ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Multidrug-resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school-going children in Kibera slum, Kenya

[version 1; peer review: 2 approved with reservations]
PUBLISHED 07 Feb 2020
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Pathogens gateway.

This article is included in the Antimicrobial Resistance collection.

Abstract

Background: The objective of this study was to determine the prevalence of thermophilic Campylobacter spp. in asymptomatic school-going children and establish the antibiotic resistant patterns of the isolates towards the drugs used to treat campylobacteriosis, including macrolides, quinolones and tetracycline. Campylobacter spp. are a leading cause of enteric illness and have only recently shown resistant to antibiotics.
Methods: This study isolated Campylobacter spp., including Campylobacter coli, Campylobacter jejuni and Campylobacter lari, in stool samples from asymptomatic school-going children in one of the biggest urban slums in Kenya. The disc diffusion method using EUCAST breakpoints was used to identify antibiotic-resistant isolates, which were further tested for genes encoding for tetracycline resistances using primer-specific polymerase chain reaction.
Results: In total, 580 stool samples were collected from 11 primary schools considering both gender and age. Subjecting 294 biochemically characterized Campylobacter spp. isolates to genus-specific PCR, 106 (18.27% of stool samples) isolates were confirmed Campylobacter spp. Out of the 106 isolates, 28 (4.83%) were Campylobacter coli, 44 (7.58%) were Campylobacter jejuni while 11 (1.89%) were Campylobacter lari. Campylobacter jejuni had the highest number of isolates that were multi-drug resistant, with 26 out of the 28 tested isolates being resistant to ciprofloxacin (5 mg), nalidixic acid (30 mg), tetracycline (30 mg) and erythromycin (15 mg).
Conclusions: In conclusion, a one-health approach, which considers overlaps in environment, animals and human ecosystems, is recommended in addressing campylobacteriosis in humans, since animals are the main reservoirs and environmental contamination is evident.

Keywords

Multidrug, resistance, Campylobacter, genes, asymptomatic

Introduction

Campylobacter spp. infection is a leading cause of enteric illness1,2, manifesting as mild-to-severe diarrhoea with watery loose stool that is often followed by bloody diarrhoea3. Infections also manifest as meningitis, pneumonia, miscarriage, severe form of Guillain-Barre syndrome (GBS) and reactive arthritis (ReA) and irritable bowel syndrome (IBS)35. Isolation of pathogenic Campylobacter spp. from asymptomatic children would be as a result of the pathogens not expressing the virulence factor cytolethal distending toxin, which is able to induce host cell apoptosis. Pathogenesis could also be influenced by host immune system and pathogens adaptation strategies6. Other factors like motility and chemotaxis affect effective Campylobacter colonization and pathogenesis; these have been shown to vary in mutants7.

Campylobacter spp. are found in the intestinal tract of wild and domestic animals, particularly in birds, asymptomatically as temporal carriers but causing illness in humans3. The bacteria can survive up to five months at -20°C but die off in a few days at room temperature5,8,9. They are vulnerable to air exposure, drying, low pH and heating3. Three species, namely C. jejuni, C. coli and C. lari, account for 99% of human Campylobacter spp. isolates, with C. jejuni contributing 90% of the isolates. C. fetus and C. upsaliensis have also been isolated in humans1012.

Distinguishing between Campylobacter species using phenotypic methods is difficult; however, genotypic methods have been developed that are capable of distinguishing species. This has enabled more elaborate epidemiological understanding of Campylobacteriosis, thus identification of the sources and routes of infection13,14. The use of multiplex PCR methods has resulted in cheap, rapid and sensitive genetic identification procedures15.

It was not until recently that Campylobacter spp. was shown to exhibit multidrug resistance (MDR). Before that, the bacteria were considered to be susceptible16. Tetracycline is one of the antimicrobial agents against which Campylobacter spp. have showed resistance. In Campylobacter spp., tetracycline resistance has been reported to have been mediated by more than one tetracycline resistance (tet) genes. The tet(O) gene is the ribosomal protection protein and plays the primary part in tetracycline resistance in C. jejuni and C. coli17,18. This is transferred as a plasmid encoded gene19 or as non-self-mobile form when transferred through the chromosome17. Similarly, the tet(S) gene is a ribosomal protein gene which is transferable through the same channels like the tet(O) gene. The tet(A) gene encodes the 46 kDa membrane-bound efflux protein. This protein carries tetracycline from the cell membrane and its first known resistance role in Campylobacter spp. was reported in 201416.

In Campylobacter spp. resistance to the antibiotic quinolone is mainly due to a single point mutation in the quinolone resistance determination region of gyrA gene (QRDF)20,21, at amino acid 86 by replacement of Thr by Ile22. Occasionally, mutation in topoisomerase IV (ParC) results to resistance against quinolones. Other amino acids substitutions have been reported by Paddock et al. and others2326. In Campylobacter there has been no documented mutational change to the gyrB subunit gene in relation to resistance against quinolones; however, Piddock et al.22, and Changkwanyeun et al.27 noted that resistance to ciprofloxacin in Campylobacter is mediated by mutations on the gyrA gene.

Methods

Study area and background

The study was carried out at primary schools located at Kibera informal settlement, Nairobi County, Kenya in July 2015. Kibera is located at an altitude of 1670 m above sea level, at latitude 36°50’ east and longitude 1°17’ south, about 140 km south of the equator. Kibera is located 5 km South of Nairobi Central Business District (CBD), the Capital of Kenya. Kibera is divided into 9 official villages. The average living place is 3 m2, with an average of 5 persons per place. The study site presents a population with diverse enteric infections28. In total, 11 primary schools with pupil population ranging from 120 to 189 were randomly sampled and, 40 to 80 stool samples collected from pupils in each school, depending on the school population, making a total of 580 stool samples. With a known prevalence of 40.7% of soil transmitted helminths in school going children in urban Kenya, the formula by Martin et al. (1998) was used to determine the desired minimum sample size. The schools were distributed in five administrative villages, namely Lindi, Silanga, Laini Saba, Gatwekera and Mashimoni. Participants’ parents provided written consent through the care givers. This was done during parents’ school meetings, where parents were informed of the intended study and its benefits, those who agreed their children to participate were issued with consent forms for them to sign and return to their class teacher. Only those who their parents consented participated in the study.

Research clearances were given by National Commission for Science, Technology and Innovation (research clearance permit No. 3756) and ethical clearance (PKU/278/1274) was granted by Kenyatta University Ethical Review Committees.

Campylobacter spp. culture. In the laboratory, 5 g of freshly collected faecal sample was pre-enriched by suspending the faeces in 45 ml buffered peptone water (BPW) (Oxoid, Hampshire, England) and incubating the suspension at 42°C for 18 hours in a 50-ml closed culture tube. The pre-enrichment was inoculated onto modified campylobacter charcoal-cefoperazone deoxycholate (mCCDA) agar plates with supplement (polymyxin B 2500IU, rifampincin 5 mg, trimethoprim 5 mg and cycloheximide 50 mg) using a sterile swab and the plates incubated at 45°C for up to 48 hours under anaerobic conditions. The mCCDA culture media (Oxoid, Hampshire, England) was prepared according to manufacturer’s instructions and stored at 4°C until use. Anaerobic conditions were achieved by adding a 21.3-g sachet of CampyGenTM 3.5 L (Oxoid, Hampshire, England) in an anaerobic jar with the cultures resulting to a maximum of 13.2% O2 within 24 hours and 9.5% CO2 in 1 hours. After 24 hours of incubation, the plates were checked for characteristic growth and plates without growth were re-incubated for an additional 24 hours. Characteristic colonies (grey/white or creamy grey in colour with moist appearance) were examined and counted. Distinct colonies were harvested and tested for oxidase and peroxidase breakdown, by picking a portion of distinct colony with a sterile wire loop and placing it on a drop of 30% hydrogen peroxide on a clean microscope slide. Production of effervescent air bubbles was recorded as peroxidases positive. The same colonies were tested for cytochrome oxidase enzyme production by placing a portion of the test colony onto oxidase paper impregnated with NNN’N’ tetramethyl-p-phenylene-diamine dihydrochloride (Oxoid, Basingstoke, UK). Purple colour change was recorded as positive reaction. Reactive colonies were processed for DNA and a portion stored in skimmed milk at -80°C for further characterization.

DNA preparation from bacteria colonies and multiplex PCR. For DNA preparation, three distinct colonies from pure bacteria cultures were lifted with a sterile wire loop and suspended in 0.5 ml sterile, distilled water. The suspension was boiled for 30 minutes in a water bath. After cooling to room temperature, the preparation was centrifuged at 2000 x g and the supernatant harvested and stored at -20°C until analysis by polymerase chain reaction (PCR). PCR was first undertaken to confirm Campylobacter genus for the isolates after which three specific species were also identified: C. coli, C. jejuni and C. lari. The Campylobacter DNA preparation (2 µl) was amplified in a 25 µl reaction mix by mixing 2.5 µl 10X PCR buffer (Coraload), 0.5 µl dNTPs, 0.125 µl Taq DNA polymerase (Inqaba biotec, Pretoria, South Africa) and 0.1 µl of each specific primer to 10 pmole (Inqaba Biotec, Pretoria, South Africa), 2 µl DNA template and 18.657 µl DNAse/RNAse-free distilled water. The DNA was amplified using a program of initial heating at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 1 minutes, annealing at 56°C for 1 min, extension at 72°C for 1 min with a final extension of 72°C for 10 min using a Veriti 96 wells thermocycler, (Applied Biosystems, model 9902, Singapore) in 0.2-ml PCR tubes. The PCR products were kept at -20°C until gel electrophoresis was done.

The Campylobacter genus-specific primers, C412F and C1228 R, described by Linton et al.29 were used to amplify a 812 bp fragment within the 16S rRNA gene of Campylobacter species using forward primer C412F 5’-GGATGACACTTTTCGGAGC-3’ and reverse primer; C1228R 5’-R-CATTGTAGCACGTGTGTC-3’. Multiplex PCR was carried out for C. jejuni and C. coli with specific primers CjejlpxAF, CjejipxAR (shared by both species) and CcollpxAF, described by Klena et al.15 to amplify 331 bp and 391 bp fragment flanking the lpxA gene. The primer sequences were; CjejlpxAF (forward) 5’-ACAACTTGGTGACGATGTTGTA-3’, CjejipxAR (reverse, shared by CjejlpxA and CcollpxA) 5’-CAATCATGDGCDATATGASAATAHGCCAT-3’ for C. jejuni and for C. coli CcollpxAF (forward) 5’-AGACAAATAAGAGAGAATCAG -3’. The C. lari specific primers were forward primer lpxAC, 5’-AGACAATAAGAGAGAATCAG-3’ and reverse primer lpxARKK2M, 5’CAATCATGDGCDATATGASAATAHGCCAT-3’.

The PCR products were visualized by electrophoresis in a 1.5% agarose (Genetics analysis grade, Fisher Scientific, New Jersey) gel stained with 0.02% ethidium bromide and amplicons identified against molecular marker (50 bp DNA ladder, England Biolab) run alongside the samples.

For confirmation, the positively identified PCR products were submitted for sequencing. The PCR products were fist purified using exonuclease1, shrimp alkaline phosphatase mixture (ExoSAP mix) according to the manufacturer’s instructions. Briefly, this was done by adding 2.5 µl of ExoSAP mix to 10 µl PCR product. The mixture was then incubated at 37°C for 30 minutes and reaction stopped by heating at 95°C for 5 minutes. The clean PCR product was then quantified using a fluorimeter (Qubit 2.0, Invitrogen, USA). The clean DNA was first labelled with BigDye terminator v3.1kit (Applied Biosystem, CA, USA) according to the manufacturer’s instructions and loaded into Genetic Analyzer (ABI 3730 capillary analyser; Applied Biosystems, Foster City, CA, USA) for sequencing. Sequences were obtained in ABI files that were opened and edited to remove unspecific ends using BioEdit version 7.0.4 (Hall, CA, USA) software. Clean sequences were then submitted to NCBI GenBank database and BLASTn program used to test for homology and genetic identity of bacteria isolates.

Antimicrobial sensitivity test (AST) for PCR-confirmed Campylobacter spp.. Campylobacter spp. isolates were phenotypically tested for resistance using selected antimicrobial agents according to European committee on antimicrobial susceptibility testing (EUCAST)30. Only those antibiotics with EUCAST established breakpoints were tested, namely tetracyclines (tetracycline 30 mg), quinolones (ciprofloxacin 5 mg, naladixic acid 30 mg) and macrolides (erythromycin 15mg). Mueller-Hinton agar plates plus 5% de-fibrinated horse blood with 20 mg/L β-nicotinamide adenine dinucleotide Mueller-Hinton fastidious (β-NAD (MH-F)); (Oxoid, Basingstoke, UK) were prepared and dried at 35°C, with the lid removed, for 15 min prior to inoculation to reduce swarming. Inoculum turbidity was adjusted to McFarland 0.5 prior to inoculation. The antibiotic discs were placed on the inoculated plates using a sterile multi-disc dispenser and incubated in a microaerobic environment at 41±1°C for 24 hours. Isolates with insufficient growth after 24 hours of incubation were re-incubated immediately and inhibition zones read after a total of 40–48 hours incubation. The inhibition zones were defined by the point showing no growth when viewed from the front of the plate with the lid removed and with reflected light.

Genotypic characterization of Campylobacter spp. isolates for antimicrobial resistance. The 90 antibiotic resistant, PCR-characterized Campylobacter spp. isolates including; 11 C. lari, 30 C. coli and 49 C. jejuni were selected for demonstration of genes encoding for resistance to tetracyclines. Presence of four tetracycline resistance genes, tet(A), tet(B), tet(C) and tet(O), were tested. Multiplex PCR was carried out as described above. Primers used for amplification of products encoding for the resistant genes to tetracyclines are shown in Table 1.

Table 1. Primers used for identifying tetracyclines encoding genes in selected bacteria isolates.

Primer sequence 5’-3’DirectionPCR
product, bp
genesReference
GTGAAACCCAACATACCCCForward577Tet(A)31
GAAGGCAAGCAGGATGTAGReverse
CCTCAGCTTCTCAACGCGTForward635Tet(B)31
GCACCTTGCTGAGACTCTTReverse
ACTTGGAGCCACTATCGACForward880Tet(C)32
CTACAATCCATGCCAACCCReverse
AACTTAGGCATTCTGGCTCACForward515Tet(O)33
TCCCACTGTTCCATATCGTCAReverse

Results

Of the 580 stool samples collected in 11 schools in Kibera, 294 (51%) were phenotypically characterized as suspect Campylobacter spp. When these isolates were subjected to PCR using genus and species-specific primers, 106 (18%) isolates were confirmed to be Campylobacter spp. Among the 106 isolates, 28 (4.8%) were C. coli, 44 (7.6%) C. jejuni while 11 (1.9%) were C. lari (Figure 1). In total, 23 (4.0%) Campylobacter isolates were not species identified as belonging to C. coli, C. jejuni or C. lari (Table 2).

244b357e-3fcf-48ce-a5d4-35fafaa0d725_figure1.gif

Figure 1. Ethidium bromide stained 1.5% agarose gel electrophoresis of Campylobacter coli (391 bp) and C. jejuni (331 bp) in a multiplex PCR with a 100-bp ladder.

From left to right, lane 1 and 2 positive samples; mixture of Campylobacter jejuni and Campylobacter coli obtained from sequenced laboratory isolates (PHPT 1 &2). Lane 3 negative control: purified water. Lanes 4, 5, 9, 11 and 12: C. jejuni. Lanes 6, 8 and 15: Campylobacter coli. Lanes 7, 10, 13 and 14: negative samples. Lane 16: 100-bp ladder.

Table 2. Molecular characterization by polymerase chain reaction of Campylobacter spp. isolates from school going children’s stool samples.

SchoolC. coliC. jejuniC. lariOther C. spp.Total Campylobacter
spp.
A00058.5% (5/59)
B302321% (8/38)
C00238.1% (5/62)
D670234% (15/44)
E891225% (20/79)
F030121% (4/19)
G5101223% (18/80)
H03119.4% (5/53)
I041017% (5/30)
J562222% (15/69)
K121213% (6/47)
Total28441123106
Prevalence4.8% (28/580)7.6% (44/580)1.9% (11/580)3.9% (23/580)18.3% (106/580)

Antimicrobial sensitivity test (AST) for confirmed Campylobacter spp.

The EUCAST disk diffusion method was used to determine the resistance patterns of only the identified isolates, 68 (C. jejuni, C. coli and C. lari) confirmed by PCR (Table 2). Fifteen isolates were not recovered from storage culture after identification and thus not tested. All of the antibiotics studied had isolates showing resistance towards them, with 96% of isolates resistant to tetracycline (30 mg), 93% to naladixic acid (30 mg) and all the isolates tested resistant to erythromycin (15 mg). The antibiotic that most isolates were sensitive to was ciprofloxacin (5 mg) which still had 84% of the isolates showing resistance (Table 3). Of the four tet genes tested, tet(A) was most frequently identified in 20 (29.1%) of the isolates followed by tet(O) in 8 (11.7%) isolates and tet(C) in only 2 (2.9%) isolates. None of the isolates had more than one tet gene demonstrated. (Table 3).

Table 3. Drug resistant patterns of pathogenic Campylobacter spp. isolates from school children’s stool samples, n=68 using EUCAST disk diffusion method (2016) and presence of genes coding for tetracycline resistance.

Antimicrobial agentResistance genes (no. of
isolates)
Resistant isolates (EUCAST, 2016)
C. jejuni (n=30)C. coli (n=27)C. lari (n=11)Total Resistance (%)
Tetracyline (30 mg)Tet(A) (20), tet(B) (0), tet(C)
(2), tet(O) (8)
30261167 (96)
Ciprofloxacin (5 mg)Genotyping not done2523957 (84)
Naladixic acid (30 mg)29241063 (93)
Erythromycin (15 mg)Genotyping not done30271168 (100)

Multidrug resistant profiles in Campylobacter spp. isolates

Four MDR profiles were observed. All of the tested isolates were resistant to two or more antimicrobial agents, but the majority of isolates (84%) were resistant to all the antibiotics studied (profile 3 and 4). Campylobacter jejuni had the highest number of isolates that were MDR with 25 (37%) isolates being resistant to all four antibiotics tested (profile 1). C. coli had 23 (34%) isolates resistant to all the four antibiotics while C. lari had 9 (13%) isolates resistant to the four antibiotics. One (1.5%) C. jejuni and C. lari isolates was resistant to drugs in profile 2, while three (3%) C. coli isolates were in this profile. However, profile 4 had only one (1%) C. coli isolate while profile 4 had 2 (3%) C. lari, 4 (6%) C. coli and 5 (7%) C. jejuni MDR isolates (Table 4).

Table 4. Multidrug resistance (MDR) Campylobacter spp. isolates profile by antimicrobial sensitivity testing.

Drug (dose) profilesNo of MDR resistant isolates
per species
MDR Camylobacter
spp. isolates (n=68)
C. jejuni
(n=30)
C. coli
(n=27)
C. lari
(n=11)
1. Ciprofloxacin (5 mg), nalidixic acid (30 mg),
tetracycline (30 mg), erythromycin (15mg)
2523957 (84%)
2. Nalidixic acid (30 mg), tetracycline (30 mg),
erythromycin (15 mg)
1315 (7.3%)
3. Ciprofloxacin (5 mg), erythromycin (15mg)54211 (16%)
4. Tetracycline (30 mg), erythromycin (15 mg)0101 (1.5%)

Discussions

A prevalence of 18% Campylobacter spp. in asymptomatic school going children was confirmed with PCR in this study. Campylobacter isolation from healthy children has been reported in developing countries34 at a prevalence of 15%, which closely agrees with this study’s findings. The authors attributed the infections with Campylobacter to close contact with reservoir animals like chickens, as well as poor sanitation20. Both of these factors are prominent in this study area, where chicken share housing with humans. The isolates were further characterized and C. jejuni was isolated more frequently (7.6%) as compared to C. coli (4.8%) and C. lari (2%), whereas 4% were none of the three species analysed. This distribution between Campylobacter species agrees with other reports from both developed and developing countries, as well as from Kenya3436. Among the thermophilic Campylobacter species, C. upsaliensis was not characterised using PCR in this study. Phenotypic methods available for identification and differentiation of individual thermophilic Campylobacter spp. are non-conclusive and more sensitive methods are recommended37.

The Campylobacter spp. resistant to tetracycline had more tet(A) genes than tet(O) genes which were found in 20 (29%) and 8(12%) isolates respectively. This echoes Nguyen et al.20 who identified more tet(A) genes than tet(O) genes in Kenyan Campylobacter spp. isolates from chickens, at 35% and 13%. respectively. The high resistance rates obtained in this study, with 84% of isolates being resistant to all four agents, was in agreement with findings of Nguyen et al.20 and Coker et al.34 for chicken and human Campylobacter isolates, respectively. Both studies reported more than 70% resistance to ciprofloxacin, nalidixic acid and tetracycline. However, these results contrast with those of a report on human Campylobacter from diarrhoea cases in Western Kenya, where resistance towards ciprofloxacin were observed in 6% cases, towards nalidixic acid in 26%, and towards tetracycline in 18%. Erythromycin resistance in this study was also high, which contrasts the findings of Nguyen et al.20 in chicken-isolated Campylobacter. In the setting of the current study, with domestic animals hosted within the human settlements and poor sanitation, the possibility of cross-infection is very likely, as is horizontal transfer of antimicrobial resistance-encoding genes. Ciprofloxacin and erythromycin are the drugs of choice for Campylobacter treatment. These drugs are often used in Kenya for self-treatment of infections other than gastroenteritis, and resistance can be expected to increase in developing countries34.

In conclusion, the World Health Organization has recommended a multi-tiered and goal-oriented approach to control Campylobacter infections in both human and animals. Appropriate measures need to be taken on the various routes of transmission, including contaminated water and milk, through chlorination and pasteurization, respectively. Poultry, as the major reservoir, must be the main target4.

Data availability

Figshare: Multidrug resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school going children in Kibera slum, Kenya.xlsx. https://doi.org/10.6084/m9.figshare.1130229238.

File ‘Multidrug resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school going children in Kibera slum, Kenya.xlsx’ contains the bacterial species identified from samples, the antibiotic zones of inhibition and the presence or absence of antibiotic-resistance genes in each sample.

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 07 Feb 2020
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Gitahi N, Gathura PB, Gicheru MM et al. Multidrug-resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school-going children in Kibera slum, Kenya [version 1; peer review: 2 approved with reservations]. F1000Research 2020, 9:92 (https://doi.org/10.12688/f1000research.21299.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 07 Feb 2020
Views
15
Cite
Reviewer Report 21 Jul 2020
Byeonghwa Jeon, Division of Environmental Health Sciences, School of Public Health, University of Minnesota, St. Paul, MN, USA 
Approved with Reservations
VIEWS 15
Abstract:
  1. Background: Should read: the antibiotic resistance patterns of
     
  2. Results: antibiotic concentrations, not the amount, need to be used. This applies to the entire manuscript. 

Introduction: ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Jeon B. Reviewer Report For: Multidrug-resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school-going children in Kibera slum, Kenya [version 1; peer review: 2 approved with reservations]. F1000Research 2020, 9:92 (https://doi.org/10.5256/f1000research.23456.r65988)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
20
Cite
Reviewer Report 27 Mar 2020
Musafiri Karama, Veterinary Public Health Section, Department of Paraclinical Sciences, Faculty of Veterinary Science, University of Pretoria, Onderstepoort, South Africa 
Approved with Reservations
VIEWS 20
The manuscript entitled “Multidrug-resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school-going children in Kibera slum, Kenya” investigated the occurrence and antimicrobial resistance of Campylobacter spp. among school-going children in a populous slum of Kenya. The study is well ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Karama M. Reviewer Report For: Multidrug-resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school-going children in Kibera slum, Kenya [version 1; peer review: 2 approved with reservations]. F1000Research 2020, 9:92 (https://doi.org/10.5256/f1000research.23456.r59720)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 07 Feb 2020
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.