Home Browse Cross sectional study to determine chloroquine resistance among Plasmodium...
ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
▬
✚
Research Article

Cross sectional study to determine chloroquine resistance among Plasmodium falciparum clinical isolates from Khartoum, Sudan

[version 1; peer review: 1 approved, 2 approved with reservations]
Walaa Salah Abdulla Mohammed
https://orcid.org/0000-0003-1494-1007
1, Kyakonye Yasin2, N.S. Mahgoub3-5, Muzamil Mahdi Abdel Hamid
https://orcid.org/0000-0002-6157-4388
6
Walaa Salah Abdulla Mohammed
https://orcid.org/0000-0003-1494-1007
1, Kyakonye Yasin2, N.S. Mahgoub3-5, Muzamil Mahdi Abdel Hamid
https://orcid.org/0000-0002-6157-4388
6
PUBLISHED 20 Feb 2018
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Pathogens gateway.

Abstract

Background:  Malaria continues to present a global health threat; the World Health Organization (WHO) reported 214 million cases of malaria by the year 2015 with a death rate of 438000. Sudan is endemic to malaria with over 95% of malaria cases due to Plasmodium falciparum. Chloroquine is a well-established drug in the treatment of P. falciparum malaria although its use has declined since its introduction as the drug of choice in treatment of malaria in Sudan. The mechanism of resistance has been attributed to mutations in P. falciparum Chloroquine resistance transporter gene coding for a key food vacuole proteins. In current study we aimed at verifying the genetic cause of resistance to Chloroquine in field isolates of P. falciparum.
Methods: Twenty P. falciparum cases were diagnosed from East Nile hospital in Khartoum and recruited in the investigation. Nested PCR was conducted to isolate mutation region in the PfCRT gene and the amplicons were sequenced using Sanger sequencing technique (Macrogen, Soule Korea).
Results: 16/20 (80%) of the field isolates contained base pair mutation of codon 76 in the pfcrt gene thus being resistant to chloroquine treatment and only 4/20 (20%) did not contain such mutation.
Conclusions: High treatment failures associated with Chloroquine treatment is evident of the high prevalence of mutant strains of P. falciparum field isolates thus suggesting the reduced relevance of Chloroquine as a treatment choice in the management of P. falciparum malaria.

Keywords

Chloroquine, resistant, sensitive, P. falciparum, pfcrt

Corresponding author: Muzamil Mahdi Abdel Hamid
Competing interests: No competing interests were disclosed.
Grant information: The author(s) declared that no grants were involved in supporting this work.
Copyright:  © 2018 Abdulla Mohammed WS et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).
How to cite: Abdulla Mohammed WS, Yasin K, Mahgoub NS and Abdel Hamid MM. Cross sectional study to determine chloroquine resistance among Plasmodium falciparum clinical isolates from Khartoum, Sudan [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2018, 7:208 (https://doi.org/10.12688/f1000research.13273.1) First published: 20 Feb 2018, 7:208 (https://doi.org/10.12688/f1000research.13273.1) Latest published: 20 Feb 2018, 7:208 (https://doi.org/10.12688/f1000research.13273.1)

Introduction

The use of chloroquine in low middle income countries (LMICs) has helped to reduce mortality and morbidity. In 1940, sixteen years after its discovery, Chloroquine had been used as a first drug of choice for malaria treatment due to its high efficacy, especially in highly endemic areas in Africa1. It has been used as the main treatment for malaria in Africa for over 50 years. Since the late 1980s, resistance to chloroquine has rapidly increased across much of Eastern and Southern Africa2.

Drug resistance of Plasmodium falciparum represents one of the greatest public health challenges in Africa. Tropical Africa accounts for more than 90% of the 300–500 million clinical cases of malaria occurring each year3. Malaria is transmitted by the female anopheles mosquito with P. falciparum being most prevalent; however recent studies in most parts Sudan have indicated a high prevalence of P. vivax infection4.

Chloroquine resistance is associated with a parasitic digestive vacuole, in which the toxic free heme is converted into an insoluble non-toxic crystalline form called hemozoin5. In sensitive parasites, Chloroquine diffuses across the food vacuole membrane and accumulates inside it to inhibit hemozoin crystallization, which leads to formation of another highly toxic-dimeric hematin complex1,5. Resistant strains fail to accumulate sufficient Chloroquine inside their food vacuoles as a result of mutations in the FV membrane proteins5. Mutation in P. falciparum Chloroquine resistance transporter gene Pfcrt, which codes for one of the food vacuole proteins is considered the strongest predictor for Chloroquine resistance5. This mutation leads to the substitution of the amino acid lysine with threonine at position 76 (K76T)5.

By 2004, the National Malaria Control Programme of Sudan updated the policy of malaria treatment due to high prevalence of Chloroquine resistant cases. In this policy, Artesunate + Sulfadoxine-Pyrimethamine (AS + SP) was adopted as the first-line treatment for uncomplicated P. falciparum malaria, and Artemether-Lumefantrine (AL) was adopted as a second-line treatment6.

However, until now, Chloroquine is still considered as one of the cheapest and safest drugs ever used for malaria treatment. Besides, recent clinical observations show a decreasing trend in prevalence of P. falciparum Chloroquine resistance, which has brought Chloroquine reintroduction back into the discussion about the management of malaria7,8.

Hence, in this pilot study, we aimed to assess the prevalence of Chloroquine resistant P. falciparum from clinically isolated samples by sequencing the Pfcrt gene in patients with uncomplicated malaria in Khartoum, Sudan.

Methods

Ethical statement

This study was reviewed and approved by Institute Of Endemic Diseases Research and Ethics Committee (ethical approval number 6/2016). Oral informed consent was obtained from participating patients or from parents or guardians for the case of minors (under 19 years). Oral consent was obtained over written consent, since the majority of the patients included in this study were illiterate.

Study site and patients

A cross sectional study was conducted between December 2015 and January 2016 within Khartoum East Nile Hospital. According to Isaac and Michael (1995) suggestion of pilot study sample size, twenty patients, between age 4–55 years, have been randomly selected from the hospital attendance sheet9. After getting positive results of uncomplicated malaria diagnostic tests, the selected patients were immediately asked to be a part of the present study. Thirteen of the patients were women and seven were men. Demographic data was obtained from participating patients including ethnicity and recent history of malaria infection. Only patients confirmed with P. falciparum monoinfection were included in further studies. Pregnant or lactating women and patients presenting with signs or symptoms of severe malaria or having a history of taking antimalarials during the previous month or another febrile disease requiring treatment were excluded.

Sampled and malaria microscopy

1ml blood sample was collected from each patient and stored in a labeled EDTA tube, thick and thin blood films were prepared for microscopical examination to detect and isolate Plasmodium species and estimate of parasitemia level.

Parasite DNA extraction

1ml blood sample, for mutation molecular detection, was collected from each patient and stored in a labeled EDTA tube. A mixture of 1ml of Saponin (0.5%) (Sigma-Aldrich) and 150 µL of each blood sample was incubated overnight at 4°C, and then centrifuged at 6000 rpm speed. 1ml of phosphate-buffered saline (PBS) (Sigma-Aldrich) was added and the mixture was centrifuged, at 6000 speed, for four consecutive times. 70 µL of chelex (Bio-Rad) and 30 µL of water were added to the precipitant and the mixture heated at 95°C for 20 minutes in 4 rounds (5 min/round). After every round the mixture was vortexed for 1 minute. DNA was collected and stored at -20°C until a PCR reaction was conducted.

Molecular detection of Pfcrt K76T mutation

For round 1 of nested PCR, 2µL of extracted DNA was multiplied using 0.5µL of Taq DNA polymerase, 2µL buffer, 2µL dNTPs, 10.5µL nuclease-free PCR water, 1.5µL of forward primer (CRTP1; Macrogen), and 1.5µL reverse primer (CRTP2; Macrogen). Primer details are provided in Table 1. The PCR initial denaturation was conducted at 95°C for 3min, 94°C for 30 s for the successive denaturation steps, DNA annealing was set at 56°C for 30 s and elongation at 60°C for 1 min, a total of 45 cycles were conducted and final extension at 72°C for 5min.

Table 1. Primers used in the present study.

PrimerSequenceProduct
size
Outer forward primer CRTP15’CCGTTAATAATAAATACACGCAG3’537 bp
Outer reverse primer CRTP25’CGGATGTTACAAAACTATAGTTACC3’
Nested forward primer CRTD15’TGTGCTCATGTGTTTAAACTT3’145 bp
Nested reverse primer CRTD25’CAAAACTATAGTTACCAATTTTG3’

For round 2 of nested PCR, 1 µL of round 1 product was used with CRTD1 (Macrogen), as forward primer and CRTD2 (Macrogen) as reverse primer, with the PCR profile as summarized below.

Initial denaturation at 95°C for 5 min and 92°C for 30 s for succeeding denaturation steps, annealing was conducted at 48°C for 30 s, elongation at 65°C for 30 s. Final elongation was conducted at 65°C for 3 min. The DNA amplicons were run in 1.5% agarose gel stained with 2% ethidium bromide electrophoresis gel and finally bands were visualized under UV light. The amplicons were then sequenced using Sanger sequencing techniques at Macrogen (Soul Korea). All sequences were obtained and compared to the nucleotide sequence of Plasmodium falciparum 3D7 reference strain provided by Biomedical Primate Research Centre (BPRC, Netherlands).

Bioinformatics analysis

Sequence cleaning and blast analysis were conducted using FinchTV software version 1.4.0. Visualization of nucleotide sequences and alignment with wild type sequences was conducted using Bioedit software version 7.2.5.

Results

All samples from 20 patients were successfully amplified. Nucleotide sequences were obtained and analyzed using bioinformatics analysis. Nucleotide sequences were aligned and compared to standard sequence of Plasmodium falciparum 3D7 reference strain. 16/20 (80%) of the sequenced DNA contained ACA triplet codon, which codes for Threonine at the Apol 1 restriction enzyme cutting region. Only 4/20 (20%) samples contained the AAA triple codon which codes for Lysin in the wild type Pfcrt gene, as shown in Figure 1.

95dc8169-84be-4fb4-b401-741b60c5f000_figure1.gif

Figure 1.

(a) Multiple sequence alignment highlighting the Pfcrt gene at the Apol 1 cutting region. (b and c) Highlight point mutation in Pfcrt gene where the A nucleotide in a wild-type is substituted with C nucleotide in the mutant strain, (d and e) the nucleotide sequence chromatogram of wild type and mutant strains respectively. (f and g) The translated amino acid in wild and mutant strains, respectively.

Dataset 1.Raw sequences for the 20 patients included in the present study.
Files included: sequence in pdf format, sequence for opening in FinchTV software (.ab1 file), and sequence for opening in Notepad (TXT file).

Discussion

Chloroquine has been widely used in many malaria endemic regions of many sub-Sahara African regions for its cost benefit and cost effective effects; and has therefore been considered as the golden choice in the treatment of malaria10. In the current study, Chloroquine resistance showed an increase to 80% from the previously documented figure of 72.7% in 2007 in Sudan8. This evidence differs from that documented from surveys in Malawi, Tanzania and Mozambique as in such regions there has been a decreasing trend of Chloroquine resistance prior to withdrawal of Chloroquine from the treatment guidelines11.

In Malawi, resistant strains of P. falciparum (Pfcrt- T76) had declined from >t;85% to 0% within 13 years following Chloroquine withdrawal from treatment guidelines. In Tanzania P. falciparum resistance reduced from >80% to <10% in ten years, and in Mozambique statistics showed a decline of Chloroquine resistance from >95% to 20% within five years of Chloroquine withdrawal11. However, studies from Kenya indicated a slow decline in Chloroquine resistant P. falciparum from 95% to 60% between 1993 to 2006 following malaria policy changes12. The results of the present study are similar to studies from Uganda as the frequency of Pfcrt- T76 was between 100 and 98.7% in 2008, about eight years post-Chloroquine replacement11.

In present study, the small sample size represents a limitation and the final result shows obvious persistence of P. falciparum chloroquine resistant strains in endemic areas where Chloroquine use was continued following the World Health Organization's declaration of sidelining Chloroquine as a first treatment choice for malaria.

Conclusions

Pfcrt K76T mutation still persists in Sudan, which makes it impossible for the reintroduction of Chloroquine as an antimalarial treatment choice on the current National clinical guidelines of Sudan. However for a better implementation of this policy further studies need to be conducted with a larger representative sample from all regions of Sudan as this was a primary survey that involved a narrow sample.

Data availability

Dataset 1: Raw sequences for the 20 patients included in the present study. Files included: sequence in pdf format, sequence for opening in FinchTV software (.ab1 file), and sequence for opening in Notepad (TXT file). DOI, 10.5256/f1000research.13273.d19297813

Competing interests

No competing interests were disclosed

Grant information

The author(s) declared that no grants were involved in supporting this work.

References

  • 1.  Zhou R, Zhang H, Yang C, et al.: Molecular mutation profile of pfcrt in Plasmodium falciparum isolates imported from Africa in Henan province. Malar J. BioMed Central; 2016; 15(1): 265. PubMed Abstract | Publisher Full Text | Free Full Text
  • 2.  Winstanley P, Ward S, Snow R, et al.: Therapy of falciparum malaria in sub-saharan Africa: from molecule to policy. Clin Microbiol Rev. 2004; 17(3): 612–37. PubMed Abstract | Publisher Full Text | Free Full Text
  • 3.  Bloland PB, Kazembe PN, Oloo AJ, et al.: Chloroquine in Africa: critical assessment and recommendations for monitoring and evaluating chloroquine therapy efficacy in sub-Saharan Africa. Trop Med Int Health. 1998; 3(7): 543–52. PubMed Abstract | Publisher Full Text
  • 4.  Suliman MMA, Hamad BM, Albasheer MMA, et al.: Reemergence of chloroquine (CQ) as multi-targeting antimalarial agents: 2016. 2016.
  • 5.  Mushtaque M, Shahjahan S: Reemergence of chloroquine (CQ) analogs as multi-targeting antimalarial agents: a review. Eur J Med Chem. Elsevier Ltd; 2015; 90: 280–95. PubMed Abstract | Publisher Full Text
  • 6.  Adeel AA, Elnour FA, Elmardi KA, et al.: High efficacy of artemether-lumefantrine and declining efficacy of artesunate + sulfadoxine-pyrimethamine against Plasmodium falciparum in Sudan (2010–2015): evidence from in vivo and molecular marker studies. Malar J. BioMed Central; 2016; 15(1): 285. PubMed Abstract | Publisher Full Text | Free Full Text
  • 7.  Wang X, Mu J, Li G, et al.: Decreased prevalence of the Plasmodium falciparum chloroquine resistance transporter 76T marker associated with cessation of chloroquine use against P. falciparum malaria in Hainan, People’s Republic of China. Am J Trop Med Hyg. 2005; 72(4): 410–4. PubMed Abstract
  • 8.  Menegon M, Talha AA, Severini C, et al.: Frequency distribution of antimalarial drug resistance alleles among Plasmodium falciparum isolates from Gezira State, central Sudan, and Gedarif State, eastern Sudan. Am J Trop Med Hyg. 2010; 83(2): 250–7. PubMed Abstract | Publisher Full Text | Free Full Text
  • 9.  Johanson GA, Brooks GP: Initial scale development: sample size for pilot studies. Educ Psychol Meas. 2010; 70(3): 394–400. Publisher Full Text
  • 10.  Tajebe A, Aemero M, Francis K, et al.: Identification of chloroquine resistance Pfcrt-K76T and determination of Pfmdr1-N86Y copy number by SYBR Green I qPCR. Asian Pac J Trop Biomed. Hainan Medical University; 2015; 5(3): 208–20. Publisher Full Text
  • 11.  Mohammed A, Ndaro A, Kalinga A, et al.: Trends in chloroquine resistance marker, Pfcrt-K76T mutation ten years after chloroquine withdrawal in Tanzania. Malar J. 2013; 12(1): 415. PubMed Abstract | Publisher Full Text | Free Full Text
  • 12.  Mwai L, Ochong E, Abdirahman A, et al.: Chloroquine resistance before and after its withdrawal in Kenya. Malar J. 2009; 8: 106. PubMed Abstract | Publisher Full Text | Free Full Text
  • 13.  Abdulla Mohammed WS, Kyakonye Y, Mahgoub NS, et al.: Dataset 1 in: Cross sectional study to determine chloroquine resistance among clinically isolated samples of Plasmodium falciparum from Khartoum, Sudan. F1000Research. 2018. Data Source

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 20 Feb 2018
Comment
Author details Author details
Competing interests
Grant information
Article Versions (1)
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
 - -
Citations
SEE MORE DETAILS
CITE
how to cite this article
Abdulla Mohammed WS, Yasin K, Mahgoub NS and Abdel Hamid MM. Cross sectional study to determine chloroquine resistance among Plasmodium falciparum clinical isolates from Khartoum, Sudan [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2018, 7:208 (https://doi.org/10.12688/f1000research.13273.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 20 Feb 2018
Views
8
Cite
Reviewer Report 16 May 2018
Gabriel N. Magoma, Institute for Basic Sciences, Technology and Innovation (PAUSTI), Pan African University, Juja, Kenya 
Approved
VIEWS 8
https://doi.org/10.5256/f1000research.14400.r31878
The rationale for the research on the determination of prevalence chloroquine resistance among clinical isolates is generally sound given the significance of the Malaria disease.

The statement that there chloroquine has been in used despite the ban ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Magoma GN. Reviewer Report For: Cross sectional study to determine chloroquine resistance among Plasmodium falciparum clinical isolates from Khartoum, Sudan [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2018, 7:208 (https://doi.org/10.5256/f1000research.14400.r31878)
The direct URL for this report is:
https://f1000research.com/articles/7-208/v1#referee-response-31878
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Report a concern
Views
10
Cite
Reviewer Report 08 May 2018
Satish K. Dhingra, Department of Microbiology and Immunology, Columbia University Medical Center, New York City, NY, USA 
Approved with Reservations
VIEWS 10
https://doi.org/10.5256/f1000research.14400.r33752
1. The premise of this study uses PfCRT K76T as a molecular maker of chloroquine resistance. However, a recent study from French Guiana in South America has shown that despite the presence of PfCRT K76T parasites can be sensitive to ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Dhingra SK. Reviewer Report For: Cross sectional study to determine chloroquine resistance among Plasmodium falciparum clinical isolates from Khartoum, Sudan [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2018, 7:208 (https://doi.org/10.5256/f1000research.14400.r33752)
The direct URL for this report is:
https://f1000research.com/articles/7-208/v1#referee-response-33752
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Report a concern
Views
15
Cite
Reviewer Report 03 Apr 2018
Jagadish Mahanta, Regional Medical Research Centre, Indian Council of Medical Research (ICMR), Dibrugarh, India 
Approved with Reservations
VIEWS 15
https://doi.org/10.5256/f1000research.14400.r31876
  1. The concept is old and methodology is well established, however geography specific information still has the relevance and the results of such studies have policy implications in the programme. In this context, the investigators should give elaborate
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Mahanta J. Reviewer Report For: Cross sectional study to determine chloroquine resistance among Plasmodium falciparum clinical isolates from Khartoum, Sudan [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2018, 7:208 (https://doi.org/10.5256/f1000research.14400.r31876)
The direct URL for this report is:
https://f1000research.com/articles/7-208/v1#referee-response-31876
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Report a concern

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 20 Feb 2018
Comment

Open Peer Review

Reviewer Status

Alongside their report, reviewers assign a status to the article:

Approved
The paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations
A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved
Fundamental flaws in the paper seriously undermine the findings and conclusions

Reviewer Reports

Invited Reviewers
1 2 3
Version 1
20 Feb 18 		read read read
  1. Jagadish Mahanta, Indian Council of Medical Research (ICMR), Dibrugarh, India
  2. Satish K. Dhingra, Columbia University Medical Center, New York City, USA
  3. Gabriel N. Magoma, Pan African University, Juja, Kenya

Comments on this article

All Comments(0)

Add a comment
Sign up for content alerts

Browse by related subjects

    keyboard_arrow_left Back to all reports
    keyboard_arrow_left Back to all reports
    keyboard_arrow_left Back to all reports
    Alongside their report, reviewers assign a status to the article:
    Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
    Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
    Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
    Sign In
    If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

    The email address should be the one you originally registered with F1000.
    Email address not valid, please try again

    You registered with F1000 via Google, so we cannot reset your password.

    To sign in, please click here.

    If you still need help with your Google account password, please click here.

    You registered with F1000 via Facebook, so we cannot reset your password.

    To sign in, please click here.

    If you still need help with your Facebook account password, please click here.

    Code not correct, please try again
    Email us for further assistance.
    Server error, please try again.