Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer

Alex Chauhan; Nilesh Pandey; Nitin Raithatha; Purvi Patel; Ajesh Desai; Neeraj Jain

doi:10.12688/f1000research.14840.2

Home Browse Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Revised

Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer

[version 2; peer review: 2 approved, 1 not approved]

Alex Chauhan¹, Nilesh Pandey¹, Nitin Raithatha², Purvi Patel³, Ajesh Desai⁴, Neeraj Jain¹

Alex Chauhan¹, Nilesh Pandey¹, [...] Nitin Raithatha², Purvi Patel³, Ajesh Desai⁴, Neeraj Jain¹

PUBLISHED 30 Aug 2018

Author details Author details

¹ P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India
² Department of Obstetrics and Gynaecology, Pramukh Swami Medical College, Shree Krishna Hospital, Karamsad, India
³ Department of Obstetrics and Gynaecology, Sir Sayajirao General Hospital and Medical College Baroda, Vadodara, India
⁴ Department of Obstetrics and Gynaecology, GMERS Medical College and Hospital, Ahmedabad, India

Alex Chauhan
Roles: Formal Analysis, Investigation, Methodology, Visualization, Writing – Original Draft Preparation

Nilesh Pandey
Roles: Formal Analysis, Investigation, Writing – Review & Editing

Nitin Raithatha
Roles: Investigation, Resources, Writing – Review & Editing

Purvi Patel
Roles: Investigation, Resources, Writing – Review & Editing

Ajesh Desai
Roles: Investigation, Resources, Writing – Review & Editing

Neeraj Jain
Roles: Conceptualization, Funding Acquisition, Project Administration, Supervision, Validation, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

Abstract

Background: Toll-like receptor 9 (TLR9) plays a key role in the elimination of viral pathogens by recognising their CpG DNA. Polymorphisms in the TLR9 gene may influence their recognition and subsequent elimination. Therefore, the present study was designed to elucidate the role of a rare unexplored TLR9 gene polymorphism C296T/ Pro99Leu (rs5743844) in cervical cancer susceptibility among Indian women.
Methods: The genotyping of TLR9 Pro99Leu polymorphism in 110 cervical cancer patients and 141 healthy controls was performed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP).
Results: The genotype frequency detected in both cervical cancer and control populations was 1.0 (CC), 0.0 (CT) and 0.0 (TT); while the allele frequency was found to be 1.0 (C) and 0.0 (T).
Conclusions: The present study demonstrates no involvement of TLR9 C296T/ Pro99Leu polymorphism in cervical cancer susceptibility and supports minor allele frequency (MAF) (0.0002) status of the same as no nucleotide variation was detected in any of the study subjects.

Keywords

Cervical cancer, TLR9, Polymorphism, Genotypic frequency, Susceptibility

Corresponding author: Neeraj Jain

Competing interests: No competing interests were disclosed.

Grant information: The study was funded by Charotar University of Science and Technology (CHARUSAT).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2018 Chauhan A et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

How to cite: Chauhan A, Pandey N, Raithatha N et al. Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer [version 2; peer review: 2 approved, 1 not approved]. F1000Research 2018, 7:606 (https://doi.org/10.12688/f1000research.14840.2) First published: 17 May 2018, 7:606 (https://doi.org/10.12688/f1000research.14840.1) Latest published: 30 Aug 2018, 7:606 (https://doi.org/10.12688/f1000research.14840.2)

Revised Amendments from Version 1

This version has been modified based on the reservations given by Dr. Gopeshwar Narayan and Prof. B. C. Das. The previous version of this article did not include the power calculation. In this version, we have calculated the statistical power based on the global minor allele frequency of the polymorphism under study and have drawn appropriate conclusions. The reason for the selection of TLR9 gene for this study has been mentioned in the Introduction as well as in the Discussion.

See the authors' detailed response to the review by Gopeshwar Narayan
See the authors' detailed response to the review by Bhudev C. Das

Introduction

Cervical cancer is the fourth-most common cancer among women globally and second leading cause of cancer-related deaths in Indian women¹. Although persistent infection of high-risk human papillomavirus (hrHPV) is considered as the chief causative agent of cervical cancer, variations in host genetic make-up does influence the risk of acquiring HPV infection, and susceptibility to cervical carcinogenesis^2–4. In this context, variations in Toll-like receptor (TLR) genes, that play a crucial role in activating immune response by identifying pathogen-associated molecular patterns (PAMPs), have drawn significant attention, as single nucleotide polymorphisms (SNPs) in TLR genes have been shown to alter susceptibility to many infections and human diseases including cancer^5–8.

Ten functional TLR genes are known in humans, the products of which recognizes specific PAMPs⁹. TLR1, TLR2, TLR4, TLR5 and TLR6 which are located on the cell surface of immune cells are known to recognize triacyl lipopeptides, peptidoglycans, lipopolysaccharides, flagellin and diacyl lipopeptides respectively that belong to bacterial cell wall or virus particles^10,11. On the other hand TLR3, TLR7, TLR8 and TLR9 are located in the endosomal compartments, wherein TLR3 recognizes single as well as double stranded viral RNA, TLR7 recognizes ssRNA from viruses while the TLR9 gene product recognizes bacterial and viral DNA motifs including HPV16 CpG motifs^5,10–12. Frequently analysed TLR9 SNPs G2848A and −1486 T/C have been suggested to alter cervical cancer susceptibility^13–16, but no report is available elucidating the role of TLR9 Pro99Leu polymorphism in cancer. Although TLR9 Pro99Leu is a rare population SNP with a global minor allele frequency (MAF) of 0.0002 as reported in the single nucleotide polymorphism database (dbSNP), in-vitro analysis has revealed its significant role in DNA ligand hyporesponsiveness¹⁷. Considering the fact that cervical cancer is largely caused by hrHPV infection and TLR9 has the ability to respond to viral DNA, while other TLRs do not, the present study was designed to elucidate the association of the TLR9 Pro99Leu polymorphism with cervical cancer.

Methods

Biological specimens

Biopsies from 110 cervical cancer patients and cervical smears from 141 healthy volunteers were collected from Shree Krishna Hospital, Anand; Sir Sayajirao General Hospital, Vadodara; and GMERS Hospital, Ahmedabad, India. The samples were collected from 2012 to 2017. The cancer biopsies and healthy cervical smears were histopathologically and cytologically confirmed. The clinical staging of cervical cancer samples was done as per The International Federation of Gynecology and Obstetrics (FIGO) guidelines.

DNA isolation and genetic analysis

DNA was isolated from cervical cancer biopsies and cervical smears by standard phenol-chloroform extraction method¹⁸. In the case of a low number of cervical cells, a spin-column based DNA isolation kit (Macherey-Nagel, Germany; Cat# 740952.50) was utilized as per manufacturer’s instructions. The quality and quantity of DNA was determined using ethidium bromide-stained 1% agarose gel on GelDoc system (BioRad, USA) as well as a NanoDrop 2000 (Thermofisher, USA). The TLR9 Pro99Leu polymorphism was detected using polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method as described by Kubarenko et al.¹⁷ Briefly, a 25µl PCR mix contained 0.1µM each of forward and reverse primer (Imperial Life Sciences, India), 0.1mM dNTP mix (Invitrogen, USA; Cat# 18427088), 2.5mM MgCl₂ (Vivantis, USA; Cat# RB0204), 1 unit Taq DNA polymerase (Kapabiosystems, USA; Cat# KK1015) and 100 to 150ng genomic DNA. The PCR was run on an MJ Mini thermal cycler (BioRad, USA).

Upon confirmation of 337 bp PCR product on 2% ethidium bromide-stained agarose gel, 10µl PCR product was digested with BslI restriction enzyme (New England Biolabs, USA; Cat# R0555S) at 55°C overnight, separated on 12% polyacrylamide gel and analysed on a GelDoc system (BioRad, USA) for genotype identification. The details of PCR conditions and parameters for genotype consideration are mentioned in Table 1 and Table 2 respectively. To confirm the PCR-RFLP results, we performed Sanger sequencing of five randomly selected cervical cancer as well as control samples. All the sequencing reactions were performed on 3730xl DNA Analyzer (Applied Biosystems, USA) using BigDye™ Terminator v3.1 kit (Applied Biosystems, USA; Cat# 4337454) as per manufacturer’s instructions. The 10µl sequencing reaction was comprised of 7.0µl BigDye™ Terminator v3.1 Ready Reaction Mix, 10pmol forward primer and 50ng PCR product. The sequencing results were analyzed on Sequencing Analysis Software version 5.3.1 (Applied Biosystems, USA).

Table 1. Details of TLR9 C296T/ Pro99Leu specific PCR.

Primer Sequence (5′ – 3′)	Thermal Profile	PCR Product	Visualized on
FP: GGATGTTGGTATGGCTGAGG RP: AACTGCAACTGGCTGTTCCT	(95°C – 5′) 1 (95°C – 45″, 56°C – 1′, 72°C – 30″) 35 (72°C – 10′) 1	337 bp	2% Agarose Gel

Abbreviations: TLR9, Toll-like receptor 9; FP, forward Primer; RP, Reverse Primer; PCR, Polymerase Chain Reaction; bp, base pairs

Table 2. Parameters for genotypes consideration of TLR9 C296T/ Pro99Leu polymorphism.

Enzyme	Digested Products (bp)	Genotype
*BslI*	166 + 136 + 35	CC (Pro/Pro)
	201 + 166 + 136 + 35	CT (Pro/Leu)
	201 + 136	TT (Leu/Leu)

Statistical analysis

Statistical analysis was performed on GraphPad Prism version 5.00 for Windows (GraphPad Software, USA). Age of patients and controls were compared using two-sided Student's t-test. Due to the presence of single genotype across all the samples no additional statistical association was performed. The power of the study was calculated using Online Sample Size Estimator.

Results

Demographic and clinical characteristics

The average age of cervical cancer patients (52.43±11.78 years) and controls (51.8±11.35 years) was comparable without any statistically significant difference (p=0.668). Histopathologic analysis revealed all the cervical cancer cases to be of squamous cell carcinoma type. According to FIGO analysis, 9 (8.2%), 39 (35.5%), 55 (50%) and 7 (6.3%) patients belonged to Stage I, II, III and IV respectively. In the absence of polymorphic allele in the present population we calculated the power of the study based on the global minor allele frequency (0.0002) which was found to be 3.6%.

TLR9 Pro99Leu polymorphism

PCR amplification revealed the presence of a single intact band of 337 bp (Figure 1; Dataset 1¹⁹). A single genotype CC (Pro/Pro) was detected across all the sample types (Table 3; Dataset 2²⁰) which was evident by the presence of 166 bp, 136 bp and 35 bp DNA bands after RFLP assay (Figure 2; Dataset 3²¹). Sanger sequencing of the randomly selected PCR products corroborated with RFLP results (Figure 3; Dataset 4²²).

Figure 1. Representative PCR picture showing amplification of TLR9 gene segment for C296T/ Pro99Leu gene polymorphism on ethidium bromide-stained 2% agarose gel.

Lane M is 100 bp molecular marker (Takara, Japan; Cat# RR820A), Lane 1 is negative control and Lanes 2–7 are tumor DNA showing PCR products of 337 bp. (Abbreviations: PCR, Polymerase Chain Reaction; TLR9, Toll-like receptor 9; bp, base pair).

Table 3. Genotype and allele frequencies of TLR9 C296T/ Pro99Leu polymorphism in cervical cancer patients and healthy controls.

Genotype	Cervical Cancer n (%)	Controls n (%)
CC	110 (100.0)	141 (100.0)
CT	0 (0.0)	0 (0.0)
TT	0 (0.0)	0 (0.0)
Allele
C	220 (100.0)	282 (100.0)
T	0 (0.0)	0 (0.0)

Figure 2. Representative PAGE picture of RFLP results for TLR9 C296T/ Pro99Leu polymorphism on 12% polyacrylamide gel.

Lane M is 100 bp molecular marker, Lane 1 is undigested PCR product and Lanes 2 to 6 are showing digested PCR products of 166 bp and 136 bp (35 bp band is not visible) by BslI enzyme representing CC genotype. (Abbreviations: PAGE, Polyacrylamide Gel Electrophoresis; RFLP, Restriction Fragment Length Polymorphism).

Figure 3.

Sanger sequence electropherogram of (A) a healthy individual and (B) patient showing single peak (highlighted) of C allele of TLR9 C296T/ Pro99Leu SNP representing CC genotype. (Abbreviations: SNP, Single Nucleotide Polymorphism).

Dataset 1.Raw agarose gel images of PCR amplification of TLR9 gene segment for C296T/ Pro99Leu polymorphism from 50 samples consisting of 26 controls and 24 cervical cancer cases.

Figure 1 is a representative picture of the same.

Dataset 2.Age, clinical stage and TLR9 genotype status among cervical cancer patients as well as age and TLR9 genotype status among controls.

Dataset 3.Raw polyacrylamide gel electrophoresis images of 27 controls and 24 cervical cancer PCR amplified products that underwent restriction fragment length polymorphism (RFLP) analysis.

Figure 2 is a representative picture of the same.

Dataset 4.Nucleotide sequences spanning TLR9 gene segment for C296T single nucleotide polymorphism, obtained after performing Sanger sequencing on five samples each of cervical cancer and healthy controls.

The sequencing results confirm the restriction fragment length polymorphism (RFLP) analysis that represents single genotype CC among all the study subjects. Figure 3A and B are representative electropherograms of the TLR9 C296T CC genotype as evident by the presence of single peak of C allele.

Discussion

Although hrHPV infection is the primary etiological agent of cervical carcinogenesis, the role of host genetic factors, especially those associated with body immunity such as TLRs, cannot be ignored. TLR9 which recognizes CpG DNA motifs from bacteria and viruses has also been reported to recognize HPV16 CpG DNA¹². Moreover, variations in the TLR9 gene has found associations with various diseases including cancer. TLR9 SNPs −1486 T/C and G2848A have been found to be contradictorily associated with cervical cancer risk. In Polish and Mexican populations both TLR9 −1486 T/C and G2848A polymorphisms were suggested to be risk factors for cervical carcinogenesis^13,15. In two independent studies on Chinese population, a positive association with TLR9 G2848A SNP was detected^23,24 but no involvement of TLR9 −1486 T/C was found²⁴, however, the other study suggested −1486 T/C was not a contributory factor to cervical carcinogenesis¹⁴. From India, a single report on North Indian patients revealed a marginal role of TLR9 G2848A polymorphism with cervical cancer risk¹⁶.

To date, no report is available on the rare TLR9 Pro99Leu polymorphism in cancer, which has been shown to be associated with DNA ligand hyporesponsiveness in HeLa cell lines¹⁷. Considering the fact that cervical cancer is majorly caused by hrHPV infection and the TLR9 Pro99Leu polymorphism is associated with DNA ligand hyporesponsiveness, the present study investigated, for the first time, the role of the TLR9 Pro99Leu polymorphism in cervical cancer susceptibility. This is also the first report to study this polymorphism in any of the cancer types globally. Our results revealed the presence of a single genotype CC (Pro/Pro) among cases and controls, demonstrating no significance of the Pro99Leu polymorphism to cervical cancer susceptibility. Similarly, no association with high-risk HPV infection, that was detected in almost 70% of the patients, was found (details of HPV infection to be published elsewhere). A complete absence of Pro99Leu in our study population corroborates with the report of Lee and group (2006) where neither controls nor lung tuberculosis and sarcoidosis patients had the TLR9 Pro99Leu polymorphism²⁵. Similarly, the Pro99Leu polymorphism was not detected among healthy Caucasians as well as pneumococcal disease, bacteraemia, and leprosy patients¹⁷. Moreover, according to dbSNP, the global MAF of this polymorphism is 0.0002, and our results, albeit on a smaller cohort, do solicit its rare polymorphism status. Therefore, owing to sample size constraint, it would be inappropriate to draw a direct conclusion of the effect of above-said polymorphism on the susceptibility to cervical cancer. As the power of study calculated based on the global MAF was very low (3.6%), and to achieve a power of study of 80%, approximately 40000 samples will be required to analyze. Finally, under present scenario, a direct role of this SNP in cancer, as well as other diseases, seems a remote possibility. Nonetheless, a comprehensive analysis of a larger cohort covering a varied ethnic population globally is suggested to comprehend its role in microbial infection and/or disease susceptibility including cancer.

Conclusion

The preliminary data obtained from the present study does not suggest a role for the TLR9 Pro99Leu polymorphism in cervical cancer susceptibility. However, analysis on a larger cohort worldwide may provide more insights into the frequency distribution of Pro99Leu polymorphism and reveal its influential role in various human diseases including cancer.

Data availability

Dataset 1. Raw agarose gel images of PCR amplification of TLR9 gene segment for C296T/ Pro99Leu polymorphism from 50 samples consisting of 26 controls and 24 cervical cancer cases. Figure 1 is a representative picture of the same. 10.5256/f1000research.14840.d203405¹⁹

Dataset 2. Age, clinical stage and TLR9 genotype status among cervical cancer patients as well as age and TLR9 genotype status among controls. 10.5256/f1000research.14840.d203406²⁰

Dataset 3. Raw polyacrylamide gel electrophoresis images of 27 controls and 24 cervical cancer PCR amplified products that underwent restriction fragment length polymorphism (RFLP) analysis. Figure 2 is a representative picture of the same. 10.5256/f1000research.14840.d203407²¹

Dataset 4. Nucleotide sequences spanning TLR9 gene segment for C296T single nucleotide polymorphism, obtained after performing Sanger sequencing on five samples each of cervical cancer and healthy controls. The sequencing results confirm the restriction fragment length polymorphism (RFLP) analysis that represents single genotype CC among all the study subjects. Figure 3 A and B are representative electropherograms of the TLR9 C296T CC genotype as evident by the presence of single peak of C allele. 10.5256/f1000research.14840.d203408²²

Ethical considerations

The research was carried out following due approval from ethics committee of all the participating institutes. Subjects were verbally informed and explained about the study, and were provided with an information sheet. Written informed consent was obtained from the subjects who agreed to enrol in the present study. Personal information of all the study subjects was kept confidential.

Grant information

The study was funded by Charotar University of Science and Technology (CHARUSAT).

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Acknowledgement

Authors thank Dr. Anjana Chauhan, Gynec Cancer Surgeon, Ex Associate Professor, Gujarat Cancer and Research Institute, Ahmedabad, India for stimulating discussions.

Faculty Opinions recommended

References

1. Ferlay J, Soerjomataram I , Dikshit R, et al.: Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 2015; 136(5): E359–386. PubMed Abstract | Publisher Full Text
2. Walboomers JM, Jacobs MV, Manos MM, et al.: Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol. 1999; 189(1): 12–9. PubMed Abstract | Publisher Full Text
3. Chattopadhyay K: A comprehensive review on host genetic susceptibility to human papillomavirus infection and progression to cervical cancer. Indian J Hum Genet. 2011; 17(3): 132–44. PubMed Abstract | Publisher Full Text | Free Full Text
4. Leo PJ, Madeleine MM, Wang S, et al.: Defining the genetic susceptibility to cervical neoplasia-A genome-wide association study. PLoS Genet. 2017; 13(8): e1006866. PubMed Abstract | Publisher Full Text | Free Full Text
5. Kumar H, Kawai T, Akira S: Toll-like receptors and innate immunity. Biochem Biophys Res Commun. 2009; 388(4): 621–5. PubMed Abstract | Publisher Full Text
6. Schröder NW, Schumann RR: Single nucleotide polymorphisms of Toll-like receptors and susceptibility to infectious disease. Lancet Infect Dis. 2005; 5(3): 156–64. PubMed Abstract | Publisher Full Text
7. Misch EA, Hawn TR: Toll-like receptor polymorphisms and susceptibility to human disease. Clin Sci (Lond). 2008; 114(5): 347–60. PubMed Abstract | Publisher Full Text
8. El-Omar EM, Ng MT, Hold GL: Polymorphisms in Toll-like receptor genes and risk of cancer. Oncogene. 2008; 27(2): 244–52. PubMed Abstract | Publisher Full Text
9. Gomaz AN: The polymorphisms in Toll-like receptor genes and cancer risk. 2012; 114(4): 461–9. Reference Source
10. Kawai T, Akira S: Toll-like receptor and RIG-I-like receptor signaling. Ann N Y Acad Sci. 2008; 1143: 1–20. PubMed Abstract | Publisher Full Text
11. Hemmi H, Takeuchi O, Kawai T, et al.: A Toll-like receptor recognizes bacterial DNA. Nature. 2001; 408(6813): 740–5. PubMed Abstract | Publisher Full Text
12. Hasan UA, Bates E, Takeshita F, et al.: TLR9 expression and function is abolished by the cervical cancer-associated human papillomavirus type 16. J Immunol. 2007; 178(5): 3186–97. PubMed Abstract | Publisher Full Text
13. Roszak A, Lianeri M, Sowińska A, et al.: Involvement of Toll-like Receptor 9 polymorphism in cervical cancer development. Mol Biol Rep. 2012; 39(8): 8425–30. PubMed Abstract | Publisher Full Text | Free Full Text
14. Chen X, Wang S, Liu L, et al.: A genetic variant in the promoter region of Toll-like receptor 9 and cervical cancer susceptibility. DNA Cell Biol. 2012; 31(5): 766–71. PubMed Abstract | Publisher Full Text
15. Martínez-Campos C, Bahena-Román M, Torres-Poveda K, et al.: TLR9 gene polymorphism -1486T/C (rs187084) is associated with uterine cervical neoplasm in Mexican female population. J Cancer Res Clin Oncol. Springer Berlin Heidelberg; 2017; 143(12): 2437–2445. PubMed Abstract | Publisher Full Text
16. Pandey S, Mittal B, Srivastava M, et al.: Evaluation of Toll-like receptors 3 (c.1377C/T) and 9 (G2848A) gene polymorphisms in cervical cancer susceptibility. Mol Biol Rep. 2011; 38(7): 4715–21. PubMed Abstract | Publisher Full Text
17. Kubarenko AV, Ranjan S, Rautanen A, et al.: A naturally occurring variant in human TLR9, P99L, is associated with loss of CpG oligonucleotide responsiveness. J Biol Chem. 2010; 285(47): 36486–94. PubMed Abstract | Publisher Full Text | Free Full Text
18. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. Reference Source
19. Chauhan A, Pandey N, Raithatha N, et al.: Dataset 1 in: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.14840.d203405
20. Chauhan A, Pandey N, Raithatha N, et al.: Dataset 2 in: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.14840.d203406
21. Chauhan A, Pandey N, Raithatha N, et al.: Dataset 3 in: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.14840.d203407
22. Chauhan A, Pandey N, Raithatha N, et al.: Dataset 4 in: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.14840.d203408
23. Jin Y, Qiu S, Shao N, et al.: Association of toll-like receptor gene polymorphisms and its interaction with HPV infection in determining the susceptibility of cervical cancer in Chinese Han population. Mamm Genome. Springer US; 2017; 28(5–6): 213–9. PubMed Abstract | Publisher Full Text
24. Lai ZZ, Ni-Zhang, Pan XL: Toll-like receptor 9 (TLR9) gene polymorphisms associated with increased susceptibility of human papillomavirus-16 infection in patients with cervical cancer. J Int Med Res. 2013; 41(4): 1027–36. PubMed Abstract | Publisher Full Text
25. Lee PL, West C, Crain K, et al.: Genetic polymorphisms and susceptibility to lung disease. J Negat Results Biomed. 2006; 5: 5. PubMed Abstract | Publisher Full Text | Free Full Text

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 17 May 2018

Author details Author details

Alex Chauhan
Roles: Formal Analysis, Investigation, Methodology, Visualization, Writing – Original Draft Preparation

Nilesh Pandey
Roles: Formal Analysis, Investigation, Writing – Review & Editing

Nitin Raithatha
Roles: Investigation, Resources, Writing – Review & Editing

Purvi Patel
Roles: Investigation, Resources, Writing – Review & Editing

Ajesh Desai
Roles: Investigation, Resources, Writing – Review & Editing

Neeraj Jain
Roles: Conceptualization, Funding Acquisition, Project Administration, Supervision, Validation, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

The study was funded by Charotar University of Science and Technology (CHARUSAT).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (2)

version 2

Revised

Published: 30 Aug 2018, 7:606

https://doi.org/10.12688/f1000research.14840.2

version 1

Published: 17 May 2018, 7:606

https://doi.org/10.12688/f1000research.14840.1

© 2018 Chauhan A et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Chauhan A, Pandey N, Raithatha N et al. Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer [version 2; peer review: 2 approved, 1 not approved]. F1000Research 2018, 7:606 (https://doi.org/10.12688/f1000research.14840.2)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?

Key to Reviewer Statuses VIEW HIDE

ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions

Version 2

VERSION 2

PUBLISHED 30 Aug 2018

Revised

Views

Reviewer Report 03 Oct 2018

Gopeshwar Narayan, Department of Molecular and Human Genetics, Banaras Hindu University, Varanasi, India

Approved

https://doi.org/10.5256/f1000research.17000.r39042

The authors have addressed the ... Continue reading

CITE

Report a concern

Respond or Comment

Views

Reviewer Report 13 Sep 2018

Balraj Mittal, Department of Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow, India

Not Approved

https://doi.org/10.5256/f1000research.17000.r37741

CITE

Report a concern

Respond or Comment

Views

Reviewer Report 04 Sep 2018

Bhudev C. Das, Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, New Delhi, India

Approved

https://doi.org/10.5256/f1000research.17000.r37740

CITE

Report a concern

Respond or Comment

Version 1

VERSION 1

PUBLISHED 17 May 2018

Views

Reviewer Report 02 Aug 2018

Bhudev C. Das, Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, New Delhi, India

Approved with Reservations

https://doi.org/10.5256/f1000research.16153.r34120

I have gone through the manuscript entitled “Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer” submitted by Alex Chauhan et al. for its publication in F1000Research. The authors have studied the polymorphisms of Toll-like receptor 9 (TLR9) Pro99Leu polymorphism in cervical cancer to examine its role in cervical carcinoma in elimination of viral pathogens though recognition of CpG islands. It is suggested that polymorphism of TLR9 gene may influence the recognitions of the above DNA sequence leading to elimination of infection. The authors have used as many as 110 cervical cancer samples and normal cervical smears from 141 healthy controls and employed PCR-RFLP and sequencing methods for detection of genotype variation. The authors could not find any variation in genotypes of TLR9 hence authors concluded that the specific polymorphism C296T/Pro99Leu has no role in cervical cancer.

This is a very clean and straight forward study which could not find any link between TLR9 polymorphism and cervical cancer. The data and the figures presented including PCR and PCR-RFLP and sequencing pictures are excellent and convincing. However, there are few points which need to be clarified/corrected before the manuscript is accepted and indexed. My comments are as follows:

The whole study is based on only one TLR9 gene polymorphism. Authors need to very clearly justify their choice of TLR9, and not other TLRs in Introduction as well as in the Discussion.
It is well established that the causative agent for cervical cancer is due to infection of specific types of high risk Human papillomaviruses. Any study on cervical cancer demands for an obvious correlation/association with HPV status of the cervical cancer. If at all no HPV analysis has been done, the authors must discuss this in the Discussion.
There are several English and grammatical errors throughout the manuscript. Authors need to carefully re-read the manuscript and correct the manuscript. Few obvious errors are indicated here:-
i) Methods: 3^rd line: reaction and restriction fragment length
ii)Conclusion: 1^st line – the present study demonstrates no involvement – (delete ‘results’), 3^rd line – delete ‘worldwide’ and in 4^th line – delete ‘participants’, replace it with ‘subjects
iii)Table 1 last column below Visualized on: write 2% Agarose gel.
Data set 3: delete ‘unedited’.

In summary, the manuscript may be accepted for indexing after the authors made the minor revision of the manuscript as suggested above.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 30 Aug 2018

Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India

30 Aug 2018

Author Response

Dear Prof. B. C. Das,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation 1: The ... Continue reading Dear Prof. B. C. Das,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation 1: The whole study is based on only one TLR9 gene polymorphism. Authors need to very clearly justify their choice of TLR9, and not other TLRs in Introduction as well as in the Discussion.
Response: The choice of TLR9 is based on the fact that it recognized HPV16 DNA which is a main causative agent of cervical cancer. As suggested this has been included in the introduction as well as discussion.

Reservation 2: It is well established that the causative agent for cervical cancer is due to infection of specific types of high risk Human papillomaviruses. Any study on cervical cancer demands for an obvious correlation/association with HPV status of the cervical cancer. If at all no HPV analysis has been done, the authors must discuss this in the Discussion.
Response 2: We do agree that cervical cancer is mainly caused by the infection of hrHPVs. We found approximately 70% of our cases with HPV positivity, that has been incorporated in the discussion. The details of HPV infection will be published elsewhere.

Reservation 3: There are several English and grammatical errors throughout the manuscript. Authors need to carefully re-read the manuscript and correct the manuscript. Few obvious errors are indicated here:-
i) Methods: 3rd line: reaction and restriction fragment length
ii)Conclusion: 1st line – the present study demonstrates no involvement – (delete ‘results’), 3rd line – delete ‘worldwide’ and in 4th line – delete ‘participants’, replace it with ‘subjects
iii)Table 1 last column below Visualized on: write 2% Agarose gel.
Response 3: The above mentioned suggestions have been incorporated.

Reservation 4: Data set 3: delete ‘unedited’.
Response 4: Deleted.
Dear Prof. B. C. Das,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation 1: The whole study is based on only one TLR9 gene polymorphism. Authors need to very clearly justify their choice of TLR9, and not other TLRs in Introduction as well as in the Discussion.
Response: The choice of TLR9 is based on the fact that it recognized HPV16 DNA which is a main causative agent of cervical cancer. As suggested this has been included in the introduction as well as discussion.

Reservation 2: It is well established that the causative agent for cervical cancer is due to infection of specific types of high risk Human papillomaviruses. Any study on cervical cancer demands for an obvious correlation/association with HPV status of the cervical cancer. If at all no HPV analysis has been done, the authors must discuss this in the Discussion.
Response 2: We do agree that cervical cancer is mainly caused by the infection of hrHPVs. We found approximately 70% of our cases with HPV positivity, that has been incorporated in the discussion. The details of HPV infection will be published elsewhere.

Reservation 3: There are several English and grammatical errors throughout the manuscript. Authors need to carefully re-read the manuscript and correct the manuscript. Few obvious errors are indicated here:-
i) Methods: 3rd line: reaction and restriction fragment length
ii)Conclusion: 1st line – the present study demonstrates no involvement – (delete ‘results’), 3rd line – delete ‘worldwide’ and in 4th line – delete ‘participants’, replace it with ‘subjects
iii)Table 1 last column below Visualized on: write 2% Agarose gel.
Response 3: The above mentioned suggestions have been incorporated.

Reservation 4: Data set 3: delete ‘unedited’.
Response 4: Deleted.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 30 Aug 2018

Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India

30 Aug 2018

Author Response

Dear Prof. B. C. Das,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation 1: The ... Continue reading Dear Prof. B. C. Das,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation 1: The whole study is based on only one TLR9 gene polymorphism. Authors need to very clearly justify their choice of TLR9, and not other TLRs in Introduction as well as in the Discussion.
Response: The choice of TLR9 is based on the fact that it recognized HPV16 DNA which is a main causative agent of cervical cancer. As suggested this has been included in the introduction as well as discussion.

Reservation 2: It is well established that the causative agent for cervical cancer is due to infection of specific types of high risk Human papillomaviruses. Any study on cervical cancer demands for an obvious correlation/association with HPV status of the cervical cancer. If at all no HPV analysis has been done, the authors must discuss this in the Discussion.
Response 2: We do agree that cervical cancer is mainly caused by the infection of hrHPVs. We found approximately 70% of our cases with HPV positivity, that has been incorporated in the discussion. The details of HPV infection will be published elsewhere.

Reservation 3: There are several English and grammatical errors throughout the manuscript. Authors need to carefully re-read the manuscript and correct the manuscript. Few obvious errors are indicated here:-
i) Methods: 3rd line: reaction and restriction fragment length
ii)Conclusion: 1st line – the present study demonstrates no involvement – (delete ‘results’), 3rd line – delete ‘worldwide’ and in 4th line – delete ‘participants’, replace it with ‘subjects
iii)Table 1 last column below Visualized on: write 2% Agarose gel.
Response 3: The above mentioned suggestions have been incorporated.

Reservation 4: Data set 3: delete ‘unedited’.
Response 4: Deleted.
Dear Prof. B. C. Das,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation 1: The whole study is based on only one TLR9 gene polymorphism. Authors need to very clearly justify their choice of TLR9, and not other TLRs in Introduction as well as in the Discussion.
Response: The choice of TLR9 is based on the fact that it recognized HPV16 DNA which is a main causative agent of cervical cancer. As suggested this has been included in the introduction as well as discussion.

Reservation 2: It is well established that the causative agent for cervical cancer is due to infection of specific types of high risk Human papillomaviruses. Any study on cervical cancer demands for an obvious correlation/association with HPV status of the cervical cancer. If at all no HPV analysis has been done, the authors must discuss this in the Discussion.
Response 2: We do agree that cervical cancer is mainly caused by the infection of hrHPVs. We found approximately 70% of our cases with HPV positivity, that has been incorporated in the discussion. The details of HPV infection will be published elsewhere.

Reservation 3: There are several English and grammatical errors throughout the manuscript. Authors need to carefully re-read the manuscript and correct the manuscript. Few obvious errors are indicated here:-
i) Methods: 3rd line: reaction and restriction fragment length
ii)Conclusion: 1st line – the present study demonstrates no involvement – (delete ‘results’), 3rd line – delete ‘worldwide’ and in 4th line – delete ‘participants’, replace it with ‘subjects
iii)Table 1 last column below Visualized on: write 2% Agarose gel.
Response 3: The above mentioned suggestions have been incorporated.

Reservation 4: Data set 3: delete ‘unedited’.
Response 4: Deleted.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Views

Reviewer Report 23 Jul 2018

Balraj Mittal, Department of Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow, India

Not Approved

https://doi.org/10.5256/f1000research.16153.r35718

The basic assumption of genetic epidemiology is that two alleles of a gene are present in the population and one of the allele (usually minor) has altered frequency in cases and controls. However, if a gene is mono-morphic as is the case here for TLR9C296T, then it is non-informative and there is no point to look for its association.

Therefore, the very basis of study is wrong, even though it has been carried out technically correct.

I therefore feel that this publication will not anything the present knowledge.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

CITE

Report a concern

Respond or Comment

Views

Reviewer Report 25 Jun 2018

Gopeshwar Narayan, Department of Molecular and Human Genetics, Banaras Hindu University, Varanasi, India

Approved with Reservations

https://doi.org/10.5256/f1000research.16153.r34771

With the global minor allele frequency of 0.0002, the studied sample size is too small. It is interesting to observe that there is only one genotype (homozygous wild type) present in the studied cohort. The power of the study should be mentioned by the authors. The conclusion drawn from the limited data set may not reflect the real situation. I suggest the authors to first calculate the number of samples required for the study on the basis of the frequency of minor/major alleles to achieve about 80% power of study and increase the sample size accordingly.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

CITE

Report a concern

Author Response 29 Jun 2018

Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India

29 Jun 2018

Author Response

Dear Dr. Gopeshwar Narayan,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation: With the global ... Continue reading Dear Dr. Gopeshwar Narayan,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation: With the global minor allele frequency of 0.0002, the studied sample size is too small. It is interesting to observe that there is only one genotype (homozygous wild type) present in the studied cohort. The power of the study should be mentioned by the authors. The conclusion drawn from the limited data set may not reflect the real situation. I suggest the authors first to calculate the number of samples required for the study on the basis of the frequency of minor/major alleles to achieve about 80% power of study and increase the sample size accordingly.

Response: Due to the complete absence of minor allele, the power of present study cannot be calculated. However, considering the global minor allele frequency of 0.0002 of the SNP, we calculated the power of study using Online Sample Size Estimator which was found to be 3.6%. To achieve 80% power of study approximately 40000 cases and controls are required. It is presently not possible for us to collect and analyze such a larger sample size. Studies on Pro99Leu polymorphism with similar sample size and results have also been reported by Kubarenko et al., 2010 and Lee et al., 2006, which have been cited in the article.
Dear Dr. Gopeshwar Narayan,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation: With the global minor allele frequency of 0.0002, the studied sample size is too small. It is interesting to observe that there is only one genotype (homozygous wild type) present in the studied cohort. The power of the study should be mentioned by the authors. The conclusion drawn from the limited data set may not reflect the real situation. I suggest the authors first to calculate the number of samples required for the study on the basis of the frequency of minor/major alleles to achieve about 80% power of study and increase the sample size accordingly.

Response: Due to the complete absence of minor allele, the power of present study cannot be calculated. However, considering the global minor allele frequency of 0.0002 of the SNP, we calculated the power of study using Online Sample Size Estimator which was found to be 3.6%. To achieve 80% power of study approximately 40000 cases and controls are required. It is presently not possible for us to collect and analyze such a larger sample size. Studies on Pro99Leu polymorphism with similar sample size and results have also been reported by Kubarenko et al., 2010 and Lee et al., 2006, which have been cited in the article.
Competing Interests: No competing interests were disclosed Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 29 Jun 2018

Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India

29 Jun 2018

Author Response

Dear Dr. Gopeshwar Narayan,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation: With the global ... Continue reading Dear Dr. Gopeshwar Narayan,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation: With the global minor allele frequency of 0.0002, the studied sample size is too small. It is interesting to observe that there is only one genotype (homozygous wild type) present in the studied cohort. The power of the study should be mentioned by the authors. The conclusion drawn from the limited data set may not reflect the real situation. I suggest the authors first to calculate the number of samples required for the study on the basis of the frequency of minor/major alleles to achieve about 80% power of study and increase the sample size accordingly.

Response: Due to the complete absence of minor allele, the power of present study cannot be calculated. However, considering the global minor allele frequency of 0.0002 of the SNP, we calculated the power of study using Online Sample Size Estimator which was found to be 3.6%. To achieve 80% power of study approximately 40000 cases and controls are required. It is presently not possible for us to collect and analyze such a larger sample size. Studies on Pro99Leu polymorphism with similar sample size and results have also been reported by Kubarenko et al., 2010 and Lee et al., 2006, which have been cited in the article.
Dear Dr. Gopeshwar Narayan,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation: With the global minor allele frequency of 0.0002, the studied sample size is too small. It is interesting to observe that there is only one genotype (homozygous wild type) present in the studied cohort. The power of the study should be mentioned by the authors. The conclusion drawn from the limited data set may not reflect the real situation. I suggest the authors first to calculate the number of samples required for the study on the basis of the frequency of minor/major alleles to achieve about 80% power of study and increase the sample size accordingly.

Response: Due to the complete absence of minor allele, the power of present study cannot be calculated. However, considering the global minor allele frequency of 0.0002 of the SNP, we calculated the power of study using Online Sample Size Estimator which was found to be 3.6%. To achieve 80% power of study approximately 40000 cases and controls are required. It is presently not possible for us to collect and analyze such a larger sample size. Studies on Pro99Leu polymorphism with similar sample size and results have also been reported by Kubarenko et al., 2010 and Lee et al., 2006, which have been cited in the article.
Competing Interests: No competing interests were disclosed Close
Report a concern

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 17 May 2018

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2	3
Version 2 (revision) 30 Aug 18	read	read	read
Version 1 17 May 18	read	read	read

Gopeshwar Narayan, Banaras Hindu University, Varanasi, India
Balraj Mittal, Babasaheb Bhimrao Ambedkar University, Lucknow, India
Bhudev C. Das, University of Delhi, New Delhi, India

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

7 Views

03 Oct 2018 | for Version 2

Gopeshwar Narayan, Department of Molecular and Human Genetics, Banaras Hindu University, Varanasi, India

7 Views Cite this report Responses(0)

Approved

The authors have addressed the issues raised in the previous version.

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

18 Views

13 Sep 2018 | for Version 2

Balraj Mittal, Department of Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow, India

18 Views Cite this report Responses(0)

Not Approved

I had already mentioned in my original review that it is useless to look for association of a monophonic allele with a disease and study has zero statistical power. The only conclusion from the present study is that TLR9 C296T/ Pro99Leu polymorphism appears to be monomorphic in Gujrati Indians. However, it again suffers from low sample size. The person designing such study has to understand the basic tenets of genetic epidemiology. Therefore, I do not feel that the manuscript deserves indexing.

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

14 Views

04 Sep 2018 | for Version 2

Bhudev C. Das, Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, New Delhi, India

14 Views Cite this report Responses(0)

Approved

I have gone through the revised manuscript entitled "Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer" submitted by Alex Chauhan et al. The authors have revised the manuscript satisfactorily and answered all the queries therein. The English corrections that I asked for has been incorporated in the revised manuscript and I now recommend final acceptance of the manuscript for indexing of the article.

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

23 Views

02 Aug 2018 | for Version 1

Bhudev C. Das, Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, New Delhi, India

23 Views Cite this report Responses(1)

Approved With Reservations

The whole study is based on only one TLR9 gene polymorphism. Authors need to very clearly justify their choice of TLR9, and not other TLRs in Introduction as well as in the Discussion.
It is well established that the causative agent for cervical cancer is due to infection of specific types of high risk Human papillomaviruses. Any study on cervical cancer demands for an obvious correlation/association with HPV status of the cervical cancer. If at all no HPV analysis has been done, the authors must discuss this in the Discussion.
There are several English and grammatical errors throughout the manuscript. Authors need to carefully re-read the manuscript and correct the manuscript. Few obvious errors are indicated here:-
i) Methods: 3^rd line: reaction and restriction fragment length
ii)Conclusion: 1^st line – the present study demonstrates no involvement – (delete ‘results’), 3^rd line – delete ‘worldwide’ and in 4^th line – delete ‘participants’, replace it with ‘subjects
iii)Table 1 last column below Visualized on: write 2% Agarose gel.
Data set 3: delete ‘unedited’.

In summary, the manuscript may be accepted for indexing after the authors made the minor revision of the manuscript as suggested above.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (1)

Author Response

30 Aug 2018

Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India

Dear Prof. B. C. Das,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation 1: The whole study is based on only one TLR9 gene polymorphism. Authors need to very clearly justify their choice of TLR9, and not other TLRs in Introduction as well as in the Discussion.
Response: The choice of TLR9 is based on the fact that it recognized HPV16 DNA which is a main causative agent of cervical cancer. As suggested this has been included in the introduction as well as discussion.

Reservation 2: It is well established that the causative agent for cervical cancer is due to infection of specific types of high risk Human papillomaviruses. Any study on cervical cancer demands for an obvious correlation/association with HPV status of the cervical cancer. If at all no HPV analysis has been done, the authors must discuss this in the Discussion.
Response 2: We do agree that cervical cancer is mainly caused by the infection of hrHPVs. We found approximately 70% of our cases with HPV positivity, that has been incorporated in the discussion. The details of HPV infection will be published elsewhere.

Reservation 3: There are several English and grammatical errors throughout the manuscript. Authors need to carefully re-read the manuscript and correct the manuscript. Few obvious errors are indicated here:-
i) Methods: 3rd line: reaction and restriction fragment length
ii)Conclusion: 1st line – the present study demonstrates no involvement – (delete ‘results’), 3rd line – delete ‘worldwide’ and in 4th line – delete ‘participants’, replace it with ‘subjects
iii)Table 1 last column below Visualized on: write 2% Agarose gel.
Response 3: The above mentioned suggestions have been incorporated.

Reservation 4: Data set 3: delete ‘unedited’.
Response 4: Deleted.

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

34 Views

23 Jul 2018 | for Version 1

Balraj Mittal, Department of Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow, India

34 Views Cite this report Responses(0)

Not Approved

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

30 Views

25 Jun 2018 | for Version 1

Gopeshwar Narayan, Department of Molecular and Human Genetics, Banaras Hindu University, Varanasi, India

30 Views Cite this report Responses(1)

Approved With Reservations

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (1)

Author Response

29 Jun 2018

Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India

Dear Dr. Gopeshwar Narayan,

We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

Reservation: With the global minor allele frequency of 0.0002, the studied sample size is too small. It is interesting to observe that there is only one genotype (homozygous wild type) present in the studied cohort. The power of the study should be mentioned by the authors. The conclusion drawn from the limited data set may not reflect the real situation. I suggest the authors first to calculate the number of samples required for the study on the basis of the frequency of minor/major alleles to achieve about 80% power of study and increase the sample size accordingly.

Response: Due to the complete absence of minor allele, the power of present study cannot be calculated. However, considering the global minor allele frequency of 0.0002 of the SNP, we calculated the power of study using Online Sample Size Estimator which was found to be 3.6%. To achieve 80% power of study approximately 40000 cases and controls are required. It is presently not possible for us to collect and analyze such a larger sample size. Studies on Pro99Leu polymorphism with similar sample size and results have also been reported by Kubarenko et al., 2010 and Lee et al., 2006, which have been cited in the article.

View more View less

Competing Interests

No competing interests were disclosed

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

Click here to access the data.

Downloaded data do not display as expected? Download the data

Click here to access the data.

Downloaded data do not display as expected? Download the data

Click here to access the data.

Downloaded data do not display as expected? Download the data

Click here to access the data.

Downloaded data do not display as expected? Download the data

[1] 1. Ferlay J, Soerjomataram I , Dikshit R, et al.: Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 2015; 136(5): E359–386. PubMed Abstract | Publisher Full Text

[2] 2. Walboomers JM, Jacobs MV, Manos MM, et al.: Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol. 1999; 189(1): 12–9. PubMed Abstract | Publisher Full Text

[3] 3. Chattopadhyay K: A comprehensive review on host genetic susceptibility to human papillomavirus infection and progression to cervical cancer. Indian J Hum Genet. 2011; 17(3): 132–44. PubMed Abstract | Publisher Full Text | Free Full Text

[4] 4. Leo PJ, Madeleine MM, Wang S, et al.: Defining the genetic susceptibility to cervical neoplasia-A genome-wide association study. PLoS Genet. 2017; 13(8): e1006866. PubMed Abstract | Publisher Full Text | Free Full Text

[5] 5. Kumar H, Kawai T, Akira S: Toll-like receptors and innate immunity. Biochem Biophys Res Commun. 2009; 388(4): 621–5. PubMed Abstract | Publisher Full Text

[6] 6. Schröder NW, Schumann RR: Single nucleotide polymorphisms of Toll-like receptors and susceptibility to infectious disease. Lancet Infect Dis. 2005; 5(3): 156–64. PubMed Abstract | Publisher Full Text

[7] 7. Misch EA, Hawn TR: Toll-like receptor polymorphisms and susceptibility to human disease. Clin Sci (Lond). 2008; 114(5): 347–60. PubMed Abstract | Publisher Full Text

[8] 8. El-Omar EM, Ng MT, Hold GL: Polymorphisms in Toll-like receptor genes and risk of cancer. Oncogene. 2008; 27(2): 244–52. PubMed Abstract | Publisher Full Text

[9] 9. Gomaz AN: The polymorphisms in Toll-like receptor genes and cancer risk. 2012; 114(4): 461–9. Reference Source

[10] 10. Kawai T, Akira S: Toll-like receptor and RIG-I-like receptor signaling. Ann N Y Acad Sci. 2008; 1143: 1–20. PubMed Abstract | Publisher Full Text

[11] 11. Hemmi H, Takeuchi O, Kawai T, et al.: A Toll-like receptor recognizes bacterial DNA. Nature. 2001; 408(6813): 740–5. PubMed Abstract | Publisher Full Text

[12] 12. Hasan UA, Bates E, Takeshita F, et al.: TLR9 expression and function is abolished by the cervical cancer-associated human papillomavirus type 16. J Immunol. 2007; 178(5): 3186–97. PubMed Abstract | Publisher Full Text

[13] 13. Roszak A, Lianeri M, Sowińska A, et al.: Involvement of Toll-like Receptor 9 polymorphism in cervical cancer development. Mol Biol Rep. 2012; 39(8): 8425–30. PubMed Abstract | Publisher Full Text | Free Full Text

[14] 14. Chen X, Wang S, Liu L, et al.: A genetic variant in the promoter region of Toll-like receptor 9 and cervical cancer susceptibility. DNA Cell Biol. 2012; 31(5): 766–71. PubMed Abstract | Publisher Full Text

[15] 15. Martínez-Campos C, Bahena-Román M, Torres-Poveda K, et al.: TLR9 gene polymorphism -1486T/C (rs187084) is associated with uterine cervical neoplasm in Mexican female population. J Cancer Res Clin Oncol. Springer Berlin Heidelberg; 2017; 143(12): 2437–2445. PubMed Abstract | Publisher Full Text

[16] 16. Pandey S, Mittal B, Srivastava M, et al.: Evaluation of Toll-like receptors 3 (c.1377C/T) and 9 (G2848A) gene polymorphisms in cervical cancer susceptibility. Mol Biol Rep. 2011; 38(7): 4715–21. PubMed Abstract | Publisher Full Text

[17] 17. Kubarenko AV, Ranjan S, Rautanen A, et al.: A naturally occurring variant in human TLR9, P99L, is associated with loss of CpG oligonucleotide responsiveness. J Biol Chem. 2010; 285(47): 36486–94. PubMed Abstract | Publisher Full Text | Free Full Text

[18] 18. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. Reference Source

[19] 19. Chauhan A, Pandey N, Raithatha N, et al.: Dataset 1 in: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.14840.d203405

[20] 20. Chauhan A, Pandey N, Raithatha N, et al.: Dataset 2 in: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.14840.d203406

[21] 21. Chauhan A, Pandey N, Raithatha N, et al.: Dataset 3 in: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.14840.d203407

[22] 22. Chauhan A, Pandey N, Raithatha N, et al.: Dataset 4 in: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer. F1000Research. 2018. http://www.doi.org/10.5256/f1000research.14840.d203408

[23] 23. Jin Y, Qiu S, Shao N, et al.: Association of toll-like receptor gene polymorphisms and its interaction with HPV infection in determining the susceptibility of cervical cancer in Chinese Han population. Mamm Genome. Springer US; 2017; 28(5–6): 213–9. PubMed Abstract | Publisher Full Text

[24] 24. Lai ZZ, Ni-Zhang, Pan XL: Toll-like receptor 9 (TLR9) gene polymorphisms associated with increased susceptibility of human papillomavirus-16 infection in patients with cervical cancer. J Int Med Res. 2013; 41(4): 1027–36. PubMed Abstract | Publisher Full Text

[25] 25. Lee PL, West C, Crain K, et al.: Genetic polymorphisms and susceptibility to lung disease. J Negat Results Biomed. 2006; 5: 5. PubMed Abstract | Publisher Full Text | Free Full Text

Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer

Abstract

Keywords

Revised Amendments from Version 1

Introduction

Methods

Biological specimens

DNA isolation and genetic analysis

Table 1. Details of TLR9 C296T/ Pro99Leu specific PCR.

Table 2. Parameters for genotypes consideration of TLR9 C296T/ Pro99Leu polymorphism.

Statistical analysis

Results

Demographic and clinical characteristics

TLR9 Pro99Leu polymorphism

Figure 1. Representative PCR picture showing amplification of TLR9 gene segment for C296T/ Pro99Leu gene polymorphism on ethidium bromide-stained 2% agarose gel.

Table 3. Genotype and allele frequencies of TLR9 C296T/ Pro99Leu polymorphism in cervical cancer patients and healthy controls.

Figure 2. Representative PAGE picture of RFLP results for TLR9 C296T/ Pro99Leu polymorphism on 12% polyacrylamide gel.

Figure 3.

Discussion

Conclusion

Data availability

Ethical considerations

Grant information

Acknowledgement

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

The problem

How to fix it

The problem

How to fix it

The problem

How to fix it

The problem

How to fix it

Competing Interests Policy

Stay Updated