ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Note

Polyglutamine toxicity assays highlight the advantages of mScarlet for imaging in Saccharomyces cerevisiae

[version 1; peer review: 1 approved, 1 approved with reservations]
PUBLISHED 10 Aug 2018
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Development of fluorescent proteins (FPs) enabled researchers to visualize protein localization and trafficking in living cells and organisms. The extended palette of available FPs allows simultaneous detection of multiples fluorescent fusion proteins. Importantly, FPs are originally derived from different organisms from jelly fish to corals and each FP display its own biophysical properties. Among these properties, the tendency of FPs to oligomerize inherently affects the behavior of its fusion partner. Here we employed the budding yeast Saccharomyces cerevisiae to determine the impact of the latest generation of red FPs on their binding partner. We used a yeast assay based on the aggregation and toxicity of misfolded polyQ expansion proteins linked to Huntington’s disease. Since polyQ aggregation and toxicity are highly dependent on the sequences flanking the polyQ region, polyQ expansions provide an ideal tool to assess the impact of FPs on their fusion partners. We found that unlike yemRFP and yFusionRed, the synthetically engineered ymScarlet displayed severe polyQ toxicity and aggregation similar to what is observed for green FP variants. Our data indicate that ymScarlet might have significant advantages over the previous generation of red FPs for use in fluorescent fusions in yeast.

Keywords

fluorescent proteins, mScarlet, yeast, polyglutamine toxicity, aggregation, Huntington’s disease

Introduction

Following the development of the green fluorescent protein (GFP) from the jellyfish Aqueaora victoria (Chalfie et al., 1994), several other FPs with various spectral properties have been characterized (Thorn, 2017), allowing simultaneous detection of multiple fluorescent reporters. Among the most popular alternatives to GFP are the red fluorescent proteins (RFPs) isolated from Anthozoa coral and anemone species. One of the drawbacks of RFPs is that Anthozoa derived FPs are obligate tetramers (Baird et al., 2000; Verkhusha & Lukyanov, 2004). While development of RFPs into monomeric versions has been successful, it is often associated with reduced brightness of the fluorescent signal (Campbell et al., 2002) and therefore reduced overall performance of the resulting monomeric FPs. Moreover, RFPs such as TagRFP and mRuby2 reported as monomeric by passing purified proteins through sizing columns still display high tendency to oligomerize in living mammalian cells (Costantini et al., 2015; Costantini et al., 2012). Thus, under specific circumstances, FPs reported as monomeric can still be prone to oligomerization. Unwanted formation of oligomers could potentially significantly alter the function/localization of the protein of interest fused to the FP and render reporters unreliable (Costantini et al., 2015; Snapp et al., 2003; Zacharias et al., 2002). Indeed, various RFPs (mCherry, mKate2, mRuby, mKO2, mApple, TagRFP-T) have been shown to have differential effects on localization of cdc12 in yeast (Lee et al., 2013). Thus, being able to assess the behavior of fluorescent reporter in a given organism and/or cellular compartment is critical to help optimize fluorescent reporter design (Snapp, 2009).

We recently established a method to rapidly compare the behavior of FPs against a monomeric variant of superfolder GFP (msfGFP) in yeast (Jiang et al., 2017). The assays exploit the ability of polyglutamine expansions associated with Huntington’s disease (HD) to form toxic aggregates in yeast cells. The cause of HD can be traced back to abnormal expansion of a polyQ stretch within the first exon of the gene encoding the Huntingtin protein (Httex1) resulting in chorea and cognitive defects in patients (Gusella & MacDonald, 1995; Huntington, 1872; Penney et al., 1997). Expansion over 36 repeats is known to cause the Htt protein to misfold and aberrantly accumulate into detergent-insoluble amyloid-like aggregates in the cytoplasm of striatal neurons (Penney et al., 1997). Expression of expanded Httex1 in yeast results in severe polyQ aggregation and growth defect (Duennwald, 2013; Krobitsch & Lindquist, 2000; Mason & Giorgini, 2011; Meriin et al., 2002). Interestingly, the nature of the sequences flanking the polyQ regions (in this case fluorescent or epitope tags) greatly affects the propensity of the polyQ expansions to aggregate and to display significant growth defects in yeast (Duennwald et al., 2006). Using polyQ toxicity assays in yeast, we previously showed that a yeast-optimized version of mCherry (termed yemRFP (Keppler-Ross et al., 2008)) displays only a mild growth defects compared to yeast-optimized msfGFP (ymsfGFP) (Jiang et al., 2017). These results lead us to exploit the polyQ toxicity and aggregation assays to explore to effects of two of the most recently available RFPs. Here, we focused on FusionRed, a red monomeric fluorescent variant of mKate2 known for its low cytotoxicity in cells (Shemiakina et al., 2012) that displays low propensity to oligomerize in mammalian cells (Costantini et al., 2015). We also included mScarlet, a monomeric synthetic RFP that was recently shown to outperform other RFPs in terms of brightness of the fluorescent signal (Bindels et al., 2017). Both have yet to be characterized for expression in yeast.

Methods

Yeast strains and culture conditions

All strains are derived from W303A (Thomas & Rothstein, 1989). All experiments were conducted in synthetic complete media (SC) at 30°C.

DNA constructs

yemRFP (Keppler-Ross et al., 2008) was previously described. yFusionRed and ymScarlet were codon optimized for expression in yeast and synthetized by Genscript Inc. based on previously published sequences (Bindels et al., 2017; Shemiakina et al., 2012). RFPs were cloned into the SpeI/SalI site of p415 GPD. Alternatively, RFPs were cloned into the SpeI/SalI sites of p415 GAL1 25Q/68Q Httex1 lacking the proline rich domain, as previously described (Jiang et al., 2017). See Table 1 for a list of plasmids used in this study.

Table 1. Plasmids used in this study.

PlasmidsResistance
marker
Source
P415 GPDLeu(Mumberg et al., 1995)
P415 GPD-yemRFPThis study
P415 GPD-yFusionRed
P415 GPD-ymScarlet
P415 Gal1-FLAG-25Q-ymsfGFP(Jiang et al., 2017)
P415 Gal1-FLAG-68Q-ymsfGFPThis study
P415 Gal1-FLAG-25Q-yemRFP(Jiang et al., 2017)
P415 Gal1-FLAG-68Q-yemRFPThis study
P415 Gal1-FLAG-25Q-yFusionRed
P415 Gal1-FLAG-68Q-yFusionRed
P415 Gal1-FLAG-25Q-ymScarlet
P415 Gal1-FLAG-68Q-ymScarlet

Growth assays

Yeast growth was measured by spotting assay on agar plates. Briefly, cells were cultured overnight to saturation in appropriate selection media. The next day, cells densities were equalized to OD600 0.2 and 5x serial dilutions were spotted on agar plates.

Dot blot

After induction in galactose media overnight, cells were lysed using glass beads in lysis buffer (100 mM Tris pH 7.5; 200 mM NaCl; 1 mM EDTA; 5% glycerol, 1 mM Dithiothreitol (DTT) 4 mM phenylmethylsulfonyl fluoride (PSMF) and protease inhibitor cocktail). Equal amount of proteins were spotted on a nitrocellulose membrane. Membranes were blocked for 30 min in PBS-0.05%Tween at room temperature were then processed for immunoblot. Membranes were probed with anti-FLAG primary antibody (Sigma F3040) overnight at 4°C and subsequently with a secondary anti-mouse fluorescent antibody (Thermo Alexa 555 #A21424) for 1h at room temperature and imaged using a Bio-Rad ChemiDoc MP imaging system. Membranes were then stripped using the Gene Bio-Application stripping buffer and reprobed with an anti-Pgk1 primary antibody (Thermo 22C5D8). In Figure 2, for each individual antibody, both membranes were imaged simultaneously to allow direct comparison of fluorescent signal.

Fluorescent microscopy

Under the different experimental conditions, cells were diluted 10x in growth media and plated in Lab-tek (Thermo Inc.) imaging chambers and processed for fluorescent microscopy. Images in Figure 1 were acquired using a Zeiss AxioVert A1 wide field fluorescent microscope equipped with a 63X NA 1.4 Plan Apopchromat objective, a 560 to 600nM excitation/630 to 705 nm emission bandpass filter and Zeiss Axiocam 506 mono camera. Images presented in Figure 2 were collected using a Zeiss 800 confocal microscope equipped with 488 nm and 561 nm diode lasers and a 63x PlanApochromat NA 1.4 objective.

fa4297b7-0721-4ab0-8495-f90a5a9fdfda_figure1.gif

Figure 1. Comparison of red fluorescent proteins (RFPs) fluorescent intensities in yeast.

(A) yemRFP, yFusionRed and ymScarlet were introduced into centromeric vectors under the control of a constitutive GPD promoter. (B) Representative images from 3 fields of yeast cells expressing different RFPs. Imaging conditions were kept constant between samples to allow direct comparison of fluorescent intensities. Inverted black and white images are shown for clarity. Bar: 5µm (C) Yeast cells expressing the different RFPs were analyzed by flow cytometry and compared to cells carrying an empty vector. (D) Median fluorescent intensities of the various RFPs were calculated from fluorescent data acquired using flow cytometry. *p<0.05.

fa4297b7-0721-4ab0-8495-f90a5a9fdfda_figure2.gif

Figure 2. Unlike yFusionRed, ymScarlet displays a toxic polyQ phenotype similar to ymsfGFP.

(A) Fluorescent proteins (FPs) were cloned in frame with FLAG-Httex1 into a centromeric vector carrying a GAL1 inducible promoter. (B) Yeast cells carrying an empty vector or 25/68Q Httex1 fused to either ymsfGFP, yemRFP, yFusionRed or ymScarlet were grown to saturation overnight in glucose (control) or galactose (polyQ induced) containing media. The next days, cell concentrations were equalized to OD600 0.2 and 5 fold serial dilutions of the cell suspension spotted on synthetic complete agar media plates containing either glucose or galactose. (C) Yeast cells carrying an empty vector or 25/68Q Httex1 fused to ymsfGFP, yemRFP, yFusionRed or ymScarlet or carrying an empty vector were induced overnight in galactose containing media and protein levels analyzed by dot blot using either an anti-FLAG (detection of fluorescent fusions) or anti-Pgk1 antibody (loading control). (D) Representative fluorescent images from 3 fields of yeast cells expressing 25/68Q Httex1 fused to ymsfGFP, yemRFP, yFusionRed or ymScarlet after overnight induction in galactose-containing media.

Flow cytometry

Cell were cultured with appropriate media and processed for flow cytometry using a BD Bioscience FACS Celesta flow cytometer equipped with a 561 Yellow laser for imaging of RFPs. Data were analyzed using the BD FACS Diva software. All conditions were performed in triplicates, 20,000 cells were analyzed and median fluorescence intensities were calculated. No gates were applied.

Statistical analysis

A two-tailed student t-test was used to determine statistical significance between the different experimental conditions in Figure 1D using GraphPad Prism v6.0h.

Results and discussion

To analyze the performance of the three different RFPs in yeast, we first generated codon optimized versions of both FusionRed and mScarlet (termed yFusionRed and ymScarlet, respectively) (Table 2). Centromeric plasmids encoding yFusionRed, yemRFP and ymScarlet under the control of the constitutive GPD promoter were transformed in yeast (Figure 1A). Fluorescent intensities were compared using wide-field fluorescence microscopy (Figure 1B). Median fluorescent intensity (MFI) was then quantified using flow cytometry. Quantification revealed that yFusionRed was significantly dimmer than yemRFP (Figure 1C and D). This result was surprising given that previously published data reported a slightly increased brightness for FusionRed when compared to mCherry (Shemiakina et al., 2012). However, it is known that fluorescent brightness of FPs expressed in yeast can differed from the ones registered for pure purified proteins (Lee et al., 2013). As opposed to yFusionRed, ymScarlet displayed the strongest fluorescent signal (Figure 1C and D). These results are in agreement with previous studies reporting increased brightness of mScarlet compared to other RFs variants (Bindels et al., 2017). Based on the intensity of the fluorescent signal, ymScarlet appears to be the optimal RFP for imaging in yeast.

Table 2. Sequences of yeast optimized fluorescent proteins generated in this study.

NameSequences
yFusionRedATGGTTTCTGAATTGATTAAAGAAAACATGCCAATGAAGTTGTACATGGAAGGTACTGTTAACAACCATCATTTTAAATGTACATC
AGAAGGTGAAGGTAAACCATACGAAGGTACTCAAACAATGAGAATTAAAGTTGTTGAAGGTGGTCCATTGCCATTTGCTTTCGA
TATTTTGGCAACTTCTTTTATGTACGGTTCAAGAACTTTTATTAAGCATCCACCAGGTATTCCAGATTTCTTTAAGCAATCTTTCCCA
GAAGGTTTTACTTGGGAAAGAGTTACTACATATGAAGATGGTGGTGTTTTGACTGCAACACAAGATACATCATTGCAAGATGGTT
GTTTGATCTATAACGTTAAAGTTAGAGGTGTTAATTTTCCAGCTAATGGTCCAGTTATGCAAAAGAAAACTTTGGGTTGGGAAGC
TTCTACTGAAACAATGTACCCAGCAGATGGTGGTTTAGAAGGTGCTTGTGATATGGCATTGAAATTGGTTGGTGGTGGTCATTTG
ATCTGTAATTTGGAAACTACATACAGATCTAAGAAACCAGCTACAAATTTGAAGATGCCAGGTGTTTACAACGTTGATCATAGATT
GGAAAGAATTAAAGAAGCAGATGATGAAACTTACGTTGAACAACATGAAGTTGCTGTTGCAAGATACTCTACAGGTGGTGCTG
GTGACGGTGGTAAATAA
ymScarletATGGTTTCTAAAGGTGAAGCAGTTATTAAGGAATTCATGAGATTCAAGGTACACATGGAAGGTTCTATGAATGGTCACGAATTTG
AAATTGAAGGTGAAGGTGAAGGTAGACCATATGAAGGTACTCAAACTGCTAAGTTGAAGGTTACTAAAGGTGGTCCATTGCCAT
TTTCTTGGGATATTTTGTCTCCACAATTCATGTACGGTTCTAGAGCTTTTACAAAACATCCAGCAGATATTCCAGATTACTACAAGC
AATCATTCCCAGAAGGTTTTAAATGGGAAAGAGTTATGAACTTCGAAGATGGTGGTGCAGTTACTGTTACACAAGATACTTCTTT
GGAAGATGGTACATTGATCTATAAGGTTAAGTTGAGAGGTACTAATTTTCCACCAGATGGTCCAGTTATGCAAAAGAAAACTATG
GGTTGGGAAGCTTCAACAGAAAGATTGTACCCAGAAGATGGTGTTTTGAAGGGTGACATTAAGATGGCATTGAGATTGAAGGA
TGGTGGTAGATATTTGGCTGATTTCAAGACTACATACAAGGCTAAGAAACCAGTTCAAATGCCAGGTGCTTACAACGTTGATAGA
AAGTTGGATATTACTTCTCATAATGAAGATTACACAGTTGTTGAACAATATGAAAGAAGTGAAGGTAGACACAGTACAGGTGGTAT
GGATGAATTATACAAATGA
Dataset 1.Raw data behind Figure 1 and Figure 2.

Next, we sought to determine how the three different FPs affect their fusion partners in living yeast. To this end, we employed the polyQ toxicity assays. Each RFP was cloned in frame with a galactose inducible version of Httex1 carrying either 25Q (non-pathological length) or 68Q (HD-associated) (Figure 2A). 25Q constructs show no growth differences across the different FPs in both uninduced (glucose media) and polyQ-induced (galactose media) conditions indicating that expression of the different constructs results in similar growth phenotypes. When fused to 68Q Httex1, yFusionRed displayed no significant toxicity when compared to the non-toxic 25Q fusion (Figure 2B). Interestingly, ymScarlet displayed severe toxicity, showing a slow growth phenotype comparable to what was observed for ymsfGFP (Figure 2B). In addition, assessment of protein abundance for each constructs using dot blot revealed that both 25 and 68Q yFusionRed fusions were present at lower levels compared to other fluorescent counterparts Figure 2C). The cause of this phenotype is unclear and could result from increased degradation of the fusions. Based on these observations, we then investigated the effects of the different RFPs on polyQ aggregation using fluorescent microscopy. We found that yemRFP displayed robust 68Q aggregation similar to ymsfGFP as we previously described (Jiang et al., 2017). It is important to note that while prone to aggregation, yemRFP polyQ proteins were shown to form aggregates with different biophysical properties (increased detergent solubility) that can account for their moderately toxic nature (Jiang et al., 2017). In accordance with the absence of toxicity noted in the growth assay, 68Q-FusionRed did not form visible aggregates, while ymScarlet displayed strong aggregation propensity (Figure 2D). The absence of aggregation for the 68Q-yFusionRed is consistent with our previous observation showing that yomTagBFP2, a blue fluorescent proteins similarly does not form toxic aggregates (Jiang et al., 2017). In fact, both FusionRed and mTagBFP2 (Subach et al., 2011) are evolved versions of the wild-type RFP from sea anemone Entacmaea quadricolor (Merzlyak et al., 2007). In the case of mScarlet, the protein was evolved from a synthetic template design for generating a monomeric protein. Therefore, based on our data, mScarlet appears to be an attractive alternative to mCherry, which minimizes the effect of the FP on its fusion partner.

Data availability

Dataset 1: Raw data behind Figure 1 and Figure 2. DOI, 10.5256/f1000research.15829.d213385 (Albakri et al., 2018).

Both p415 GPD-yFusionRed and p415 GPD-ymScarlet are available from addgene (#111916/11917). All plasmids are available upon request from the corresponding author.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 10 Aug 2018
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Albakri MB, Jiang Y and Lajoie P. Polyglutamine toxicity assays highlight the advantages of mScarlet for imaging in Saccharomyces cerevisiae [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2018, 7:1242 (https://doi.org/10.12688/f1000research.15829.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 10 Aug 2018
Views
15
Cite
Reviewer Report 21 Aug 2018
Fedor V. Subach, Moscow Institute of Physics and Technology (MIPT), Moscow, Russian Federation 
Approved
VIEWS 15
In this manuscript Albakri Maram et al. demonstrated superior performance of the mScarlet red fluorescent protein over the FusionRed protein in the Huntington’s disease related yeast assay. First, authors showed the higher brightness of non-fused mScarlet protein vs FusionRed during ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Subach FV. Reviewer Report For: Polyglutamine toxicity assays highlight the advantages of mScarlet for imaging in Saccharomyces cerevisiae [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2018, 7:1242 (https://doi.org/10.5256/f1000research.17277.r37082)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 26 Nov 2018
    Patrick Lajoie, Department of Anatomy and Cell Biology, The University of Western Ontario, London, N6A5C1, Canada
    26 Nov 2018
    Author Response
    We thank the reviewer for helpful comments. We have addressed concerns in the new version of the manuscript. See below for the authors’ response to specific points raised during the ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 26 Nov 2018
    Patrick Lajoie, Department of Anatomy and Cell Biology, The University of Western Ontario, London, N6A5C1, Canada
    26 Nov 2018
    Author Response
    We thank the reviewer for helpful comments. We have addressed concerns in the new version of the manuscript. See below for the authors’ response to specific points raised during the ... Continue reading
Views
26
Cite
Reviewer Report 17 Aug 2018
Danny M. Hatters, Dept of Biochem & Mol Biology, The University of Melbourne, Melbourne, VIC, 3010, Australia 
Dezerae Cox, Dept of Biochem & Mol Biology, The University of Melbourne, Melbourne, VIC, 3010, Australia 
Approved with Reservations
VIEWS 26
This study reports the impact of three different red fluorescent protein (RFP) tags on the expression and toxicity patterns of Httex1 in yeast by benchmarking them against the green fluorescent protein tagged Httex1 as the established model system in the ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Hatters DM and Cox D. Reviewer Report For: Polyglutamine toxicity assays highlight the advantages of mScarlet for imaging in Saccharomyces cerevisiae [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2018, 7:1242 (https://doi.org/10.5256/f1000research.17277.r37079)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 26 Nov 2018
    Patrick Lajoie, Department of Anatomy and Cell Biology, The University of Western Ontario, London, N6A5C1, Canada
    26 Nov 2018
    Author Response
    We would like to thank the reviewers for their helpful comments. Below is our point-by-point response addressing the concerns raised during the review process. 

    Major queries: 
    1. The
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 26 Nov 2018
    Patrick Lajoie, Department of Anatomy and Cell Biology, The University of Western Ontario, London, N6A5C1, Canada
    26 Nov 2018
    Author Response
    We would like to thank the reviewers for their helpful comments. Below is our point-by-point response addressing the concerns raised during the review process. 

    Major queries: 
    1. The
    ... Continue reading

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 10 Aug 2018
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.