ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study

[version 1; peer review: 1 approved, 1 not approved]
PUBLISHED 26 Oct 2018
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Advances in Fibroblast Research collection.

Abstract

Background: The maintenance of oral health can be achieved mainly by mechanical and chemical means. Among chemical agents, mouthwashes are widely used for personal oral hygiene because of their ability to inhibit dental plaque. The antibacterial effects of essential oils (EOs) and chlorhexidine (CHX) are well documented; however, the reaction of host tissue to these substances has a poor documentation. Until now studies have not examined the effect of EOs with sodium fluoride (EOF) on fibroblast cell lines. The aim of this study was to examine the effect of mouth rinse EOs, EOF and CHX on the apoptosis of fibroblast cell line.
Methods: BHK-21 fibroblast cell line was cultured and incubated in Eagle's Minimum Essential Medium containing EOs, EOF and CHX mouthwashes with different doses (15% or 25%) and various exposure times. Cell apoptosis was assayed using RT-PCR.
Results: EOs, EOF and CHX induce apoptotic effects on fibroblasts in a dose and time dependent manner.
Conclusion: CHX is the most cytotoxic mouthwash to fibroblasts as compared to mouthwashes containing EOs and EOF.

Keywords

fibroblast, chlorhexidine, essential oils, essential oils with sodium fluoride, mouthwash.

Introduction

Fibroblasts are the common cell type in connective tissue and plays a major role in normal function and in pathologic changes of oral tissues1,2. Various antiseptic agents are available in the form of mouthwashes, among them are essential oils (EOs), EOs with sodium fluoride (EOF) and chlorhexidine (CHX). The antibacterial action of these agents had been widely examined1,3,4.

In fibroblasts, EOs can induce depolarization of the mitochondrial membranes by decreasing the membrane potential, affecting ionic Ca++ cycling5,6. They change the permeability of membranes resulting in liberation of cytochrome, leading to apoptosis7. Fluoride inhibits protein synthesis and thus it influences certain signalling pathways included in apoptosis such as the P53 pathway8,9.

CHX inhibits protein and DNA synthesis, resulting in cell apoptosis3,10. Moreover, CHX can damage mitochondrial membranes resulting in leakage of apoptosis-inducing proteins11,12.

Many previous studies have compared the effect of both CHX and EOs mouthwashes on cultured fibroblasts3,5. However, to the best of our knowledge, the combined effect of EOs and EOF hasn’t been studied yet. In this study, we investigated the effect of different doses and different exposure periods of mouthwashes containing EOs, EOF and CHX on a fibroblast cell line.

Methods

Laboratory procedures

This study was performed on BHK-21 cell line in (Vacsera Co., Egypt). It was cultured according to a previous protocol3. Briefly, BHK-21 cells were cultured in Eagle's Minimum Essential Medium (ATCC, Manassas, VA, USA). They were sub-cultured into 96-well plates (ATCC, USA).

Commercial mouthwashes (3 total) were diluted to 15% and 25% using distilled water. Mouthwashes used were composed as followed:

  • - EO mouthwash: containing thymol (0.0060%), eucalyptol (0.09%), mentol (0.042%) and methyl-salicylate (0.064%) in a 26.9% hydroalcoholic vehicle;

  • - EOF mouthwash: containing EOs as before and 0.2% sodium fluoride;

  • - CHX mouthwash: containing 0.12% chlorhexidine hydrochloric acid.

Cells were incubated with mouthwashes for 0, 1, 2, 3, 5, 10 minutes in the 96-well plates at 37oC.

Assessment of apoptosis

After cell culturing, RNA extraction and quantitative real time polymerase chain reaction (PCR) was performed as follows1:

  • 1. Total RNA was isolated using the RNeasy Micro Kit (Qiagen, Germany) and RNA concentration was measured spectrophotometrically using Nanodrop ND-1000.

  • 2. Reverse transcription was performed on 600 ng of total RNA using oligo dT primers and MMLV Reverse Transcriptase in a final volume of 20 mL (Invitrogen, CA, USA) for 5 minutes at 65oC, followed by one hour at 37oC.

  • 3. Samples were subsequently heated for 15 minutes at 70oC to terminate the reverse transcription reaction.

  • 4. Real-time quantitative PCR was performed on the cDNA samples using an Applied Biosystem Real-Time Detection System. Annexin V was the target gene for apoptosis. Primer sequences for Annexin V: sense primer, 5' CAGTCTAGGTGCAGCTGCCG 3' and antisense primer, 5' GGTGAAGCAGGACCAGTGT3'. The following primer sequences were used for GAPDH (housekeeping gene): sense primer, 5' ATG GCC TTC CGT GTT CCT AC 3' and antisense primer, 5' GCC TGC TTC ACC ACC TTC TT 3'

  • 5. Real-time PCR was conducted by amplifying the cDNA with iQ SYBR Green Universal Master Mix (Applied Biosystems, CA, USA).

  • 6. Melting curve analysis of amplification products was performed at the end of the PCR reaction to confirm that a single PCR product was detected. For every PCR reaction, GAPDH was used as the internal control.

  • 7. A relative quantification method 2−ΔΔCT method was used13. The relative quantitation value of target was normalized to the internal control (GAPDH).

Statistical methods

Data was analysed using IBM Statistical Package for Social Sciences (SPSS), version 21 (SPSS Inc., IL, USA). Numerical data was described as mean and standard deviation and comparisons between these were performed using ANOVA and a post-hoc Tukey test.

Results

Microscopic examination

Microscopic examination of fibroblast cell line after application of different mouthwashes at different concentrations and for different time durations is shown in Figure 1.

0e080273-900e-4c29-8e9a-37c4109e45ff_figure1.gif

Figure 1. Microscopic examination of fibroblast BHK-21 cells treated with various mouthwashes at different concentrations and for different durations.

From L-R (A) Untreated fibroblast cell line demonstrated confluent growth of elongated cells. Some cells appeared bipolar and some were multipolar. (BE) Essential oil mouthwash: (B) 15% for 1 minute showed many viable spindle shaped fibroblasts; (C) 15% for 10 minutes showed decreased spindle shaped fibroblasts; (D) 25% for 1 minute showed few viable spindle shaped fibroblasts; (E) 25% for 10 minutes showed obvious cell free areas. (FI) Sodium fluoride mouthwash: (F) 15% for 1 minute showed many viable spindle shaped fibroblasts and few apoptotic cells; (G) 15% for 10 minutes showed destroyed fibroblasts; (H) 25% for 1 minute showed large cell free areas; (I) 25% for 10 minutes showed more obvious large cell free areas. (J-M) Chlorhexidine mouthwash: (J) 15% for 1 and (K) 10 minutes many viable fibroblasts were detected; (L) 25% for 1 minute showed massive reduction in cell viability, many dead or destroyed fibroblasts surrounded by large cell free areas; (M) 25% for 10 minutes, only few remnants of dead fibroblasts were obvious.

Effect of concentration of EOs, EOF and CHX mouthwashes on apoptosis induction in fibroblast cell line

In all mouthwashes 25% concentration showed a statistically significant increase in apoptosis compared with 15% and the untreated control (Table 1 and Figure 2).

Table 1. Apoptosis induction in BHK-21 fibroblast cell line by EO, EOF and CHX mouthwashes compared to an untreated group (n=3).

MouthwashUntreated15% mouthwash dilution25% mouthwash dilutionP-value**
EO1.01±-0.2a1.34±0.470a5.97±1.90b0.0000
EOF1.01±-0.2a1.77±0.710a5.30±1.93b0.0000
CHX1.01±-0.2a1.97±0.52a10.3±2.61c0.0000

*Groups with different letters are statistically significantly different. **ANOVA. EO, essential oil; EOF, sodium fluoride; CHX, chlorhexidine.

0e080273-900e-4c29-8e9a-37c4109e45ff_figure2.gif

Figure 2. Apoptosis induction in fibroblast BHK-21 cells after incubation with various mouthwashes at different concentrations.

EO, essential oil; EOF, sodium fluoride; CHX, chlorhexidine (n=3).

Effect of duration of application of EOs, EOF and CHX mouthwashes on apoptosis induction in fibroblast cell line

In the EO mouthwash, values for apoptosis continued to significantly increase after 2, 3, 5 and 10 minutes for the 25% concentration (Table 2 and Figure 3).

Table 2. Effect of duration of application and percentage of an essential oil mouthwash on apoptosis induction in BHK-21 fibroblast cell line.

Time
Mouthwash0123510P-value**
15%1.01±1.5a1.15±0.18a1.17±0.21a1.22±0.46a1.5±0.502a1.74±0.65a0.6448
20%1.01±1.5a4.66±1.28b5.26±1.58b5.99±1.64b6.57±1.65c6.78±2.3c0.0001

*Groups with different letters are statistically significantly different. **ANOVA

0e080273-900e-4c29-8e9a-37c4109e45ff_figure3.gif

Figure 3. Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of essential oil containing mouthwash for different time durations (n=3).

In the EOF mouthwash, at 25% concentration, a significant increase in apoptosis values was detected after 5 and 10 minutes (Table 3 and Figure 4).

Table 3. Effect of duration of application and percentage of a sodium fluoride mouthwash on apoptosis induction in BHK-21 fibroblast cell line.

Time
Mouthwash0123510P-value**
15%1.01±1.5a1.19±0.15a1.24±0.18a1.42±0.34a2.13±0.31a2.74±0.25a0.0019
20%1.01±1.5a4.82±2.06a4.99±0.95a5.38±1.36a6.02±2.7b7±1.96b0.0008

*Groups with different letters are statistically significantly different. **ANOVA

0e080273-900e-4c29-8e9a-37c4109e45ff_figure4.gif

Figure 4. Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of sodium fluoride containing mouthwash for different time durations (n=3).

In the CHX mouthwash, at 25% concentration, a significant increase in apoptosis values started after 1 minute and continued to increase by time (Table 4 and Figure 5).

Table 4. Effect of duration of application and percentage of a chlorhexidine mouthwash on apoptosis induction in BHK-21 fibroblast cell line.

Time
Mouthwash0123510P-value**
15%1.01±1.5a1.86±0.71a1.87±0.36a1.94±0.69a2.06±0.25a2.38±0.45a0.1606
20%1.01±1.5a8.34±1.9c10.6±3.4b11.1±1.96d11.3±0.83b11.4±1.5b0.0000

*Groups with different letters are statistically significantly different. **ANOVA

0e080273-900e-4c29-8e9a-37c4109e45ff_figure5.gif

Figure 5. Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of chlorhexidine containing mouthwash for different time durations (n=3).

Dataset 1.Dataset 1. File containing: Part A, Raw numerical data of RNA concentration at each concentration and duration of application of the mouthwashes; part B, raw phase contrast photomicrograph of fibroblast cell line after application of mouthwashes at different concentrations and durations.
https://doi.org/10.5256/f1000research.16337.d220684

Discussion

The effectiveness of CHX and EOs mouthwashes in controlling the formation of plaque and gingivitis has been demonstrated14. However, there are concerns that these products are harmful to oral cells1517.

CHX is toxic, even in low concentrations, for different cell types including fibroblasts in culture18,19. Topical application of CHX can result in its penetration through the epithelial barrier leading to tissue damage20. In our study, and increase in concentration for EOs, EOF and CHX mouthwashes resulted in an increase in apoptosis. This was also observed by Faria et al.1 who reported that CHX induced apoptosis of cultured fibroblasts in a concentration dependent manner. Values for apoptosis at 15% and 25% concentrations of EOF were slightly higher than EOs alone in our study, demonstrating the ability of fluoride to enhance apoptosis induction, as previously described9.

A significant increase in apoptosis induction was seen at 15% concentration CHX and at 25% concentration EOs and EOF. This suggests that CHX is more effective than EOs and EOF in apoptosis induction. This result was in agreement with Tsourounakis et al.5 who reported that there was a significant reduction in cell survival that occurred at concentrations of 15% CHX and 25% EOs21.

The increase in duration of application of EOs, EOF and CHX didn’t significantly increase apoptosis at the low concentration of 15% in the present study. However, at 25% CHX, increase in the duration of treatment significantly enhanced apoptosis, which was significant obvious after 1 minute. This means that CHX is more efficient than EOs and EOF in apoptosis induction at lower concentrations. This was in accordance with Flemingson et al.3 who stated that the apoptotic effect of CHX on fibroblasts occurs early, after 1 minute exposure, and added that CHX had the maximum cytotoxicity followed by EOs.

Conclusion

CHX mouthwash is the most cytotoxic to fibroblasts compared to EOs and EOF containing mouthwashes. Adding fluoride to EOs in low concentrations didn’t worsen the adverse effects of Eos as shown by the combination mouthwash containing EOs and fluoride.

Data availability

F1000Research: Dataset 1. File containing: Part A, Raw numerical data of RNA concentration at each concentration and duration of application of the mouthwashes; part B, raw phase contrast photomicrograph of fibroblast cell line after application of mouthwashes at different concentrations and durations., 10.5256/f1000research.16337.d22068422.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 26 Oct 2018
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Ali El Basuony SAH, El Hossary N and Raouf Amin N. Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study [version 1; peer review: 1 approved, 1 not approved]. F1000Research 2018, 7:1703 (https://doi.org/10.12688/f1000research.16337.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 26 Oct 2018
Views
8
Cite
Reviewer Report 18 Jan 2019
Thomas E. Lallier, Department of Oral Biology, Louisiana State University Health Science Center, New Orleans, LA, USA 
Not Approved
VIEWS 8
The authors demonstrate that chlorohexidine (CHX)- and essential oil (EO)-containing mouth rinses induce cell death in fibroblasts in culture. They attempt to prove that this is through apoptosis, using qPCR to quantify the expression of Annexin V (Annexin-A5) in these ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Lallier TE. Reviewer Report For: Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study [version 1; peer review: 1 approved, 1 not approved]. F1000Research 2018, 7:1703 (https://doi.org/10.5256/f1000research.17846.r40531)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
7
Cite
Reviewer Report 09 Nov 2018
Marwa Mokbel ElShafei, Oral Pathology Department, Faculty of Dentistry, Misr International University, Cairo, Egypt 
Approved
VIEWS 7
In my opinion normality tests should be performed before statistical tests and considering the small sample size, non-parametric tests could have been used. The article is approved, though a recommendation can be added after the conclusion in order to recommend ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
ElShafei MM. Reviewer Report For: Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study [version 1; peer review: 1 approved, 1 not approved]. F1000Research 2018, 7:1703 (https://doi.org/10.5256/f1000research.17846.r39910)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 26 Oct 2018
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.