Successful CRISPR/Cas9 mediated homologous recombination in a chicken cell line

Construction of expression vectors

We used human codon-optimized Cas9 (hCas9) as it has been previously demonstrated that the optimized Cas9 works in chicken cells and there was no need to synthesize chicken codon-optimized nuclease [Bai et al., 2016; Véron et al., 2015; Wang et al., 2017; Zuo et al., 2016]. A plasmid CAG-Cas9 (#89995, Addgene; Cambridge MA, USA) was taken for human codon-optimized Cas9 expression. Similarly as for Cas9 it has been previously demonstrated that the human U6 promoter works in chicken cells [Bai Y; Lee et al., 2017; Véron et al., 2015]. Unique 20bp sequences for the selected gRNAs were cloned under human U6 promoter in the plasmid phU6-gRNA (#53188, Addgene). A plasmid pQE30TaqRFP (Evrogen; Moscow, Russia) coding RFP was used for cotransfection as a reporter of the efficiency of DNA delivery to the cells.

Targeting vector design

The targeting vector was designed based on the plasmid LSL-Cas9-Rosa26TV (#61408, Addgene). Homology regions of 999bp and 3093bp for left and right arms respectively were amplified from the genomic DNA of chicken cell line DF1 by PCR, and cloned using MauBI and PmeI restriction sites for the left arm, and SgrDI and AscI for the right arm respectively (DF-1 genome is yet to be sequenced, common chicken genomic data is available here). Left and right homology regions in the shuttle flank the P2A-eGFP sequence, where eGFP is enhanced green fluorescent protein. Coding sequence of the left arm was in frame with P2A-eGFP in order to provide the gene transcription under the control of endogenous promoter. Neomycin resistance (neo) gene was cloned after eGFP under a constitutive cytomegalovirus (CMV) promoter for positive selection of cells with the desired insertion. The total length of the inserted sequence between two homology arms in the shuttle was 3259bp. Diphteria Toxin Fragment A (DTA) coding sequence was inserted in the shuttle after the right arm under a PGK promoter for negative selection (Figure 1A). The left homology arm was amplified by PCR with the following primers: 5’-TTGTTGACCTGACCTGCCGTCTGGAG-3’ and 5’-CTCCTTGGATGCCATGTGGACCATCAAG-3’; the right homology arm was amplified with primers 5’-CCCTTTGTTGGAGCCCCTGCTCTTC-3’ and 5’-GAGCCCTGTATCTTCCTTGCACAGACC-3’. The primer were designed in Primer-BLAST and synthesized by Evrogen.

Figure 1.

(A) A schematic illustration of the chicken GAPDH locus, HDR-cassette, edited GAPDH locus. (B) A schematic diagram of the target sites in the chicken GAPDH 3’UTR flanked with homology arms.

Length of the right homology arm is longer in order to increase HDR due to high repeat content in 3’URT region. Chicken right and left homology arms are separated by a stretch of 42bp in the beginning of 3’UTR that is targeted by the gRNAs (Figure 1B). Thus, CRISPR/Cas9 cutting of successfully edited genomic DNA is prevented due to the targeted sequence not being present in the vector for HDR.

gRNA selection

We searched for gRNAs to target the GAPDH locus in the 3’UTR within 50bp near the stop codon of the gene. We sequenced exon 10 of GAPDH and the beginning of the 3’UTR. 100bp region of the chicken GAPDH around the stop-codon was analyzed on the ChopChop server for gRNA design. We selected three gRNAs in the locus (Table 1, Figure 1B).

These gRNAs had a few predicted off-target sites (Table S1). None of the off-target sites were present in a known coding sequence of the Gallus gallus genome.

DF1 cell line cultivation

The chicken DF-1 cell line (ATCC, CRL-12203) was cultivated in DMEM medium (Gibco, ThermoFisher) containing 10% fetal bovine serum (FBS, Gibco) and 100u/ml penicillin/streptomycin mix according to ATCC recommendation. Cells were maintained at 37°C with 5% CO2. For experiments, DF-1 cells were plated into 6-well or 24-well-plates.

Cell transfection

Cells were co-transfected with 4µg DNA plasmid mix for 6-well plates or 1µg for 24-well plates using TurboFect transfection reagent (ThermoFisher; Waltham MA, USA). The plasmid mix contained the Cas9 plasmid, the gRNA plasmid, the RFP plasmid and the linear HDR shuttle. We used the equimolar ratio of all components: pCas9:pgRNA:pRFP:HDR shuttle. After 72 hours post transfection, cells were analyzed by fluorescence microscopy. Five – seven technical repeats were made for every experiment, which were used for genome analysis, G418 selection and for flow cytometry analysis.

Selection with geneticin

Titration of geneticin (G418, Gibco) on the DF-1 cell line had been performed before selection and the optimal concentration 500ng/µl was chosen. Cells were cultured with geneticin for 10 days with daily medium change. Geneticin-resistant cells were analyzed with PCR to confirm the correct insert. Fluorescence microscopy and FACS were used to visualize and define the percentage of eGFP-positive cells respectively.

Cell viability and cytotoxicity assays

For evaluation of an appropriate concentration of geneticin, CellTiter-Blue® Cell Viability Assay (Promega, Fitchburg WI, USA) was used. The principle of the assay is based on conversion of resazurin to resorufin by metabolically active cells that results in the generation of a fluorescent shift from 605 nm to 573 nm. Thus, the produced fluorescence is proportional to the number of viable cells. 48-well assay plate containing cultured cells with media was set up. Three technical repeats were performed for each concentration at each time point. G418 (Gibco) in concentrations of 100ng/µl; 200ng/µl; 500ng/µl; 1000ng/µl; 2000ng/µl and 5000ng/µl was added. The recommended volume of CellTiter Blue Reagent was added to a series of wells at 48, 96, 140, 192 and 240 hours following geneticin treatment. After addition of the reagent, cells were incubated for 2 hours. Fluorescence was measured (CLARIOstar - BMG Labtech; Offenburg, Germany) at 560/590nm. 570–600nm absorbance versus concentration of G418 was plotted.

Detection of Cas9-mediated cuts in the targeted locus

For detection of Cas9-mediated cuts, a T7E1 assay was performed [Kim et al., 2009]. The assay is based on the ability of the T7 Endonuclease to recognize and cleave non-perfectly matched DNA. DF-1 cells were harvested and genomic DNA was isolated using the Wizard® Genomic DNA Purification Kit (Promega). PCR products were amplified using the primers T7-for: 5’-GACCATTTCGTCAAGCTTGTTTCC-3’ and T7-rev: 5’-GATCAGTTTCTATCAGCCTCTCCCAC-3’. The primer were designed in Primer-BLAST and synthesized by Evrogen. The amplified product, 635bp in length, was purified from agarose gel. 200ng of the product was reannealed to form heteroduplex DNA at the following temperature conditions: 95°C – 5min; 95°C-85°C with ramping 2°C/sec; 85°C-25°C with ramping 0,1°C/sec; 25°C – 2min; 4°C. - After the reannealing, T7 nuclease EI (New England Biolabs; Ipswich MA, USA) was added (10 units). Heteroduplex DNA was incubated with the enzyme at 37°C during 30 min. The resulting product was analyzed by electrophoresis.

Mutation frequencies were calculated as described by Guschin et al. (2010) based on the band intensities. Band intensities were measured with ImageJ software (version 2). Mutation frequency (%) = 100 · [1 – (1 – F)1/2], where F represents the cleavage coefficient, which is the proportion of the total relative density of the cleavage bands to all of the relative densities of the cleavage bands and uncut bands [Guschin et al., 2010].

PCR analysis

To confirm HDR cassette integration several pairs of primers were used (Figure S1D). The primers were designed based on schematic sequence of the edited locus in Figure S1D, checked in BLASTn for specificity and synthesised by Evrogen.

Primers forward: 5’-GACCATTTCGTCAAGCTTGTTTCC-3’ and reverse: 5’-GATCAGTTTCTATCAGCCTCTCCCAC-3’ amplify the area surrounding the site of insertion (Figure S1D, primers pointed as 1’ and 1’’). PCR product in the case of insertion had a length of 3851bp. Amplified product from the endogenous locus without an integration had a length of 635bp.

Amplification with primers exon 2-forward: 5’ - AATGGGCACGCCATCACTATCTTC - 3’ and P2A-reverse: 5’ - TGGCCCGGGATTCTCTTCGA - 3’ results in product only in the case of successful HDR-mediated cassette integration (Figure S1D, primers pointed as 2). Primers forward 5’-GACCATTTCGTCAAGCTTGTTTCC-3’ and reverse 5’-tggcccgggattctcttcgac-3’ (Figure S4D, primers pointed as 3) were used for PCR analysis from the genome of cells enriched by drug selection after successful modification. The product is only amplified in case of an unmodified genome. This happens due to the reverse primer aligning to the 50bp area of 3’UTR that was targeted by gRNAs, but it does not align to the HDR vector itself.

FACS analysis

FACS analysis (Accuri™ C6 Flow Cytometer, BD Biosciences; San Jose CA, USA) was used to estimate the proportion of eGFP- positive cells.

Off-target analysis

Potential CRISPR/Cas9 off-target sites for selected guides are presented in Table S1. The off-targets were predicted by ChopChop tool. All off-target sites were located in introns or in intergenic loci.

In vitro Cas9 cleavage

Primers for in vitro gRNA synthesis:

In order to make dsDNA template for RNA transcription the two following oligonucleotides were annealed.

-CRISPR R: (common primer for all targets, it contains the sequence for RNA scaffold synthesis) - the oligonucleotide was common for synthesis of all DNA templates coding a gRNA:

5’–AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC–3’-CRISPR F: (the oligonucleotide contains the T7 promoter and the specific target sequence). Both oligonucleotides have a 20nt complementary sequence that allows them to anneal.

CRISPR F GAPDH gRNA1

5’–GAAATTAATACGACTCACTATA GGGGCATCCAAGGAGTGAGCC GTTTTAGAGCTAGAAATAGC–3’

CRISPR F GAPDH gRNA2

5’–GAAATTAATACGACTCACTATA GGGTGTGCCTGGCTCACTCCT GTTTTAGAGCTAGAAATAGC–3’

CRISPR F GAPDH gRNA3

5’–GAAATTAATACGACTCACTATA GGGCTTCCCTAGGCAGCAGGG GTTTTAGAGCTAGAAATAGC–3’

The oligonucleotide synthesis was ordered from Evrogen.

Full-length dsDNA template was made via PCR overlap of corresponding oligonucleotides

In vitro transcription of gRNAs

HiScribe T7 High Yield RNA Synthesis Kit (E2040S, New England Biolabs) was used for in vitro RNA synthesis of gRNAs, as described in the manufacturer’s protocol. RNA was purified using the MEGAclear™ Transcription Clean-Up Kit (AM1908, ThermoFisher) following the protocol from the manufacturer.

In vitro Cas9 digestion

In vitro digestion was made by Cas9 Streptococcus pyogenes (S. pyogenes; New England Biolabs) according to the protocol from the manufacturer. PCR product for analysis was amplified with following primers: forward 5’-GACCATTTCGTCAAGCTTGTTTCC-3’and reverse 5’-GATCAGTTTCTATCAGCCTCTCCCAC-3’.

Droplet digital PCR (ddPCR).

Probes description

We designed three kinds of probes. Probe 1 - a reference probe (VIC) located away from the editing site to count all genomic copies (Figure S2I). GAPDH was used as a reference, having a single copy per genome [Weiskirchen et al., 1993].

We designed three kinds of probes. Probe 1 - a reference probe (VIC) located away from the editing site to count all genomic copies (Figure S2I). GAPDH was used as a reference, having a single copy per genome [Weiskirchen et al., 1993].

Probe 2 - a (FAM) probe, located in the inserted sequence (Figure S2I). Probe 3 - a (VIC) probe located in DTA gene of the cassette that does not insert into the locus or kill the cells in case of insertion (Figure S2I). The nucleotide sequence of the probes and primers are shown in the Table 2.

Samples description.

The following samples were used:

-DNA from DF1 cells transfected with linearised cassette only (negative control). The sample was taken in amount 20ng.

-DNA from geneticin enriched DF1 cells, isolated 1 month after HDR. The sample was taken in amount - 1ng and 20ng.

-Water was used as a no template control (NTC) to rule out cross-contamination.

We set up two repeats for each amount of DNA.

Cassette probe was used to determine the copy number of transgene in DF1 cells. GAPDH probe was used as the reference.

ddPCR reaction preparation.

The following reagents were mixed in 96 plate to make reaction:

ddPCR Supermix for Probes (#186-3026, Bio-Rad);

10 U of EcoRI (#R3101S, New England BioLabs);

Genomic DNA (DNA dilutions 1ng and 20ng were selected based on preliminary experiments);

The total volume of the reaction was 20µl.

Droplets were generated with 20μl of the premixed reaction and a QX200 Droplet Generator according to the manufacturer’s instructions (Bio-Rad) and transferred to a 96-well PCR plate for standard PCR on a CFX96 Touch™ Real-Time PCR Detector system (Bio-Rad).

The following cycling programs were used:

1) 95°C for 10 min;

2) 95°C for 30 s;

3) 59–63 °C (in depends on pair of primers and probe) for 1 min; repeat steps 2 and 3 for 40 times;

Optimal annealing temperature was determined empirically for each pair of primers and probe with a temperature gradient. After PCR amplification, each droplet provides an independent fluorescent positive or negative signal indicating the target DNA was present or not. The droplets were analysed with a QX200 Droplet Reader (Bio-Rad) with the selected option “absolute quantification”. Positive and negative droplets are counted for each samples, and the software calculates the concentration of target DNA as copies per microliter.

Quantification of ddPCR data.

QuantaSoft (version 1.7.4.0917) was used for quantification (Bio-Rad).

An appropriate threshold between the positive and negative droplets was applied manually based on the NTC wells. ddPCR software reads the positive and negative droplets in each sample and plots the fluorescence droplet by droplet. The fraction of positive droplets determines the concentration of the target in the sample. Software calculates the concentration of target DNA as copies per microliter. Then the copy number of an unknown target is calculated relative to a known reference. In our case we estimated the copy number of inserted sequence relative to GAPDH gene. The confidence intervals for each well are calculated by QuantaSoft based on Poisson distribution.

The formula used for Poisson modeling is:

Copies per droplet = –ln(1 – p)

where p = fraction of positive droplets.

The primers and probes were designed in Primer-BLAST. Primers were synthesised by Evrogen. Probes were ordered from Syntol (Moscow, Russia)

Targeting 3’UTR of chicken GAPDH by Cas9

In order to test the effectiveness of targeting endogenous 3’UTR of GAPDH with the selected gRNAs in chicken cells, Cas9, gRNA plasmids, combined with the RFP plasmid, were co-transfected in DF-1 cells. Cas9 expression vector without a gRNA was used as the negative control. RFP expression was estimated at 72h after transfection (Figure S4). Figure S2 is represented by seven technical repeats. The average level of transfection efficiency was more than 45%.

Genomic DNA was extracted from the cells, and T7 endonuclease I (T7EI) assay demonstrated that only gRNA2 in complex with Cas9 had activity in DF1 cells with the targeting rate around 1.8% (Figure 2).

Figure 2. Detection of Cas9-mediated cuts in the targeted endogenous chicken GAPDH 3’UTR locus with T7 Endonuclease assay.

Homologous recombination in GAPDH locus

In order to obtain cells with the insertion we co-transfected DF-1 cells with plasmids encoding Cas9, gRNA, RFP and cassette for homology directed repair. As a negative control we added Cas9, RFP and cassette without any gRNAs. At 72h after transfection we observed 0.5% GFP-positive cells of transfected cells in the experimental group (Figure 3). Figure 3 is represented by five technical repeats. In the vector for HDR, eGFP does not have its own promoter and can be expressed only in the case of the correct insertion in frame with the GAPDH gene. The genomic DNA was extracted for PCR analysis. The analysis confirmed the presence of the expected integration (Figure S1A and Figure S6B).

Figure 3. Homologous recombination at the CRISPR/Cas9-targeted 3’UTR GAPDH locus.

(A) Transfection with gRNA2, Cas9, RFP; (B) Transfection with gRNA2, Cas9, RFP, cassette for HDR; (C) Transfection with Cas9 without any gRNA, RFP, cassette for HDR. Scale bar = 200 µm.

Enrichment of successfully edited cells with geneticin selection

Applying drug selection in combination with CRISPR/Cas9 allowed us to select and grow colonies carrying the modification. Based on the survival curve (Figure S5) we added 500 ng/µl of geneticin (G418) at 72h after transfection. The appropriate concentration of the drug was selected after titration in the DF-1 cell line (Figure S5). Single eGFP-positive cells had developed in colonies after 10 days of incubation on G418. RFP fluorescence had vanished due to its transient expression (Figure 4). Figure 4 is representative of five technical repeats.

Figure 4. Enrichment of CRISPR/Cas9-modified cells with G418 selection, 500 ng/µl.

(A) 72h after transfection; (B) 15 days after selection; (C) 1 month after selection. Scale bar = 200 µm. Figure is representative of five technical repeats.

One month after the drug selection the enriched cells were analyzed by PCR and FACS. PCR analysis confirmed the absence of cells without modification (Figure S1C). FACS analysis showed about 90% of eGFP positive cells in the cell population (Figure S6). The nucleotide composition around the insertion was analyzed by DNA sequencing, additionally confirming the correct integration (Figure S7). Also we made a ddPCR analysis to measure the copy number of the integrated sequence per genome. DNA samples from enriched edited cells was analysed in comparison with DNA sample from the cassette only transfected cells (at 72 hour after transfection). 1-D plot with FAM positive droplets (Figure S2.II.A), indicating insertion, and VIC positive (Figure S2.II.B) droplets, indicating the reference gene GAPDH, plotted on the graph of fluorescence intensity versus droplet number is shown for each sample (please see the method description). The positive droplets determines the concentration of the target in the sample which are calculated into the concentration of target DNA as copies/µl. The number of copies of the insertion was normalised by the number of copies of GAPDH as it is known that birds have one copy of the gene [Weiskirchen et al., 1993] that implies two alleles per genome. In result we got about 0,8 copy of the insertion per GAPDH allele (Figure S2.III) that additional confirm the FACS data. The copy-number of DTA gene was also estimated to differentiate the cassette or improperly integrated sequence from the correct insertion. In the enriched edited cells DTA gene was not observed (data is not shown in the Figure S2.II). Thus, all used methodological approaches confirmed the correctness and effectiveness of the transgene integration.