ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer

[version 2; peer review: 2 approved, 1 not approved]
PUBLISHED 30 Aug 2018
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Background: Toll-like receptor 9 (TLR9) plays a key role in the elimination of viral pathogens by recognising their CpG DNA. Polymorphisms in the TLR9 gene may influence their recognition and subsequent elimination. Therefore, the present study was designed to elucidate the role of a rare unexplored TLR9 gene polymorphism C296T/ Pro99Leu (rs5743844) in cervical cancer susceptibility among Indian women.
Methods: The genotyping of TLR9 Pro99Leu polymorphism in 110 cervical cancer patients and 141 healthy controls was performed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP).
Results: The genotype frequency detected in both cervical cancer and control populations was 1.0 (CC), 0.0 (CT) and 0.0 (TT); while the allele frequency was found to be 1.0 (C) and 0.0 (T).
Conclusions: The present study demonstrates no involvement of TLR9 C296T/ Pro99Leu polymorphism in cervical cancer susceptibility and supports minor allele frequency (MAF) (0.0002) status of the same as no nucleotide variation was detected in any of the study subjects.

Keywords

Cervical cancer, TLR9, Polymorphism, Genotypic frequency, Susceptibility

Revised Amendments from Version 1

This version has been modified based on the reservations given by Dr. Gopeshwar Narayan and Prof. B. C. Das. The previous version of this article did not include the power calculation. In this version, we have calculated the statistical power based on the global minor allele frequency of the polymorphism under study and have drawn appropriate conclusions. The reason for the selection of TLR9 gene for this study has been mentioned in the Introduction as well as in the Discussion.

See the authors' detailed response to the review by Gopeshwar Narayan
See the authors' detailed response to the review by Bhudev C. Das

Introduction

Cervical cancer is the fourth-most common cancer among women globally and second leading cause of cancer-related deaths in Indian women1. Although persistent infection of high-risk human papillomavirus (hrHPV) is considered as the chief causative agent of cervical cancer, variations in host genetic make-up does influence the risk of acquiring HPV infection, and susceptibility to cervical carcinogenesis24. In this context, variations in Toll-like receptor (TLR) genes, that play a crucial role in activating immune response by identifying pathogen-associated molecular patterns (PAMPs), have drawn significant attention, as single nucleotide polymorphisms (SNPs) in TLR genes have been shown to alter susceptibility to many infections and human diseases including cancer58.

Ten functional TLR genes are known in humans, the products of which recognizes specific PAMPs9. TLR1, TLR2, TLR4, TLR5 and TLR6 which are located on the cell surface of immune cells are known to recognize triacyl lipopeptides, peptidoglycans, lipopolysaccharides, flagellin and diacyl lipopeptides respectively that belong to bacterial cell wall or virus particles10,11. On the other hand TLR3, TLR7, TLR8 and TLR9 are located in the endosomal compartments, wherein TLR3 recognizes single as well as double stranded viral RNA, TLR7 recognizes ssRNA from viruses while the TLR9 gene product recognizes bacterial and viral DNA motifs including HPV16 CpG motifs5,1012. Frequently analysed TLR9 SNPs G2848A and −1486 T/C have been suggested to alter cervical cancer susceptibility1316, but no report is available elucidating the role of TLR9 Pro99Leu polymorphism in cancer. Although TLR9 Pro99Leu is a rare population SNP with a global minor allele frequency (MAF) of 0.0002 as reported in the single nucleotide polymorphism database (dbSNP), in-vitro analysis has revealed its significant role in DNA ligand hyporesponsiveness17. Considering the fact that cervical cancer is largely caused by hrHPV infection and TLR9 has the ability to respond to viral DNA, while other TLRs do not, the present study was designed to elucidate the association of the TLR9 Pro99Leu polymorphism with cervical cancer.

Methods

Biological specimens

Biopsies from 110 cervical cancer patients and cervical smears from 141 healthy volunteers were collected from Shree Krishna Hospital, Anand; Sir Sayajirao General Hospital, Vadodara; and GMERS Hospital, Ahmedabad, India. The samples were collected from 2012 to 2017. The cancer biopsies and healthy cervical smears were histopathologically and cytologically confirmed. The clinical staging of cervical cancer samples was done as per The International Federation of Gynecology and Obstetrics (FIGO) guidelines.

DNA isolation and genetic analysis

DNA was isolated from cervical cancer biopsies and cervical smears by standard phenol-chloroform extraction method18. In the case of a low number of cervical cells, a spin-column based DNA isolation kit (Macherey-Nagel, Germany; Cat# 740952.50) was utilized as per manufacturer’s instructions. The quality and quantity of DNA was determined using ethidium bromide-stained 1% agarose gel on GelDoc system (BioRad, USA) as well as a NanoDrop 2000 (Thermofisher, USA). The TLR9 Pro99Leu polymorphism was detected using polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method as described by Kubarenko et al.17 Briefly, a 25µl PCR mix contained 0.1µM each of forward and reverse primer (Imperial Life Sciences, India), 0.1mM dNTP mix (Invitrogen, USA; Cat# 18427088), 2.5mM MgCl2 (Vivantis, USA; Cat# RB0204), 1 unit Taq DNA polymerase (Kapabiosystems, USA; Cat# KK1015) and 100 to 150ng genomic DNA. The PCR was run on an MJ Mini thermal cycler (BioRad, USA).

Upon confirmation of 337 bp PCR product on 2% ethidium bromide-stained agarose gel, 10µl PCR product was digested with BslI restriction enzyme (New England Biolabs, USA; Cat# R0555S) at 55°C overnight, separated on 12% polyacrylamide gel and analysed on a GelDoc system (BioRad, USA) for genotype identification. The details of PCR conditions and parameters for genotype consideration are mentioned in Table 1 and Table 2 respectively. To confirm the PCR-RFLP results, we performed Sanger sequencing of five randomly selected cervical cancer as well as control samples. All the sequencing reactions were performed on 3730xl DNA Analyzer (Applied Biosystems, USA) using BigDye™ Terminator v3.1 kit (Applied Biosystems, USA; Cat# 4337454) as per manufacturer’s instructions. The 10µl sequencing reaction was comprised of 7.0µl BigDye™ Terminator v3.1 Ready Reaction Mix, 10pmol forward primer and 50ng PCR product. The sequencing results were analyzed on Sequencing Analysis Software version 5.3.1 (Applied Biosystems, USA).

Table 1. Details of TLR9 C296T/ Pro99Leu specific PCR.

Primer Sequence (5′ – 3′)Thermal ProfilePCR
Product
Visualized
on
FP: GGATGTTGGTATGGCTGAGG
RP: AACTGCAACTGGCTGTTCCT
(95°C – 5′) 1
(95°C – 45″, 56°C – 1′, 72°C – 30″) 35
(72°C – 10′) 1
337 bp2% Agarose Gel

Abbreviations: TLR9, Toll-like receptor 9; FP, forward Primer; RP, Reverse Primer; PCR, Polymerase Chain Reaction; bp, base pairs

Table 2. Parameters for genotypes consideration of TLR9 C296T/ Pro99Leu polymorphism.

EnzymeDigested Products (bp)Genotype
BslI166 + 136 + 35CC (Pro/Pro)
201 + 166 + 136 + 35CT (Pro/Leu)
201 + 136TT (Leu/Leu)

Statistical analysis

Statistical analysis was performed on GraphPad Prism version 5.00 for Windows (GraphPad Software, USA). Age of patients and controls were compared using two-sided Student's t-test. Due to the presence of single genotype across all the samples no additional statistical association was performed. The power of the study was calculated using Online Sample Size Estimator.

Results

Demographic and clinical characteristics

The average age of cervical cancer patients (52.43±11.78 years) and controls (51.8±11.35 years) was comparable without any statistically significant difference (p=0.668). Histopathologic analysis revealed all the cervical cancer cases to be of squamous cell carcinoma type. According to FIGO analysis, 9 (8.2%), 39 (35.5%), 55 (50%) and 7 (6.3%) patients belonged to Stage I, II, III and IV respectively. In the absence of polymorphic allele in the present population we calculated the power of the study based on the global minor allele frequency (0.0002) which was found to be 3.6%.

TLR9 Pro99Leu polymorphism

PCR amplification revealed the presence of a single intact band of 337 bp (Figure 1; Dataset 119). A single genotype CC (Pro/Pro) was detected across all the sample types (Table 3; Dataset 220) which was evident by the presence of 166 bp, 136 bp and 35 bp DNA bands after RFLP assay (Figure 2; Dataset 321). Sanger sequencing of the randomly selected PCR products corroborated with RFLP results (Figure 3; Dataset 422).

3ee455f8-11ba-4cc1-ba85-be51633f09e3_figure1.gif

Figure 1. Representative PCR picture showing amplification of TLR9 gene segment for C296T/ Pro99Leu gene polymorphism on ethidium bromide-stained 2% agarose gel.

Lane M is 100 bp molecular marker (Takara, Japan; Cat# RR820A), Lane 1 is negative control and Lanes 2–7 are tumor DNA showing PCR products of 337 bp. (Abbreviations: PCR, Polymerase Chain Reaction; TLR9, Toll-like receptor 9; bp, base pair).

Table 3. Genotype and allele frequencies of TLR9 C296T/ Pro99Leu polymorphism in cervical cancer patients and healthy controls.

GenotypeCervical Cancer
n (%)
Controls
n (%)
CC110 (100.0)141 (100.0)
CT0 (0.0)0 (0.0)
TT0 (0.0)0 (0.0)
Allele
C220 (100.0)282 (100.0)
T0 (0.0)0 (0.0)
3ee455f8-11ba-4cc1-ba85-be51633f09e3_figure2.gif

Figure 2. Representative PAGE picture of RFLP results for TLR9 C296T/ Pro99Leu polymorphism on 12% polyacrylamide gel.

Lane M is 100 bp molecular marker, Lane 1 is undigested PCR product and Lanes 2 to 6 are showing digested PCR products of 166 bp and 136 bp (35 bp band is not visible) by BslI enzyme representing CC genotype. (Abbreviations: PAGE, Polyacrylamide Gel Electrophoresis; RFLP, Restriction Fragment Length Polymorphism).

3ee455f8-11ba-4cc1-ba85-be51633f09e3_figure3.gif

Figure 3.

Sanger sequence electropherogram of (A) a healthy individual and (B) patient showing single peak (highlighted) of C allele of TLR9 C296T/ Pro99Leu SNP representing CC genotype. (Abbreviations: SNP, Single Nucleotide Polymorphism).

Dataset 1.Raw agarose gel images of PCR amplification of TLR9 gene segment for C296T/ Pro99Leu polymorphism from 50 samples consisting of 26 controls and 24 cervical cancer cases.
Figure 1 is a representative picture of the same.
Dataset 2.Age, clinical stage and TLR9 genotype status among cervical cancer patients as well as age and TLR9 genotype status among controls.
Dataset 3.Raw polyacrylamide gel electrophoresis images of 27 controls and 24 cervical cancer PCR amplified products that underwent restriction fragment length polymorphism (RFLP) analysis.
Figure 2 is a representative picture of the same.
Dataset 4.Nucleotide sequences spanning TLR9 gene segment for C296T single nucleotide polymorphism, obtained after performing Sanger sequencing on five samples each of cervical cancer and healthy controls.
The sequencing results confirm the restriction fragment length polymorphism (RFLP) analysis that represents single genotype CC among all the study subjects. Figure 3A and B are representative electropherograms of the TLR9 C296T CC genotype as evident by the presence of single peak of C allele.

Discussion

Although hrHPV infection is the primary etiological agent of cervical carcinogenesis, the role of host genetic factors, especially those associated with body immunity such as TLRs, cannot be ignored. TLR9 which recognizes CpG DNA motifs from bacteria and viruses has also been reported to recognize HPV16 CpG DNA12. Moreover, variations in the TLR9 gene has found associations with various diseases including cancer. TLR9 SNPs −1486 T/C and G2848A have been found to be contradictorily associated with cervical cancer risk. In Polish and Mexican populations both TLR9 −1486 T/C and G2848A polymorphisms were suggested to be risk factors for cervical carcinogenesis13,15. In two independent studies on Chinese population, a positive association with TLR9 G2848A SNP was detected23,24 but no involvement of TLR9 −1486 T/C was found24, however, the other study suggested −1486 T/C was not a contributory factor to cervical carcinogenesis14. From India, a single report on North Indian patients revealed a marginal role of TLR9 G2848A polymorphism with cervical cancer risk16.

To date, no report is available on the rare TLR9 Pro99Leu polymorphism in cancer, which has been shown to be associated with DNA ligand hyporesponsiveness in HeLa cell lines17. Considering the fact that cervical cancer is majorly caused by hrHPV infection and the TLR9 Pro99Leu polymorphism is associated with DNA ligand hyporesponsiveness, the present study investigated, for the first time, the role of the TLR9 Pro99Leu polymorphism in cervical cancer susceptibility. This is also the first report to study this polymorphism in any of the cancer types globally. Our results revealed the presence of a single genotype CC (Pro/Pro) among cases and controls, demonstrating no significance of the Pro99Leu polymorphism to cervical cancer susceptibility. Similarly, no association with high-risk HPV infection, that was detected in almost 70% of the patients, was found (details of HPV infection to be published elsewhere). A complete absence of Pro99Leu in our study population corroborates with the report of Lee and group (2006) where neither controls nor lung tuberculosis and sarcoidosis patients had the TLR9 Pro99Leu polymorphism25. Similarly, the Pro99Leu polymorphism was not detected among healthy Caucasians as well as pneumococcal disease, bacteraemia, and leprosy patients17. Moreover, according to dbSNP, the global MAF of this polymorphism is 0.0002, and our results, albeit on a smaller cohort, do solicit its rare polymorphism status. Therefore, owing to sample size constraint, it would be inappropriate to draw a direct conclusion of the effect of above-said polymorphism on the susceptibility to cervical cancer. As the power of study calculated based on the global MAF was very low (3.6%), and to achieve a power of study of 80%, approximately 40000 samples will be required to analyze. Finally, under present scenario, a direct role of this SNP in cancer, as well as other diseases, seems a remote possibility. Nonetheless, a comprehensive analysis of a larger cohort covering a varied ethnic population globally is suggested to comprehend its role in microbial infection and/or disease susceptibility including cancer.

Conclusion

The preliminary data obtained from the present study does not suggest a role for the TLR9 Pro99Leu polymorphism in cervical cancer susceptibility. However, analysis on a larger cohort worldwide may provide more insights into the frequency distribution of Pro99Leu polymorphism and reveal its influential role in various human diseases including cancer.

Data availability

Dataset 1. Raw agarose gel images of PCR amplification of TLR9 gene segment for C296T/ Pro99Leu polymorphism from 50 samples consisting of 26 controls and 24 cervical cancer cases. Figure 1 is a representative picture of the same. 10.5256/f1000research.14840.d20340519

Dataset 2. Age, clinical stage and TLR9 genotype status among cervical cancer patients as well as age and TLR9 genotype status among controls. 10.5256/f1000research.14840.d20340620

Dataset 3. Raw polyacrylamide gel electrophoresis images of 27 controls and 24 cervical cancer PCR amplified products that underwent restriction fragment length polymorphism (RFLP) analysis. Figure 2 is a representative picture of the same. 10.5256/f1000research.14840.d20340721

Dataset 4. Nucleotide sequences spanning TLR9 gene segment for C296T single nucleotide polymorphism, obtained after performing Sanger sequencing on five samples each of cervical cancer and healthy controls. The sequencing results confirm the restriction fragment length polymorphism (RFLP) analysis that represents single genotype CC among all the study subjects. Figure 3 A and B are representative electropherograms of the TLR9 C296T CC genotype as evident by the presence of single peak of C allele. 10.5256/f1000research.14840.d20340822

Ethical considerations

The research was carried out following due approval from ethics committee of all the participating institutes. Subjects were verbally informed and explained about the study, and were provided with an information sheet. Written informed consent was obtained from the subjects who agreed to enrol in the present study. Personal information of all the study subjects was kept confidential.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 17 May 2018
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Chauhan A, Pandey N, Raithatha N et al. Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer [version 2; peer review: 2 approved, 1 not approved]. F1000Research 2018, 7:606 (https://doi.org/10.12688/f1000research.14840.2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 30 Aug 2018
Revised
Views
8
Cite
Reviewer Report 03 Oct 2018
Gopeshwar Narayan, Department of Molecular and Human Genetics, Banaras Hindu University, Varanasi, India 
Approved
VIEWS 8
The authors have addressed the ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Narayan G. Reviewer Report For: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer [version 2; peer review: 2 approved, 1 not approved]. F1000Research 2018, 7:606 (https://doi.org/10.5256/f1000research.17000.r39042)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
20
Cite
Reviewer Report 13 Sep 2018
Balraj Mittal, Department of Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow, India 
Not Approved
VIEWS 20
I had already mentioned in my original review that it is useless to look for association of a monophonic allele with a disease and study has zero statistical power. The only conclusion from the present study is that TLR9 C296T/ Pro99Leu polymorphism ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Mittal B. Reviewer Report For: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer [version 2; peer review: 2 approved, 1 not approved]. F1000Research 2018, 7:606 (https://doi.org/10.5256/f1000research.17000.r37741)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
15
Cite
Reviewer Report 04 Sep 2018
Bhudev C. Das,  Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, New Delhi, India 
Approved
VIEWS 15
I have gone through the revised manuscript entitled "Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer" submitted by Alex Chauhan et al. The authors have revised the manuscript satisfactorily and answered all the queries therein. The English corrections ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Das BC. Reviewer Report For: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer [version 2; peer review: 2 approved, 1 not approved]. F1000Research 2018, 7:606 (https://doi.org/10.5256/f1000research.17000.r37740)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 17 May 2018
Views
26
Cite
Reviewer Report 02 Aug 2018
Bhudev C. Das,  Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, New Delhi, India 
Approved with Reservations
VIEWS 26
I have gone through the manuscript entitled “Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer” submitted by Alex Chauhan et al. for its publication in F1000Research. The authors have studied the polymorphisms of Toll-like receptor 9 (TLR9) Pro99Leu ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Das BC. Reviewer Report For: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer [version 2; peer review: 2 approved, 1 not approved]. F1000Research 2018, 7:606 (https://doi.org/10.5256/f1000research.16153.r34120)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 30 Aug 2018
    Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India
    30 Aug 2018
    Author Response
    Dear Prof. B. C. Das,

    We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

    Reservation 1: The ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 30 Aug 2018
    Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India
    30 Aug 2018
    Author Response
    Dear Prof. B. C. Das,

    We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

    Reservation 1: The ... Continue reading
Views
34
Cite
Reviewer Report 23 Jul 2018
Balraj Mittal, Department of Biotechnology, Babasaheb Bhimrao Ambedkar University, Lucknow, India 
Not Approved
VIEWS 34
The basic assumption of genetic epidemiology is that two alleles of a gene are present in the population and one of the allele (usually minor) has altered frequency in cases and controls. However, if a gene is mono-morphic as is ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Mittal B. Reviewer Report For: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer [version 2; peer review: 2 approved, 1 not approved]. F1000Research 2018, 7:606 (https://doi.org/10.5256/f1000research.16153.r35718)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
33
Cite
Reviewer Report 25 Jun 2018
Gopeshwar Narayan, Department of Molecular and Human Genetics, Banaras Hindu University, Varanasi, India 
Approved with Reservations
VIEWS 33
With the global minor allele frequency of 0.0002, the studied sample size is too small. It is interesting to observe that there is only one genotype (homozygous wild type) present in the studied cohort. The power of the study should be mentioned ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Narayan G. Reviewer Report For: Absence of toll-like receptor 9 Pro99Leu polymorphism in cervical cancer [version 2; peer review: 2 approved, 1 not approved]. F1000Research 2018, 7:606 (https://doi.org/10.5256/f1000research.16153.r34771)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 29 Jun 2018
    Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India
    29 Jun 2018
    Author Response
    Dear Dr. Gopeshwar Narayan, 

    We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

    Reservation: With the global ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 29 Jun 2018
    Alex Chauhan, P D Patel Institute of Applied Sciences, Charotar University of Science and Technology, Changa, India
    29 Jun 2018
    Author Response
    Dear Dr. Gopeshwar Narayan, 

    We thank you for approving our manuscript and appreciate your valuable suggestions. Please find below the response towards your reservations:

    Reservation: With the global ... Continue reading

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 17 May 2018
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.