Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An <i>in vitro</i> study

Shaimaa Ali Hamouda Ali El Basuony; Naglaa El Hossary; Nermine Raouf Amin

doi:10.12688/f1000research.16337.1

Home Browse Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes...

ALL Metrics

-

Views

-

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study

[version 1; peer review: 1 approved, 1 not approved]

Shaimaa Ali Hamouda Ali El Basuony ¹, Naglaa El Hossary¹, Nermine Raouf Amin¹

PUBLISHED 26 Oct 2018

Author details Author details

¹ Department of Oral and Maxillofacial Pathology, Faculty of Dentistry, Cairo University, Cairo, Egypt

Shaimaa Ali Hamouda Ali El Basuony
Roles: Conceptualization, Funding Acquisition, Investigation, Writing – Original Draft Preparation, Writing – Review & Editing

Naglaa El Hossary
Roles: Conceptualization, Project Administration, Supervision, Visualization

Nermine Raouf Amin
Roles: Data Curation, Supervision, Validation, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Advances in Fibroblast Research collection.

Abstract

Background: The maintenance of oral health can be achieved mainly by mechanical and chemical means. Among chemical agents, mouthwashes are widely used for personal oral hygiene because of their ability to inhibit dental plaque. The antibacterial effects of essential oils (EOs) and chlorhexidine (CHX) are well documented; however, the reaction of host tissue to these substances has a poor documentation. Until now studies have not examined the effect of EOs with sodium fluoride (EOF) on fibroblast cell lines. The aim of this study was to examine the effect of mouth rinse EOs, EOF and CHX on the apoptosis of fibroblast cell line.
Methods: BHK-21 fibroblast cell line was cultured and incubated in Eagle's Minimum Essential Medium containing EOs, EOF and CHX mouthwashes with different doses (15% or 25%) and various exposure times. Cell apoptosis was assayed using RT-PCR.
Results: EOs, EOF and CHX induce apoptotic effects on fibroblasts in a dose and time dependent manner.
Conclusion: CHX is the most cytotoxic mouthwash to fibroblasts as compared to mouthwashes containing EOs and EOF.

Keywords

fibroblast, chlorhexidine, essential oils, essential oils with sodium fluoride, mouthwash.

Corresponding author: Shaimaa Ali Hamouda Ali El Basuony

Competing interests: No competing interests were disclosed.

Grant information: The author(s) declared that no grants were involved in supporting this work.

Copyright: © 2018 Ali El Basuony SAH et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

How to cite: Ali El Basuony SAH, El Hossary N and Raouf Amin N. Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study [version 1; peer review: 1 approved, 1 not approved]. F1000Research 2018, 7:1703 (https://doi.org/10.12688/f1000research.16337.1) First published: 26 Oct 2018, 7:1703 (https://doi.org/10.12688/f1000research.16337.1) Latest published: 26 Oct 2018, 7:1703 (https://doi.org/10.12688/f1000research.16337.1)

Introduction

Fibroblasts are the common cell type in connective tissue and plays a major role in normal function and in pathologic changes of oral tissues^1,2. Various antiseptic agents are available in the form of mouthwashes, among them are essential oils (EOs), EOs with sodium fluoride (EOF) and chlorhexidine (CHX). The antibacterial action of these agents had been widely examined^1,3,4.

In fibroblasts, EOs can induce depolarization of the mitochondrial membranes by decreasing the membrane potential, affecting ionic Ca++ cycling^5,6. They change the permeability of membranes resulting in liberation of cytochrome, leading to apoptosis⁷. Fluoride inhibits protein synthesis and thus it influences certain signalling pathways included in apoptosis such as the P53 pathway^8,9.

CHX inhibits protein and DNA synthesis, resulting in cell apoptosis^3,10. Moreover, CHX can damage mitochondrial membranes resulting in leakage of apoptosis-inducing proteins^11,12.

Many previous studies have compared the effect of both CHX and EOs mouthwashes on cultured fibroblasts^3,5. However, to the best of our knowledge, the combined effect of EOs and EOF hasn’t been studied yet. In this study, we investigated the effect of different doses and different exposure periods of mouthwashes containing EOs, EOF and CHX on a fibroblast cell line.

Methods

Laboratory procedures

This study was performed on BHK-21 cell line in (Vacsera Co., Egypt). It was cultured according to a previous protocol³. Briefly, BHK-21 cells were cultured in Eagle's Minimum Essential Medium (ATCC, Manassas, VA, USA). They were sub-cultured into 96-well plates (ATCC, USA).

Commercial mouthwashes (3 total) were diluted to 15% and 25% using distilled water. Mouthwashes used were composed as followed:

- EO mouthwash: containing thymol (0.0060%), eucalyptol (0.09%), mentol (0.042%) and methyl-salicylate (0.064%) in a 26.9% hydroalcoholic vehicle;
- EOF mouthwash: containing EOs as before and 0.2% sodium fluoride;
- CHX mouthwash: containing 0.12% chlorhexidine hydrochloric acid.

Cells were incubated with mouthwashes for 0, 1, 2, 3, 5, 10 minutes in the 96-well plates at 37^oC.

Assessment of apoptosis

After cell culturing, RNA extraction and quantitative real time polymerase chain reaction (PCR) was performed as follows¹:

1. Total RNA was isolated using the RNeasy Micro Kit (Qiagen, Germany) and RNA concentration was measured spectrophotometrically using Nanodrop ND-1000.
2. Reverse transcription was performed on 600 ng of total RNA using oligo dT primers and MMLV Reverse Transcriptase in a final volume of 20 mL (Invitrogen, CA, USA) for 5 minutes at 65^oC, followed by one hour at 37^oC.
3. Samples were subsequently heated for 15 minutes at 70^oC to terminate the reverse transcription reaction.
4. Real-time quantitative PCR was performed on the cDNA samples using an Applied Biosystem Real-Time Detection System. Annexin V was the target gene for apoptosis. Primer sequences for Annexin V: sense primer, 5' CAGTCTAGGTGCAGCTGCCG 3' and antisense primer, 5' GGTGAAGCAGGACCAGTGT3'. The following primer sequences were used for GAPDH (housekeeping gene): sense primer, 5' ATG GCC TTC CGT GTT CCT AC 3' and antisense primer, 5' GCC TGC TTC ACC ACC TTC TT 3'
5. Real-time PCR was conducted by amplifying the cDNA with iQ SYBR Green Universal Master Mix (Applied Biosystems, CA, USA).
6. Melting curve analysis of amplification products was performed at the end of the PCR reaction to confirm that a single PCR product was detected. For every PCR reaction, GAPDH was used as the internal control.
7. A relative quantification method 2−ΔΔCT method was used¹³. The relative quantitation value of target was normalized to the internal control (GAPDH).

Statistical methods

Data was analysed using IBM Statistical Package for Social Sciences (SPSS), version 21 (SPSS Inc., IL, USA). Numerical data was described as mean and standard deviation and comparisons between these were performed using ANOVA and a post-hoc Tukey test.

Results

Microscopic examination

Microscopic examination of fibroblast cell line after application of different mouthwashes at different concentrations and for different time durations is shown in Figure 1.

Figure 1. Microscopic examination of fibroblast BHK-21 cells treated with various mouthwashes at different concentrations and for different durations.

From L-R (A) Untreated fibroblast cell line demonstrated confluent growth of elongated cells. Some cells appeared bipolar and some were multipolar. (B–E) Essential oil mouthwash: (B) 15% for 1 minute showed many viable spindle shaped fibroblasts; (C) 15% for 10 minutes showed decreased spindle shaped fibroblasts; (D) 25% for 1 minute showed few viable spindle shaped fibroblasts; (E) 25% for 10 minutes showed obvious cell free areas. (F–I) Sodium fluoride mouthwash: (F) 15% for 1 minute showed many viable spindle shaped fibroblasts and few apoptotic cells; (G) 15% for 10 minutes showed destroyed fibroblasts; (H) 25% for 1 minute showed large cell free areas; (I) 25% for 10 minutes showed more obvious large cell free areas. (J-M) Chlorhexidine mouthwash: (J) 15% for 1 and (K) 10 minutes many viable fibroblasts were detected; (L) 25% for 1 minute showed massive reduction in cell viability, many dead or destroyed fibroblasts surrounded by large cell free areas; (M) 25% for 10 minutes, only few remnants of dead fibroblasts were obvious.

Effect of concentration of EOs, EOF and CHX mouthwashes on apoptosis induction in fibroblast cell line

In all mouthwashes 25% concentration showed a statistically significant increase in apoptosis compared with 15% and the untreated control (Table 1 and Figure 2).

Table 1. Apoptosis induction in BHK-21 fibroblast cell line by EO, EOF and CHX mouthwashes compared to an untreated group (n=3).

Mouthwash	Untreated	15% mouthwash dilution	25% mouthwash dilution
EO	1.01±-0.2^a	1.34±0.470^a	5.97±1.90^b
EOF	1.01±-0.2^a	1.77±0.710^a	5.30±1.93^b
CHX	1.01±-0.2^a	1.97±0.52^a	10.3±2.61^c

*Groups with different letters are statistically significantly different. **ANOVA. EO, essential oil; EOF, sodium fluoride; CHX, chlorhexidine.

Figure 2. Apoptosis induction in fibroblast BHK-21 cells after incubation with various mouthwashes at different concentrations.

EO, essential oil; EOF, sodium fluoride; CHX, chlorhexidine (n=3).

Effect of duration of application of EOs, EOF and CHX mouthwashes on apoptosis induction in fibroblast cell line

In the EO mouthwash, values for apoptosis continued to significantly increase after 2, 3, 5 and 10 minutes for the 25% concentration (Table 2 and Figure 3).

Table 2. Effect of duration of application and percentage of an essential oil mouthwash on apoptosis induction in BHK-21 fibroblast cell line.

	Time
Mouthwash	0	1	2	3	5	10	P-value**
15%	1.01±1.5^a	1.15±0.18^a	1.17±0.21^a	1.22±0.46^a	1.5±0.502^a	1.74±0.65^a	0.6448
20%	1.01±1.5^a	4.66±1.28^b	5.26±1.58^b	5.99±1.64^b	6.57±1.65^c	6.78±2.3^c	0.0001

*Groups with different letters are statistically significantly different. **ANOVA

Figure 3. Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of essential oil containing mouthwash for different time durations (n=3).

In the EOF mouthwash, at 25% concentration, a significant increase in apoptosis values was detected after 5 and 10 minutes (Table 3 and Figure 4).

Table 3. Effect of duration of application and percentage of a sodium fluoride mouthwash on apoptosis induction in BHK-21 fibroblast cell line.

	Time
Mouthwash	0	1	2	3	5	10	P-value**
15%	1.01±1.5^a	1.19±0.15^a	1.24±0.18^a	1.42±0.34^a	2.13±0.31^a	2.74±0.25^a	0.0019
20%	1.01±1.5^a	4.82±2.06^a	4.99±0.95^a	5.38±1.36^a	6.02±2.7^b	7±1.96^b	0.0008

*Groups with different letters are statistically significantly different. **ANOVA

Figure 4. Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of sodium fluoride containing mouthwash for different time durations (n=3).

In the CHX mouthwash, at 25% concentration, a significant increase in apoptosis values started after 1 minute and continued to increase by time (Table 4 and Figure 5).

Table 4. Effect of duration of application and percentage of a chlorhexidine mouthwash on apoptosis induction in BHK-21 fibroblast cell line.

	Time
Mouthwash	0	1	2	3	5	10	P-value**
15%	1.01±1.5^a	1.86±0.71^a	1.87±0.36^a	1.94±0.69^a	2.06±0.25^a	2.38±0.45^a	0.1606
20%	1.01±1.5^a	8.34±1.9^c	10.6±3.4^b	11.1±1.96^d	11.3±0.83^b	11.4±1.5^b	0.0000

*Groups with different letters are statistically significantly different. **ANOVA

Figure 5. Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of chlorhexidine containing mouthwash for different time durations (n=3).

Dataset 1.Dataset 1. File containing: Part A, Raw numerical data of RNA concentration at each concentration and duration of application of the mouthwashes; part B, raw phase contrast photomicrograph of fibroblast cell line after application of mouthwashes at different concentrations and durations.

https://doi.org/10.5256/f1000research.16337.d220684

Discussion

The effectiveness of CHX and EOs mouthwashes in controlling the formation of plaque and gingivitis has been demonstrated¹⁴. However, there are concerns that these products are harmful to oral cells^15–17.

CHX is toxic, even in low concentrations, for different cell types including fibroblasts in culture^18,19. Topical application of CHX can result in its penetration through the epithelial barrier leading to tissue damage²⁰. In our study, and increase in concentration for EOs, EOF and CHX mouthwashes resulted in an increase in apoptosis. This was also observed by Faria et al.¹ who reported that CHX induced apoptosis of cultured fibroblasts in a concentration dependent manner. Values for apoptosis at 15% and 25% concentrations of EOF were slightly higher than EOs alone in our study, demonstrating the ability of fluoride to enhance apoptosis induction, as previously described⁹.

A significant increase in apoptosis induction was seen at 15% concentration CHX and at 25% concentration EOs and EOF. This suggests that CHX is more effective than EOs and EOF in apoptosis induction. This result was in agreement with Tsourounakis et al.⁵ who reported that there was a significant reduction in cell survival that occurred at concentrations of 15% CHX and 25% EOs²¹.

The increase in duration of application of EOs, EOF and CHX didn’t significantly increase apoptosis at the low concentration of 15% in the present study. However, at 25% CHX, increase in the duration of treatment significantly enhanced apoptosis, which was significant obvious after 1 minute. This means that CHX is more efficient than EOs and EOF in apoptosis induction at lower concentrations. This was in accordance with Flemingson et al.³ who stated that the apoptotic effect of CHX on fibroblasts occurs early, after 1 minute exposure, and added that CHX had the maximum cytotoxicity followed by EOs.

Conclusion

CHX mouthwash is the most cytotoxic to fibroblasts compared to EOs and EOF containing mouthwashes. Adding fluoride to EOs in low concentrations didn’t worsen the adverse effects of Eos as shown by the combination mouthwash containing EOs and fluoride.

Data availability

F1000Research: Dataset 1. File containing: Part A, Raw numerical data of RNA concentration at each concentration and duration of application of the mouthwashes; part B, raw phase contrast photomicrograph of fibroblast cell line after application of mouthwashes at different concentrations and durations., 10.5256/f1000research.16337.d220684²².

Grant information

The author(s) declared that no grants were involved in supporting this work.

Faculty Opinions recommended

References

1. Faria G, Celes MR, De Rossi A, et al.: Evaluation of chlorhexidine toxicity injected in the paw of mice and added to cultured l929 fibroblasts. J Endod. 2007; 33(6): 715–722. PubMed Abstract | Publisher Full Text
2. Barnhart BD, Chuang A, Lucca JJ, et al.: An in vitro evaluation of the cytotoxicity of various endodontic irrigants on human gingival fibroblasts. J Endod. 2005; 31(8): 613–615. PubMed Abstract | Publisher Full Text
3. Flemingson, Emmadi P, Ambalavanan N, et al.: Effect of three commercial mouth rinses on cultured human gingival fibroblast: an in vitro study. Indian J Dent Res. 2008; 19(1): 29–35. PubMed Abstract | Publisher Full Text
4. Rajabalian S, Mohammadi M, Mozaffari B: Cytotoxicity evaluation of Persica mouthwash on cultured human and mouse cell lines in the presence and absence of fetal calf serum. Indian J Dent Res. 2009; 20(2): 169–73. PubMed Abstract | Publisher Full Text
5. Tsourounakis I, Palaiologou-Gallis AA, Stoute D, et al.: Effect of essential oil and chlorhexidine mouthwashes on gingival fibroblast survival and migration. J Periodontol. 2013; 84(8): 1211–1220. PubMed Abstract | Publisher Full Text
6. Carson CF, Mee BJ, Riley TV: Mechanism of action of Melaleuca alternifolia (tea tree) oil on Staphylococcus aureus determined by time-kill, lysis, leakage, and salt tolerance assays and electron microscopy. Antimicrob Agents Chemother. 2002; 46(6): 1914–1920. PubMed Abstract | Publisher Full Text | Free Full Text
7. Armstrong JS: Mitochondrial membrane permeabilization: the sine qua non for cell death. BioEssays. 2006; 28(3): 253–260. PubMed Abstract | Publisher Full Text
8. Jeng JH, Hsieh CC, Lan WH, et al.: Cytotoxicity of sodium fluoride on human oral mucosal fibroblasts and its mechanisms. Cell Biol Toxicol. 1998; 14(6): 383–389. PubMed Abstract | Publisher Full Text
9. Karube H, Nishitai G, Inageda K, et al.: NaF activates MAPKs and induces apoptosis in odontoblast-like cells. J Dent Res. 2009; 88(5): 461–465. PubMed Abstract | Publisher Full Text
10. Chang YC, Huang FM, Tai KW, et al.: The effect of sodium hypochlorite and chlorhexidine on cultured human periodontal ligament cells. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2001; 92(4): 446–450. PubMed Abstract | Publisher Full Text
11. Negrelo Newton AP, Cadena SM, Merlin Rocha ME, et al.: New data on biological effects of chlorhexidine: Fe²⁺ induced lipid peroxidation and mitochondrial permeability transition. Toxicol Lett. 2004; 151(3): 407–416. PubMed Abstract | Publisher Full Text
12. Cribb AE, Peyrou M, Muruganandan S, et al.: The endoplasmic reticulum in xenobiotic toxicity. Drug Metab Rev. 2005; 37(3): 405–42. PubMed Abstract | Publisher Full Text
13. Boulter N, Suarez FG, Schibeci S, et al.: A simple, accurate and universal method for quantification of PCR. BMC Biotechnol. 2016; 16: 27. PubMed Abstract | Publisher Full Text | Free Full Text
14. Haffajee AD, Roberts C, Murray L, et al.: Effect of herbal, essential oil, and chlorhexidine mouthrinses on the composition of the subgingival microbiota and clinical periodontal parameters. J Clin Dent. 2009; 20(7): 211–217. PubMed Abstract
15. Wyganowska-Swiatkowska M, Urbaniak P, Szkaradkiewicz A, et al.: Effects of chlorhexidine, essential oils and herbal medicines (Salvia, Chamomile, Calendula) on human fibroblast in vitro. Cent Eur J Immunol. 2016; 41(2): 125–131. PubMed Abstract | Publisher Full Text | Free Full Text
16. Selwitz RH, Ismail AI, Pitts NB: Dental caries. Lancet. 2007; 369(9555): 51–59. PubMed Abstract | Publisher Full Text
17. Giannelli M, Chellini F, Margheri M, et al.: Effect of chlorhexidine digluconate on different cell types: a molecular and ultrastructural investigation. Toxicol In Vitro. 2008; 22(2): 308–317. PubMed Abstract | Publisher Full Text
18. Ghabanchi J, Moattari A, Darafshi R, et al.: Effects of three Commercial Mouth Rinses on the Cultured Fibroblasts: An in Vitro Study. J Dent (Shiraz). 2013; 14(2): 64–7. PubMed Abstract | Free Full Text
19. Eren K, Ozmeriç N, Sardaş S: Monitoring of buccal epithelial cells by alkaline comet assay (single cell gel electrophoresis technique) in cytogenetic evaluation of chlorhexidine. Clin Oral Investig. 2002; 6(3): 150–154. PubMed Abstract | Publisher Full Text
20. Müller HD, Eick S, Moritz A, et al.: Cytotoxicity and Antimicrobial Activity of Oral Rinses In Vitro. Biomed Res Int. 2017; 2017: 4019723. PubMed Abstract | Publisher Full Text | Free Full Text
21. Afonina E, Stauber R, Pavlakis GN: The human poly(A)-binding protein 1 shuttles between the nucleus and the cytoplasm. J Biol Chem. 1998; 273(21): 13015–13021. PubMed Abstract | Publisher Full Text
22. El Basuony SAH, El Hossary N, Raouf Amin N: Dataset 1 in: Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.16337.d220684

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 26 Oct 2018

Author details Author details

¹ Department of Oral and Maxillofacial Pathology, Faculty of Dentistry, Cairo University, Cairo, Egypt

Shaimaa Ali Hamouda Ali El Basuony
Roles: Conceptualization, Funding Acquisition, Investigation, Writing – Original Draft Preparation, Writing – Review & Editing

Naglaa El Hossary
Roles: Conceptualization, Project Administration, Supervision, Visualization

Nermine Raouf Amin
Roles: Data Curation, Supervision, Validation, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

The author(s) declared that no grants were involved in supporting this work.

Article Versions (1)

version 1

Published: 26 Oct 2018, 7:1703

https://doi.org/10.12688/f1000research.16337.1

Copyright

© 2018 Ali El Basuony SAH et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

0

SEE MORE DETAILS

CITE

how to cite this article

Ali El Basuony SAH, El Hossary N and Raouf Amin N. Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study [version 1; peer review: 1 approved, 1 not approved]. F1000Research 2018, 7:1703 (https://doi.org/10.12688/f1000research.16337.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 26 Oct 2018

Views

5

Reviewer Report 18 Jan 2019

Thomas E. Lallier, Department of Oral Biology, Louisiana State University Health Science Center, New Orleans, LA, USA

Not Approved

https://doi.org/10.5256/f1000research.17846.r40531

The authors demonstrate that chlorohexidine (CHX)- and essential oil (EO)-containing mouth rinses induce cell death in fibroblasts in culture. They attempt to prove that this is through apoptosis, using qPCR to quantify the expression of Annexin V (Annexin-A5) in these ... Continue reading

The authors demonstrate that chlorohexidine (CHX)- and essential oil (EO)-containing mouth rinses induce cell death in fibroblasts in culture. They attempt to prove that this is through apoptosis, using qPCR to quantify the expression of Annexin V (Annexin-A5) in these cells. Unfortunately, this assay is flawed. Annexin V is a normally-expressed protein that happens to bind to phosphatidylserine, a phospholipid normally on the cytoplasmic leaflet of the plasma membrane. During apoptosis, this inner leaflet is exposed to the extracellular environment. Thus, Annexin V can be used to identify apoptotic cells fluorometrically. An increase in Annexin V transcript expression has not been linked with apoptosis. Furthermore, apoptosis is a post-translational event involving cytochromes, caspases and other proteins (e.g. BCL2 and BAX), and thus cannot be detected using a transcriptional assay like qPCR.

Thus, the only finding of this manuscript is that these mouth rinses lead to cell death, which is neither novel nor worthy of independent indexing.

The manuscript also contains numerous other errors (e.g. the photomicrographs in Figure 1 are of too little contrast to demonstrate anything, and are not even properly identified), and this is not yet ready for indexing.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

No
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

No
Are the conclusions drawn adequately supported by the results?

No

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Cell biology, including cell survival, cell attachment, cell migration assays, as well as qPCR , ELISA, and immunocytochemistry

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

CITE

Report a concern

Respond or Comment

Views

5

Reviewer Report 09 Nov 2018

Marwa Mokbel ElShafei, Oral Pathology Department, Faculty of Dentistry, Misr International University, Cairo, Egypt

Approved

https://doi.org/10.5256/f1000research.17846.r39910

In my opinion normality tests should be performed before statistical tests and considering the small sample size, non-parametric tests could have been used. The article is approved, though a recommendation can be added after the conclusion in order to recommend ... Continue reading

In my opinion normality tests should be performed before statistical tests and considering the small sample size, non-parametric tests could have been used. The article is approved, though a recommendation can be added after the conclusion in order to recommend further studies to evaluate the amount and percentage of mouth wash absorption to the connective tissue and hence reaching fibroblasts as the direct effect on the cell line doesn't mimic the real life effect.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 26 Oct 2018

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 1 26 Oct 18	read	read

Marwa Mokbel ElShafei, Misr International University, Cairo, Egypt
Thomas E. Lallier, Louisiana State University Health Science Center, New Orleans, USA

Comments on this article

All Comments(0)

Add a comment

Sign up for content alerts

Browse by related subjects

Back to all reports

Reviewer Report

5 Views

18 Jan 2019 | for Version 1

Thomas E. Lallier, Department of Oral Biology, Louisiana State University Health Science Center, New Orleans, LA, USA

5 Views Cite this report Responses(0)

Not Approved

The authors demonstrate that chlorohexidine (CHX)- and essential oil (EO)-containing mouth rinses induce cell death in fibroblasts in culture. They attempt to prove that this is through apoptosis, using qPCR to quantify the expression of Annexin V (Annexin-A5) in these cells. Unfortunately, this assay is flawed. Annexin V is a normally-expressed protein that happens to bind to phosphatidylserine, a phospholipid normally on the cytoplasmic leaflet of the plasma membrane. During apoptosis, this inner leaflet is exposed to the extracellular environment. Thus, Annexin V can be used to identify apoptotic cells fluorometrically. An increase in Annexin V transcript expression has not been linked with apoptosis. Furthermore, apoptosis is a post-translational event involving cytochromes, caspases and other proteins (e.g. BCL2 and BAX), and thus cannot be detected using a transcriptional assay like qPCR.

Thus, the only finding of this manuscript is that these mouth rinses lead to cell death, which is neither novel nor worthy of independent indexing.

The manuscript also contains numerous other errors (e.g. the photomicrographs in Figure 1 are of too little contrast to demonstrate anything, and are not even properly identified), and this is not yet ready for indexing.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

No
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

No
Are the conclusions drawn adequately supported by the results?

No

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Cell biology, including cell survival, cell attachment, cell migration assays, as well as qPCR , ELISA, and immunocytochemistry

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

5 Views

09 Nov 2018 | for Version 1

Marwa Mokbel ElShafei, Oral Pathology Department, Faculty of Dentistry, Misr International University, Cairo, Egypt

5 Views Cite this report Responses(0)

Approved

In my opinion normality tests should be performed before statistical tests and considering the small sample size, non-parametric tests could have been used. The article is approved, though a recommendation can be added after the conclusion in order to recommend further studies to evaluate the amount and percentage of mouth wash absorption to the connective tissue and hence reaching fibroblasts as the direct effect on the cell line doesn't mimic the real life effect.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

[1] 1. Faria G, Celes MR, De Rossi A, et al.: Evaluation of chlorhexidine toxicity injected in the paw of mice and added to cultured l929 fibroblasts. J Endod. 2007; 33(6): 715–722. PubMed Abstract | Publisher Full Text

[2] 2. Barnhart BD, Chuang A, Lucca JJ, et al.: An in vitro evaluation of the cytotoxicity of various endodontic irrigants on human gingival fibroblasts. J Endod. 2005; 31(8): 613–615. PubMed Abstract | Publisher Full Text

[3] 3. Flemingson, Emmadi P, Ambalavanan N, et al.: Effect of three commercial mouth rinses on cultured human gingival fibroblast: an in vitro study. Indian J Dent Res. 2008; 19(1): 29–35. PubMed Abstract | Publisher Full Text

[4] 4. Rajabalian S, Mohammadi M, Mozaffari B: Cytotoxicity evaluation of Persica mouthwash on cultured human and mouse cell lines in the presence and absence of fetal calf serum. Indian J Dent Res. 2009; 20(2): 169–73. PubMed Abstract | Publisher Full Text

[5] 5. Tsourounakis I, Palaiologou-Gallis AA, Stoute D, et al.: Effect of essential oil and chlorhexidine mouthwashes on gingival fibroblast survival and migration. J Periodontol. 2013; 84(8): 1211–1220. PubMed Abstract | Publisher Full Text

[6] 6. Carson CF, Mee BJ, Riley TV: Mechanism of action of Melaleuca alternifolia (tea tree) oil on Staphylococcus aureus determined by time-kill, lysis, leakage, and salt tolerance assays and electron microscopy. Antimicrob Agents Chemother. 2002; 46(6): 1914–1920. PubMed Abstract | Publisher Full Text | Free Full Text

[7] 7. Armstrong JS: Mitochondrial membrane permeabilization: the sine qua non for cell death. BioEssays. 2006; 28(3): 253–260. PubMed Abstract | Publisher Full Text

[8] 8. Jeng JH, Hsieh CC, Lan WH, et al.: Cytotoxicity of sodium fluoride on human oral mucosal fibroblasts and its mechanisms. Cell Biol Toxicol. 1998; 14(6): 383–389. PubMed Abstract | Publisher Full Text

[9] 9. Karube H, Nishitai G, Inageda K, et al.: NaF activates MAPKs and induces apoptosis in odontoblast-like cells. J Dent Res. 2009; 88(5): 461–465. PubMed Abstract | Publisher Full Text

[10] 10. Chang YC, Huang FM, Tai KW, et al.: The effect of sodium hypochlorite and chlorhexidine on cultured human periodontal ligament cells. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2001; 92(4): 446–450. PubMed Abstract | Publisher Full Text

[11] 11. Negrelo Newton AP, Cadena SM, Merlin Rocha ME, et al.: New data on biological effects of chlorhexidine: Fe²⁺ induced lipid peroxidation and mitochondrial permeability transition. Toxicol Lett. 2004; 151(3): 407–416. PubMed Abstract | Publisher Full Text

[12] 12. Cribb AE, Peyrou M, Muruganandan S, et al.: The endoplasmic reticulum in xenobiotic toxicity. Drug Metab Rev. 2005; 37(3): 405–42. PubMed Abstract | Publisher Full Text

[13] 13. Boulter N, Suarez FG, Schibeci S, et al.: A simple, accurate and universal method for quantification of PCR. BMC Biotechnol. 2016; 16: 27. PubMed Abstract | Publisher Full Text | Free Full Text

[14] 14. Haffajee AD, Roberts C, Murray L, et al.: Effect of herbal, essential oil, and chlorhexidine mouthrinses on the composition of the subgingival microbiota and clinical periodontal parameters. J Clin Dent. 2009; 20(7): 211–217. PubMed Abstract

[15] 15. Wyganowska-Swiatkowska M, Urbaniak P, Szkaradkiewicz A, et al.: Effects of chlorhexidine, essential oils and herbal medicines (Salvia, Chamomile, Calendula) on human fibroblast in vitro. Cent Eur J Immunol. 2016; 41(2): 125–131. PubMed Abstract | Publisher Full Text | Free Full Text

[16] 16. Selwitz RH, Ismail AI, Pitts NB: Dental caries. Lancet. 2007; 369(9555): 51–59. PubMed Abstract | Publisher Full Text

[17] 17. Giannelli M, Chellini F, Margheri M, et al.: Effect of chlorhexidine digluconate on different cell types: a molecular and ultrastructural investigation. Toxicol In Vitro. 2008; 22(2): 308–317. PubMed Abstract | Publisher Full Text

[18] 18. Ghabanchi J, Moattari A, Darafshi R, et al.: Effects of three Commercial Mouth Rinses on the Cultured Fibroblasts: An in Vitro Study. J Dent (Shiraz). 2013; 14(2): 64–7. PubMed Abstract | Free Full Text

[19] 19. Eren K, Ozmeriç N, Sardaş S: Monitoring of buccal epithelial cells by alkaline comet assay (single cell gel electrophoresis technique) in cytogenetic evaluation of chlorhexidine. Clin Oral Investig. 2002; 6(3): 150–154. PubMed Abstract | Publisher Full Text

[20] 20. Müller HD, Eick S, Moritz A, et al.: Cytotoxicity and Antimicrobial Activity of Oral Rinses In Vitro. Biomed Res Int. 2017; 2017: 4019723. PubMed Abstract | Publisher Full Text | Free Full Text

[21] 21. Afonina E, Stauber R, Pavlakis GN: The human poly(A)-binding protein 1 shuttles between the nucleus and the cytoplasm. J Biol Chem. 1998; 273(21): 13015–13021. PubMed Abstract | Publisher Full Text

[22] 22. El Basuony SAH, El Hossary N, Raouf Amin N: Dataset 1 in: Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.16337.d220684

Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An in vitro study

Abstract

Keywords

Introduction

Methods

Laboratory procedures

Assessment of apoptosis

Statistical methods

Results

Microscopic examination

Figure 1. Microscopic examination of fibroblast BHK-21 cells treated with various mouthwashes at different concentrations and for different durations.

Effect of concentration of EOs, EOF and CHX mouthwashes on apoptosis induction in fibroblast cell line

Table 1. Apoptosis induction in BHK-21 fibroblast cell line by EO, EOF and CHX mouthwashes compared to an untreated group (n=3).

Figure 2. Apoptosis induction in fibroblast BHK-21 cells after incubation with various mouthwashes at different concentrations.

Effect of duration of application of EOs, EOF and CHX mouthwashes on apoptosis induction in fibroblast cell line

Table 2. Effect of duration of application and percentage of an essential oil mouthwash on apoptosis induction in BHK-21 fibroblast cell line.

Figure 3. Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of essential oil containing mouthwash for different time durations (n=3).

Table 3. Effect of duration of application and percentage of a sodium fluoride mouthwash on apoptosis induction in BHK-21 fibroblast cell line.

Figure 4. Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of sodium fluoride containing mouthwash for different time durations (n=3).

Table 4. Effect of duration of application and percentage of a chlorhexidine mouthwash on apoptosis induction in BHK-21 fibroblast cell line.

Figure 5. Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of chlorhexidine containing mouthwash for different time durations (n=3).

Discussion

Conclusion

Data availability

Grant information

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

The problem

How to fix it

Competing Interests Policy

Stay Updated