ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet

[version 1; peer review: 2 approved with reservations]
PUBLISHED 27 Jul 2018
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Background: There is an increasing number of studies showing that physical activity and aerobic exercise have a positive effect on telomere length. Some studies also show that dynamics of telomere length is influenced by various environmental factors such as lifestyle and diet. However, the association between exercise and diet with telomere length is still questionable. The aim of this study was to examine the effects of aerobic physical exercise on relative telomere length changes in high fat-diet condition in rat animal models.
Methods: This study was an in vivo experimental study using twelve Sprague-Dawley male white rats (12-month-old). Subjects were evenly and randomly divided into two groups (n=6): (1) high fat-diet fed control group; (2) high fat-diet fed and aerobic exercise treatment group. Aerobic exercise was conducted using animal treadmill with intensity of 20 m/min, 5 days/week. At weeks 4 and 8, relative telomere length was compared with week 0 control group, using q-RT-PCR.
Results: Lengthening of relative telomere length was observed in both control and treatment groups at weeks 4 and 8, when compared to week 0 control group. The lengthening in the control group was much greater than the treatment group.
Conclusions: Excessive increase of relative telomere length was seen in high fat-diet conditions. Aerobic exercise for 8 weeks suppresses excessive increase of relative telomere length in high fat-diet conditions.

Keywords

aerobic exercise, telomere length, high fat-diet

Introduction

Obesity is a global problem that is associated with high mortality and morbidity. Several studies has shown that obesity increases the risk of cardiovascular disease, renal impairment, diabetes, and even certain cancers13. Meanwhile, the World Health Organization (WHO) showed that in the last 4 decades obesity rates have increased 10 times worldwide3. This phenomenon is worrisome because there is an increasing number of people who have a high risk of developing various diseases associated with obesity.

Some studies show that there is a strong association between the incidence of obesity with the level of physical activity and high fat diet intake. Individuals with low physical activity levels are known to have a higher risk of developing obesity4,5. Physical activity is also known to have a role on lowering blood glucose levels, improving homeostasis in people with diabetes mellitus, decreasing production of oxidative stress, lowering triglyceride levels in the body, increasing endogenous antioxidants, and can also maintain telomere length, thus reducing cardiovascular metabolic disease risk68.

The role of physical activity in decreasing the risk of cardiovascular metabolic mortality and morbidity is thought to be mediated by maintaining the length of telomeres9. A study performed by Goglin et al. demonstrates the association between telomere shortening and increased 5-year mortality in patients with acute coronary syndromes. This study also showed that a decrease in telomere shortening rate would be followed by a decrease in mortality rate10.

The rate of shortening of the telomere can be suppressed through a healthy lifestyle such as healthy diet and physical activity9,11. Certain types of food have been shown to have a correlation with telomere length. A Mediterranean-rich diet of olive oil (38% of total energy as fat) has been observed to maintain telomere length12. In contrast, a high western type diet of sugar and red meat is associated with shortening of the telomere12.

The aim of this study was to explore the effect of aerobic physical exercise on telomere length under high fat-diet conditions to provide information for further research.

Methods

Experimental animals

Twelve male Sprague-Dawley rats (Rattus norvegicus), weighing 250–450g, aged 12–13 months, were obtained from Central Animal Facility (Bogor Agricultural University) and divided into two groups: control and trained high fat diet. They were acclimatized for 1 week in a controlled room temperature of 24+1°C, with a 12-hour light/dark cycle, and access to food pellets and filtered water ad libitum to adapt to the new environment. They were housed in plastic cages (50×34×25 cm), two animals in each cage. All protocols used in this experiment received approval from the Ethical Animal Care and Use Committee of Faculty of Medicine Universitas Indonesia with approval number 164/UN2.F1/ETIK/2017.

Study design

Before the beginning of the study all rats were acclimatized with high fat-diet for 10 weeks, consisting of 19% fat, 24% protein, and 47.77% carbohydrate. After 10 weeks of acclimatization, the rats were evenly and randomly assigned using a random number into two groups (n=6 per group): (1) the control group (without aerobic exercise) and (2) the treatment group (with aerobic physical exercise). The treatment group received aerobic exercise for 8 weeks. During 8 weeks of intervention, both treatment and control groups were still given a high-fat diet.

Aerobic exercise was conducted using an animal treadmill, with a speed of 20 m/min for 20 minutes, 5 days/week, every morning around 6 am until 8 am. The intervention was carried out at the Biochemistry and Molecular Laboratory, Faculty of Medicine, Universitas Indonesia. All aerobic exercise protocols were supervised by experienced researchers.

Data collection

Blood was collected from both groups after an overnight fasting. All animals were anesthetized intraperitoneally with a ketamine-xylazine (KX) solution before blood was taken. Approximately 1 ml of whole blood was taken from the sinus orbitalis on week 0, week 4 and week 8. Genomic DNA in leukocytes was extracted from peripheral blood. DNA isolation were then performed using DNA isolation kit (GeneAll® ExgeneTM Clinic SV mini). Relative telomere length from isolated DNA were measured on a real-time PCR detection system using a Quantitative PCR method. Kit used for qPCR were pipettes (and tips), optical PCR plates and caps, and master mix. The type of taq used was AmpliTaq Gold DNA polymerase. The model number/name of the PCR machine was Applied Biosystems 7300. The cycling conditions used were 10 min at 95°C, followed by 40 cycles of 95°C for 15 sec, 60°C for 1 min, followed by a dissociation (or melt) curve. The primer sequences were as follows:

  • Telo F: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGG TTTGGGTT

  • Telo R: GGCTTGCCTTACCCTTACCCTTACCC TTACCCTTACCCT

  • 36B4 F: ACTGGTCTAGGACCCGAGAAG

  • 36B4 R: TCAATGGTGCCTCTGGAGATT

The primers were obtained from rodent (GenScript®). Relative telomere length was calculated using the formula of 2-ΔΔCt13.

Statistical analysis

All statistical analysis was performed using SPSS 20 for Windows. Because the distribution of data is not normal, the data was assessed using a nonparametric Kruskal-Wallis test.

Results

The characteristics of the animals are shown in Table 1. All the animals were in good condition throughout the length of study. There was no significant difference in age, body weight, Lee index and telomere length between control and treatment groups.

Table 1. Characteristics of the animals.

Control GroupTreatment Group
Age (months)12-1312-13
Body weight (g)370.5 ± 51.32352.5 ± 30.95
Body Mass Index (Lee Index)307.34 ± 8.66318.71 ± 10.34
Telomere length at baseline (week 0)0.993 (0.302 – 3.026)0.971 (0.493 – 5.059)

There was an increase in relative telomere length at weeks 4 and 8 compared to week 0 in both groups. At week 4, the relative telomere length of the control group (2.231) did not differ much with the treatment group (1.802) when compared to week 0 of control group. At week 8, there was a progressive increase of relative telomere length in both groups compared to week 0 and week 4. Relative telomere length increase in week 8 of the control group was much higher (178.62) compared to week 8 treatment group (74.86) (Figure 1; Table 2).

d2354cfb-4221-405b-b5e8-1ab6444cb76c_figure1.gif

Figure 1. Comparison of relative telomere length in leukocytes of rats fed a high fat-diet at weeks 0, 4 and 8 between control group (no aerobic exercise) and treatment group (aerobic exercise).

Table 2. Comparison of relative telomere length in leukocytes of rats fed with high-fet diet at week 0, 4 and 8 between control group (no aerobic exercise) and treatment group (aerobic exercise).

Median (minimum-maximum).

Control GroupTreatment GroupKruskal-Wallis test (p-value)
Week 00.993 (0.302-3.026)0.971 (0.493-5.059)0.749
Week 42.321 (0.633-9.344)1.802 (0.912-9.721)0.873
Week 8178.621 (95.158-812.49)74.864 (36.218-295.895)0.055
Dataset 1.Raw data including the relative telomere length for control and treatment groups at week 0, 4 and 8, and 2-ΔΔCt calculations.
http://dx.doi.org/10.5256/f1000research.15127.d211681

Discussion

One important structures located at the ends of the linear chromosomes is the telomere. In human cells, they are composed of TTAGGG repeats and a number of proteins. Their function is to protect the integrity and stability of the DNA14.

Many studies showed that telomere length is influenced by a number of factors9,12,15. Sedentary lifestyle, high blood glucose levels, and increased percentage of body fat have a negative influence on telomere length. The underlying mechanism have been suggested as being mediated through oxidative stress and inflammation16.

Exercise as a lifestyle intervention has been associated with longer leukocytes telomere length15. A study by Cherkas on 2401 subject showed that telomere length has a direct relation with increased level of physical activity17. An observation of physical activity and telomere length by Du et al. on 7813 adult women concluded that moderate and vigorous intensity activity increased telomere length compared with least active women18. Ludlow et al. studied the effect of physical activity on telomere length in three different groups: sedentary, moderate and overtraining. The result showed a positive effect on telomere length in the moderate group19.

To date, to our knowledge, very few studies have investigated the relative effect of a specific diet on telomere length. Cassidy et al. found that total fat intake was only inversely associated with leukocytes telomere length and higher polyunsaturated fatty acids (PUFA) intake, specifically linoleic acid intake, was inversely associated with leukocytes telomere length11. Li et al. found that there was no difference in telomere length between consumption of fish oil-rich diet and soy oil-rich diet20. Kiecolt-Glaser et al. compared telomere length between subjects with n-6 PUFA and n-3 PUFA supplementation. They found that telomere length is longer in subject with omega 3 or n-3 PUFA supplementation (high in fish oil) compared to n-6 PUFA supplementation21.

Results from our current study showed a lengthening of relative telomere length in both groups in week 4 and week 8. This was in contrast with studies showing telomeres usually shortened with age9., but there are also studies which indicate that in vivo, telomere may shorten or elongate, and leukocyte telomere length may fluctuates within months22,23.

In general, preserved telomere length and lengthening of telomere are considered as something good because it is thought to play an important role in extending the biological age of cells12,21,24.

Nevertheless, studies have also shown that telomere lengthening can be an initial response that arises after exposure to low doses of various carcinogenic chemicals in vitro and in experimental animals23. Zhang et al. concluded from their study that subject with longer telomere length had a higher risk of getting lung cancer, and this was especially true for men25.

The positive associations between high fat-diet conditions and telomere length is difficult to explain because a high fat-diet is associated with increased risk of various diseases. Telomeres generally shorten with age, thus, the discovery of telomer elongation in the provision of high-fat diet can be regarded as something that deviates from normal condition. Therefore, the positive associations between high fat-diet conditions and telomere length observed in this study are notable.

Telomere will shorten at each cell division. Telomeres that elongate excessively in both groups in this study may indicate a prolonged period before apoptosis, and this could indicates a change from normal cell function. Currently, the implications of excessive telomere lengthening are still unknown. Our result shows that aerobic exercise can act as a barrier to progressive changes that occur in the relative telomere length caused by a high-fat diet condition. Modulation of oxidative stress in the body is one possible mechanism that may explain how aerobic exercise resist relative telomere changes. Aerobic exercise upregulate genes that encode various antioxidant enzymes. Several studies shows that regular physical exercise increase the body's endogenous antioxidant activity and thus increase body’s resistance to oxidation events15,26.

Conclusions

Our study showed that exposure to a high fat-diet plays an important role to the emergence of altered telomere length, and aerobic exercise could reduce the progression of the alteration in length. Our results support the hypothesis that leukocyte telomere length is associated with daily dietary intake and physical activities. Further investigation is still needed to explore the mechanism and implications of telomere length changes found in this study.

Data availability

Dataset 1: Raw data including the relative telomere length for control and treatment groups at week 0, 4 and 8, and 2-ΔΔCt calculations. DOI, 10.5256/f1000research.15127.d21168127.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 27 Jul 2018
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Santoso DIS, Paramita N, Prijanti AR et al. The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet [version 1; peer review: 2 approved with reservations]. F1000Research 2018, 7:1143 (https://doi.org/10.12688/f1000research.15127.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 27 Jul 2018
Views
13
Cite
Reviewer Report 27 Nov 2018
Andrew T. Ludlow, University of Michigan, Ann Arbor, MI, USA 
Approved with Reservations
VIEWS 13
Santoso et al. explore the relationship between a high fat diet, aerobic exercise and telomere length. In this small-scale animal research study, the authors make the unexpected observation that after 8 weeks of high fat diet, telomeres are elongated in ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Ludlow AT. Reviewer Report For: The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet [version 1; peer review: 2 approved with reservations]. F1000Research 2018, 7:1143 (https://doi.org/10.5256/f1000research.16480.r40574)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
16
Cite
Reviewer Report 13 Aug 2018
Ronny Lesmana, Department of Physiology, Padjadjaran University (UNPAD), Bandung, Indonesia;  Central Laboratory, Universitas Padjadjaran, Bandung, Indonesia 
Hanna Goenawan, Universitas Padjadjaran, Bandung, Indonesia 
Approved with Reservations
VIEWS 16
Study is interesting, however there are some points need to be added:
  1. Training protocol should followed and compared with the protocol of the aerobic exercise in previous report, please cross check and add reference (lesmana et
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Lesmana R and Goenawan H. Reviewer Report For: The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet [version 1; peer review: 2 approved with reservations]. F1000Research 2018, 7:1143 (https://doi.org/10.5256/f1000research.16480.r36736)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 27 Jul 2018
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.