correlate to health outcomes or are correlated with secondary CVD events is unknown.
Thus, it appears that ultra-long telomere lengths (greater than 15 kb in human) could be equally as ‘bad’ as short telomeres for cell fate decisions. The major cellular and molecular issues of long telomeres are stalled replication forks at telomeres and double strand breaks in the telomeres that a refractory to repair. Do the authors suspect that the immune cells with ultra-long telomeres will die soon after the 8-week period? Is there a major shift in immune cell distribution after 8 weeks on a high fat diet that would indicate a lasting impact of this observation? Are the cells with long telomeres dying?

The concept that telomere length must be maintained at the correct telomere length and that telomere structure and sensing by the cell may be more important that absolute length is an emerging concept in the field. The results from the current study lend to the hypothesis that absolute length is not critical but rather tight regulation and sensing of telomere length is critical to cellular health and in turn gene expression regulation and cellular physiology. This idea needs and deserves more investigation as much of our evidence to date comes from cells grown in culture which may be very different than cells in vivo when it comes to telomere biology.

4. Short duration and extreme impact.

My hypothesis would have been no or very subtle changes in telomere length for this duration of intervention. What are the speculative mechanisms the authors see occurring? Are the leukocytes entering a stress mode whereby they activate telomerase and elongate telomeres dramatically to try to survive? Could this be the beginning of alternative lengthening of telomeres in these cells? Can the author speculate a bit about what they think might be happening in terms of mechanisms?

Issue of timing – in terms of physiology – after 8 weeks on a high fat diet what else is changed in the immune system of these animals? Can the authors provide about how long 8 weeks in a rats’ life would be equivalent to how long on a high fat ‘western’ diet for humans would be?

What other physiological changes occur? Fatty liver? Higher cholesterol? Higher fasting blood glucose? Hormone levels (epi, nor-epi, insulin, IGF-1, glucagon, cortisol, growth hormone, TNF alpha, IL-6, IL-10, etc.). All of these measures could identify correlates to the change in telomere length.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

References

1. McEachern MJ, Blackburn EH: Runaway telomere elongation caused by telomerase RNA gene mutations.Nature. 1995; 376 (6539): 403-9 PubMed Abstract | Publisher Full Text
2. Hirashima K, Migita T, Sato S, Muramatsu Y, et al.: Telomere length influences cancer cell differentiation in vivo.Mol Cell Biol. 2013; 33 (15): 2988-95 PubMed Abstract | Publisher Full Text
3. Fairlie J, Harrington L: Enforced telomere elongation increases the sensitivity of human tumour cells to ionizing radiation.DNA Repair (Amst). 2015; 25: 54-9 PubMed Abstract | Publisher Full Text
4. Farzaneh-Far R, Lin J, Epel E, Lapham K, et al.: Telomere length trajectory and its determinants in persons with coronary artery disease: longitudinal findings from the heart and soul study.PLoS One. 2010; 5 (1): e8612 PubMed Abstract | Publisher Full Text

Competing Interests: No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Respond or Comment

Views

15

Reviewer Report 13 Aug 2018

Ronny Lesmana, Department of Physiology, Padjadjaran University (UNPAD), Bandung, Indonesia; Central Laboratory, Universitas Padjadjaran, Bandung, Indonesia

Hanna Goenawan, Universitas Padjadjaran, Bandung, Indonesia

Approved with Reservations

https://doi.org/10.5256/f1000research.16480.r36736

Study is interesting, however there are some points need to be added:

Training protocol should followed and compared with the protocol of the aerobic exercise in previous report, please cross check and add reference (lesmana et

Study is interesting, however there are some points need to be added:

Training protocol should followed and compared with the protocol of the aerobic exercise in previous report, please cross check and add reference (lesmana et al, 2017¹).
Please present the change in level of profil lipid
Discuss more about factor change and induce telomere characteristic
Reasons the using high fat diet connected to the change telomere.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

References

1. Lesmana R, Iwasaki T, Iizuka Y, Amano I, et al.: The change in thyroid hormone signaling by altered training intensity in male rat skeletal muscle.Endocr J. 2016; 63 (8): 727-38 PubMed Abstract | Publisher Full Text

Competing Interests: No competing interests were disclosed.

We confirm that we have read this submission and believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however we have significant reservations, as outlined above.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 27 Jul 2018

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 1 27 Jul 18	read	read

Ronny Lesmana, Padjadjaran University (UNPAD), Bandung, Indonesia; Universitas Padjadjaran, Bandung, Indonesia

Hanna Goenawan, Universitas Padjadjaran, Bandung, Indonesia
Andrew T. Ludlow, University of Michigan, Ann Arbor, USA

Comments on this article

All Comments(0)

Add a comment

Sign up for content alerts

Browse by related subjects

Back to all reports

Reviewer Report

11 Views

27 Nov 2018 | for Version 1

Andrew T. Ludlow, University of Michigan, Ann Arbor, MI, USA

11 Views Cite this report Responses(0)

Approved With Reservations

Santoso et al. explore the relationship between a high fat diet, aerobic exercise and telomere length. In this small-scale animal research study, the authors make the unexpected observation that after 8 weeks of high fat diet, telomeres are elongated in circulating blood cells (leukocytes). They observed in aerobically trained animals that the apparent telomere elongation was significantly attenuated compared to a sedentary control. These interesting findings observations call into question the strict dogmatic view that telomere shortening is the rule in pathology. Human epidemiological studies have reported similar discrepancies, where telomere shortening is not always observed in pathological scenarios but rather telomere elongation can also be apparent in disease situations. While these observations are provocative, I have several concerns with the sample size, the model organism, the method used to measure telomere length, and the interpretation of the data.

This study is very positive in terms that it points out the need to perform longitudinal analysis of telomere biology in both human and model organism studies. Repeat sampling will be critical to moving the field of telomere biology and environmental/lifestyle impacts forward. For instance, what happens to telomere biology or cell biology after 12 weeks on a high fat diet following the apparent rapid and massive telomere elongation event at 8 weeks?

The negatives of this study are the model organism of choice, the measurement biochemistry, the data analysis, and the lack of mechanistic insights provided by the authors.

1. Sample size, model organism, and statistical treatment of the data.

While the effect observed in this study is large, the sample size is small. Further the authors utilize a repeated-measures design and do not analyze the data as such. Each rat’s telomere length was measured three times. Thus, change in telomere length per individual rat should be reported between each time point and analyzed via a repeated measures analysis. Further, with the assay of choice, 6 animals would be borderline powered enough to detect a meaningful change. What were the authors expectations in terms of a priori predictions on the magnitude of change in telomere length?

Are the rats inbred or outbred? This needs to be reported in the document.

Translatability of findings to humans. Rats use a different life history/ life course strategy to promote survival of the species. These animals grow quickly, have a small body size, do not suppress telomerase, reproduce young, and are cancer susceptible while humans grow slowly, have a large body size, suppress telomerase, reproduce late in life, and are cancer resistant. Thus, could this extreme lengthening be due to evolutionary differences between humans and the chosen model organism? That is, humans might not have a similar response compared to rodents.

2. Assay choice.

The Cawthon method or T/S ratio to determine relative telomere length is a valid assay when performed by certain labs, but it can have issues. A critical validation step in the assay that I did not see in the online data is the reference DNA sample. Did the authors have a reference sample of known telomere length that was run on each plate to ensure their assay was performing as expected? This should have been done on each plate and the inter and intra plate coefficient of variation should be reported for the assay in general. This is critical to be sure the findings are not erroneous. The authors could purchase a cell line with a known telomere length, isolate DNA and repeat the T/S ratio on all samples (both known and unknowns/experimental) to ensure the measurement is correct.

I would have expected higher T values across the board. Rats have 25-40 kb telomeres and a single copy of 36B4. Thus, the ratio of telomere copy to 36B4 copy should have been more like 2 or 3, not 1.

3. Interpretation concerns.

What is known about rapid telomere elongation to my knowledge is as follows:
E. Blackburn’s group showed that yeast mutants for telomerase RNA result in ultra-elongated telomeres rapidly and impair cellular survival. Further, some mutants acted as a ‘time-bomb’ and killed cells later in life (slow on set of telomere elongation ¹). In human cancer cells telomere elongation induces cell differentiation and less aggressive tumors ². Another line of evidence from the L. Harrington lab is that telomere elongation reduced cell survival after radiation treatment ³. From epidemiological evidence, telomere trajectory in CVD can be maintained, shorten or elongated in follow up ⁴. Whether or not these changes correlate to health outcomes or are correlated with secondary CVD events is unknown.
Thus, it appears that ultra-long telomere lengths (greater than 15 kb in human) could be equally as ‘bad’ as short telomeres for cell fate decisions. The major cellular and molecular issues of long telomeres are stalled replication forks at telomeres and double strand breaks in the telomeres that a refractory to repair. Do the authors suspect that the immune cells with ultra-long telomeres will die soon after the 8-week period? Is there a major shift in immune cell distribution after 8 weeks on a high fat diet that would indicate a lasting impact of this observation? Are the cells with long telomeres dying?

The concept that telomere length must be maintained at the correct telomere length and that telomere structure and sensing by the cell may be more important that absolute length is an emerging concept in the field. The results from the current study lend to the hypothesis that absolute length is not critical but rather tight regulation and sensing of telomere length is critical to cellular health and in turn gene expression regulation and cellular physiology. This idea needs and deserves more investigation as much of our evidence to date comes from cells grown in culture which may be very different than cells in vivo when it comes to telomere biology.

4. Short duration and extreme impact.

My hypothesis would have been no or very subtle changes in telomere length for this duration of intervention. What are the speculative mechanisms the authors see occurring? Are the leukocytes entering a stress mode whereby they activate telomerase and elongate telomeres dramatically to try to survive? Could this be the beginning of alternative lengthening of telomeres in these cells? Can the author speculate a bit about what they think might be happening in terms of mechanisms?

Issue of timing – in terms of physiology – after 8 weeks on a high fat diet what else is changed in the immune system of these animals? Can the authors provide about how long 8 weeks in a rats’ life would be equivalent to how long on a high fat ‘western’ diet for humans would be?

What other physiological changes occur? Fatty liver? Higher cholesterol? Higher fasting blood glucose? Hormone levels (epi, nor-epi, insulin, IGF-1, glucagon, cortisol, growth hormone, TNF alpha, IL-6, IL-10, etc.). All of these measures could identify correlates to the change in telomere length.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

References

1. McEachern MJ, Blackburn EH: Runaway telomere elongation caused by telomerase RNA gene mutations.Nature. 1995; 376 (6539): 403-9 PubMed Abstract | Publisher Full Text
2. Hirashima K, Migita T, Sato S, Muramatsu Y, et al.: Telomere length influences cancer cell differentiation in vivo.Mol Cell Biol. 2013; 33 (15): 2988-95 PubMed Abstract | Publisher Full Text
3. Fairlie J, Harrington L: Enforced telomere elongation increases the sensitivity of human tumour cells to ionizing radiation.DNA Repair (Amst). 2015; 25: 54-9 PubMed Abstract | Publisher Full Text
4. Farzaneh-Far R, Lin J, Epel E, Lapham K, et al.: Telomere length trajectory and its determinants in persons with coronary artery disease: longitudinal findings from the heart and soul study.PLoS One. 2010; 5 (1): e8612 PubMed Abstract | Publisher Full Text

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

15 Views

13 Aug 2018 | for Version 1

Ronny Lesmana, Department of Physiology, Padjadjaran University (UNPAD), Bandung, Indonesia; Central Laboratory, Universitas Padjadjaran, Bandung, Indonesia

Hanna Goenawan, Universitas Padjadjaran, Bandung, Indonesia

15 Views Cite this report Responses(0)

Approved With Reservations

Study is interesting, however there are some points need to be added:

Training protocol should followed and compared with the protocol of the aerobic exercise in previous report, please cross check and add reference (lesmana et al, 2017¹).
Please present the change in level of profil lipid
Discuss more about factor change and induce telomere characteristic
Reasons the using high fat diet connected to the change telomere.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

References

1. Lesmana R, Iwasaki T, Iizuka Y, Amano I, et al.: The change in thyroid hormone signaling by altered training intensity in male rat skeletal muscle.Endocr J. 2016; 63 (8): 727-38 PubMed Abstract | Publisher Full Text

Competing Interests

No competing interests were disclosed.

We confirm that we have read this submission and believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however we have significant reservations, as outlined above.

Respond to this report

Responses (0)

[1] 1. Arroyo-Johnson C, Mincey KD: Obesity Epidemiology Worldwide. Gastroenterol Clin North Am. 2016; 45(4): 571–9. PubMed Abstract | Publisher Full Text | Free Full Text

[2] 2. Prospective Studies Collaboration, Whitlock G, Lewington S, et al.: Body-mass index and cause-specific mortality in 900 000 adults: collaborative analyses of 57 prospective studies. Lancet. 2009; 373(9669): 1083–96. PubMed Abstract | Publisher Full Text | Free Full Text

[3] 3. Berrington de Gonzalez A, Hartge P, Cerhan JR, et al.: Body-mass index and mortality among 1.46 million white adults. N Engl J Med. 2010; 363(23): 2211–9. PubMed Abstract | Publisher Full Text | Free Full Text

[4] 4. Rachmi CN, Li M, Baur LA: Overweight and obesity in Indonesia: prevalence and risk factors-a literature review. Public Health. 2017; 147: 20–9. PubMed Abstract | Publisher Full Text

[5] 5. Rauner A, Mess F, Woll A: The relationship between physical activity, physical fitness and overweight in adolescents: a systematic review of studies published in or after 2000. BMC Pediatr. 2013; 13: 19. PubMed Abstract | Publisher Full Text | Free Full Text

[6] 6. Colberg SR, Sigal RJ, Fernhall B, et al.: Exercise and type 2 diabetes: the American College of Sports Medicine and the American Diabetes Association: joint position statement. Diabetes Care. 2010; 33(12): e147–67. PubMed Abstract | Publisher Full Text | Free Full Text

[7] 7. Saßenroth D, Meyer A, Salewsky B, et al.: Sports and Exercise at Different Ages and Leukocyte Telomere Length in Later Life--Data from the Berlin Aging Study II (BASE-II). Saretzki G, editor. PLoS One. 2015; 10(12): e0142131. PubMed Abstract | Publisher Full Text | Free Full Text

[8] 8. Botha M, Grace L, Bugarith K, et al.: The impact of voluntary exercise on relative telomere length in a rat model of developmental stress. BMC Res Notes. 2012; 5(1): 697. PubMed Abstract | Publisher Full Text | Free Full Text

[9] 9. Denham J, O’Brien BJ, Charchar FJ: Telomere Length Maintenance and Cardio-Metabolic Disease Prevention Through Exercise Training. Sports Med. 2016; 46(9): 1213–37. PubMed Abstract | Publisher Full Text

[10] 10. Goglin SE, Farzaneh-Far R, Epel ES, et al.: Change in Leukocyte Telomere Length Predicts Mortality in Patients with Stable Coronary Heart Disease from the Heart and Soul Study. Wellinger RJ, editor. PLoS One. 2016; 11(10): e0160748. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. Cassidy A, De Vivo I, Liu Y, et al.: Associations between diet, lifestyle factors, and telomere length in women. Am J Clin Nutr. 2010; 91(5): 1273–80. PubMed Abstract | Publisher Full Text | Free Full Text

[12] 12. Freitas-Simoes TM, Ros E, Sala-Vila A: Nutrients, foods, dietary patterns and telomere length: Update of epidemiological studies and randomized trials. Metabolism. 2016; 65(4): 406–15. PubMed Abstract | Publisher Full Text

[13] 13. Cawthon RM: Telomere measurement by quantitative PCR. Nucleic Acids Res. 2002; 30(10): e47. PubMed Abstract | Publisher Full Text | Free Full Text

[14] 14. O’Sullivan RJ, Karlseder J: Telomeres: protecting chromosomes against genome instability. Nat Rev Mol Cell Biol. 2010; 11(3): 171–81. PubMed Abstract | Publisher Full Text | Free Full Text

[15] 15. Arsenis NC, You T, Ogawa EF, et al.: Physical activity and telomere length: Impact of aging and potential mechanisms of action. Oncotarget. 2017; 8(27): 45008–19. PubMed Abstract | Publisher Full Text | Free Full Text

[16] 16. Kim S, Parks CG, DeRoo LA, et al.: Obesity and weight gain in adulthood and telomere length. Cancer Epidemiol Biomarkers Prev. 2009; 18(3): 816–20. PubMed Abstract | Publisher Full Text | Free Full Text

[17] 17. Cherkas LF, Hunkin JL, Kato BS, et al.: The association between physical activity in leisure time and leukocyte telomere length. Arch Intern Med. 2008; 168(2): 154–8. PubMed Abstract | Publisher Full Text

[18] 18. Du M, Prescott J, Kraft P, et al.: Physical activity, sedentary behavior, and leukocyte telomere length in women. Am J Epidemiol. 2012; 175(5): 414–22. PubMed Abstract | Publisher Full Text | Free Full Text

[19] 19. Ludlow AT, Zimmerman JB, Witkowski S, et al.: Relationship between physical activity level, telomere length, and telomerase activity. Med Sci Sports Exerc. 2008; 40(10): 1764–71, [cited 2018 May 10]. PubMed Abstract | Publisher Full Text | Free Full Text

[20] 20. Li Y, Zhao F, Wu Q, et al.: Fish oil diet may reduce inflammatory levels in the liver of middle-aged rats. Sci Rep. 2017; 7(1): 6241, [cited 2018 May 14]. PubMed Abstract | Publisher Full Text | Free Full Text

[21] 21. Kiecolt-Glaser JK, Epel ES, Belury MA, et al.: Omega-3 fatty acids, oxidative stress, and leukocyte telomere length: A randomized controlled trial. Brain Behav Immun. 2013; 28: 16–24. PubMed Abstract | Publisher Full Text | Free Full Text

[22] 22. Shin JY, Choi YY, Jeon HS, et al.: Low-dose persistent organic pollutants increased telomere length in peripheral leukocytes of healthy Koreans. Mutagenesis. 2010; 25(5): 511–6. PubMed Abstract | Publisher Full Text

[23] 23. Duan X, Yang Y, Wang S, et al.: Changes in the expression of genes involved in cell cycle regulation and the relative telomere length in the process of canceration induced by omethoate. Tumour Biol. 2017; 39(7): 1010428317719782. PubMed Abstract | Publisher Full Text

[24] 24. Roake CM, Artandi SE: DNA repair: Telomere-lengthening mechanism revealed. Nature. 2016; 539(7627): 35–6. PubMed Abstract | Publisher Full Text

[25] 25. Zhang C, Doherty JA, Burgess S, et al.: Genetic determinants of telomere length and risk of common cancers: a Mendelian randomization study. Hum Mol Genet. 2015; 24(18): 5356–66. PubMed Abstract | Publisher Full Text | Free Full Text

[26] 26. Powers SK, Radak Z, Ji LL: Exercise-induced oxidative stress: past, present and future. J Physiol. 2016; 594(18): 5081–92. PubMed Abstract | Publisher Full Text | Free Full Text

[27] 27. Santoso DIS, Paramita N, Prijanti AR, et al.: Dataset 1 in: The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.15127.d211681

The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet

Abstract

Keywords

Introduction

Methods

Experimental animals

Study design

Data collection

Statistical analysis

Results

Table 1. Characteristics of the animals.

Figure 1. Comparison of relative telomere length in leukocytes of rats fed a high fat-diet at weeks 0, 4 and 8 between control group (no aerobic exercise) and treatment group (aerobic exercise).

Table 2. Comparison of relative telomere length in leukocytes of rats fed with high-fet diet at week 0, 4 and 8 between control group (no aerobic exercise) and treatment group (aerobic exercise).

Discussion

Conclusions

Data availability

Competing interests

Grant information

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

The problem

How to fix it

Competing Interests Policy

Stay Updated