ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea

[version 1; peer review: 1 not approved]
PUBLISHED 21 Jul 2021
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Pathogens gateway.

Abstract

Background: Antimalarial drug resistance is a major challenge hampering malaria control and elimination. Plasmodium falciparum, the leading causative parasite species, has developed resistance to basically all antimalarials. Continued surveillance of drug resistance using genetic markers provides important molecular data for treatment policies. This study sought to verify the genetic mechanism of resistance to sulfadoxine-pyrimethamine and assess the occurrence of point mutations associated with artemisinin resistance in P. falciparum clinical isolates from Eritrea.
Methods: Nineteen dried blood spot samples were collected from patients visiting Adi Quala, Keren and Gash Barka Hospitals, Eritrea. The patients were followed up after receiving treatment with first line artesunate-amodiaquine. Nested polymerase chain reaction and Sanger sequencing techniques were employed to genotype point mutations in the P. falciparum bifunctional dihydrofolate reductase-thymidylate synthase (Pfdhfr, PF3D7_0417200), dihydropteorate synthase (Pfdhps, PF3D7_0810800) and kelch 13 (PfK13, PF3D7_1343700) genes.
Results: Eight of nineteen (42%) of the dried blood spot samples were successful for PCR-amplification. Data analyses of the PCR-positive isolates revealed the following point mutations: Pfdhfr N51I in four isolates, C59R in one isolate, S108N in four isolates, a rare non-synonymous substitution V45A in four isolates and Pfdhps K540E in four isolates. No PfK13 point mutations were reported.
Conclusions: Pfdhfr C59R and Pfdhps K540E point mutations are reliable markers for the sulfadoxine-pyrimethamine quintuple mutant haplotype combination. These findings highlight first reports in Eritrea, which verify the underlying genetic mechanism of antifolate resistance. Continuous monitoring of the PfK13 marker is recommended.

Keywords

drug resistance, Plasmodium falciparum, antifolate, artemisinin, genetic markers, Eritrea

Introduction

Malaria is a major vector-borne disease, endemic in 87 tropical and sub-tropical countries, causing over 400,000 deaths yearly (WHO World Malaria Report 2020). Eritrea, which is situated in the Horn of Africa, has experienced a significant decline in deaths and cases of malaria over the past 20 years (WHO World Malaria Report 2019). This reduction, according to the Ministry of Health (MOH) reports, is mainly due to extensive interventions employed towards the control of malaria since the establishment of the Eritrea National Malaria Control Program (NMCP) in 1995.1 Working hand-in-hand with Roll Back Malaria (RBM) collaborators and stakeholders,2 NMCP set up a combination of strategies including integrated vector management (IVM), early diagnosis and prompt treatment3 consequently leading to a remarkable decrease in incidence and mortality rates, following the gruesome 1998 malaria epidemic in the country.4 The disease is generally endemic in the Western lowlands of Gash Barka, Anseba, Debub and Semenawi Keih Bahri (Northern Red Sea) zobas (regions) whereas the Central highlands and Eastern lowlands of Maekel and Debubawi Keih Bahri (Southern Red Sea) zobas respectively have unstable, seasonal transmission. July–September is the common rainy season and hence malaria transmission peaks between October–November in a majority of the endemic areas while in the Coastal region the rainy season mostly occurs between December–January leading to a heightened transmission in March–April.5,6 About three-quarters of confirmed malaria cases in Eritrea are caused by Plasmodium falciparum and the remaining one-quarter is attributed to Plasmodium vivax, as well as small proportions of mixed infections (WHO African Region: Eritrea 2018). Currently, case management in Eritrea exclusively entails World Health Organisation (WHO) recommended first line treatment of uncomplicated malaria using artesunate-amodiaquine (AS-AQ), an artemisinin-based combination therapy (ACT) adopted in 2007, while quinine (Q) has been used for severe cases of infection since 2002 (WHO African Region: Eritrea 2018). Monitoring for drug resistance plays a major role in governing the efficacy of antimalarials, which subsequently influences their use in a population.

The emergence of drug resistance, especially among P. falciparum parasites, is a major hindrance to malaria control due to its increasing prevalence to essentially all antimalarials including sulfadoxine-pyrimethamine (SP) and lately artemisinins (ARTs).7 Genetic markers are invaluable tools in screening and detection of drug resistance, in addition to predicting the efficacy of antimalarials.8 Sulfadoxine-pyrimethamine P. falciparum resistance (SPR), which is well-studied, results from the occurrence and accumulation of mutations in the dihydrofolate reductase gene (Pfdhfr) and in the dihydropteorate synthase gene (Pfdhps) leading to a gradual reduction of sensitivity to pyrimethamine and sulfadoxine respectively.9 In vitro and in vivo studies have shown that SPR is mainly associated with point mutations at codons N51I, C59R, S108N and I164L of Pfdhfr and S436A, A437G, K540E, A581G and A613S of Pfdhps.10,11 Various combinations of these mutations have been used to classify SP resistant parasites according to different levels of resistance i.e. partially-, fully- or super resistant parasites and this has subsequently affected SP treatment policy. Partial resistance is demonstrated by a combination of triple mutant Pfdhfr, N51I, C59R, S108N and Pfdhps, A437G whereas full resistance is shown by a combination of triple mutant Pfdhfr, N51I, C59R, S108N and double mutant Pfdhfr, A437G, K540E. Finally, the sextuple mutant genotype involving a combination of triple mutant Pfdhfr, N51I, C59R, S108N and triple mutant Pdhfr, A437G, K540E and A581G defines super resistance.12

The development of artemisinin (ART) resistant P. falciparum parasites was first independently described in Western Cambodia, South East Asia.13 To date, resistance is commonly associated with five non-synonymous mutations including M476I, Y493H, R539T, I543T, and C580Y in the propeller domain of P. falciparum kelch 13 gene (Pfk13).14,15 ART resistance is primarily characterized by delayed parasite clearance rates in clinical studies as well as reduced in vitro drug susceptibility of the ring stage of parasite development.16,17 Considering the significant malaria control interventions accomplished in Eritrea, this pilot study aimed at availing supplementary molecular data by screening for SP and ART resistance-associated mutations from a cohort of patients, treated with first line AS-AQ, visiting selected hospitals located in malaria endemic regions of Eritrea. Generally, despite WHO’s change in treatment policy from the chloroquine (CQ) - sulfadoxine-pyrimethamine (SP) combination, adopted in 2002 to ACT, little is documented on the genetic mechanism underlying SPR using genetic markers. Additionally, a continuous detection for ART-resistance using genetic markers is important to keep track of changes at the genetic level.

Methods

Ethical statement

The ethical approval for this study was obtained from the Eritrea Institute of Technology, Research and Postgraduate Studies (RPS) Ethics Review Committee (Reference no. RPS/169/14) and the Ethics Review Board of the National Commission for Higher Education, Eritrea (NCHE) (Reference no. BHEAIL/3/656-568/14).

Study sites and sample collection.

Sample collection was conducted from 1st July to 1st October 2014 at three hospitals located in malaria-endemic zobas of Eritrea: Adi Quala Hospital, Adi Quala (14°38′07′′N, 38°50′03′′E) in Zoba Debub, Keren Hospital, Keren (15°46′40′′N, 38°27′03′′E) in Zoba Anseba and Gash Barka Referral Hospital, Barentu (15°06′20′′N, 37°35′26′′E) in Zoba Gash Barka. Three time ranges were employed for the study at the three hospitals: from 1st July to 31st August 2014 for Adi Qualla Hospital, 16th July to 15th September 2014 for Keren Hospital and 15th August to 1st October 2014 for Gash Barka Referral Hospital.

Blood samples were obtained from patients with febrile illness, who visited the three hospitals within the study period. The samples were spotted on Whatman 903TM paper (GE Healthcare Bioscience Corp.), stored in individual plastic bags with silica desiccant and transported for further molecular studies at the Institute for Biotechnology Research (IBR) in Jomo Kenyatta University of Agriculture and Technology (JKUAT), Kenya.

Genomic DNA extraction and PCR amplification

Genomic DNA extraction was performed on the dried blood spot (DBS) samples using Schneeberger’s protocol with slight modifications, comprising 1.5M guanidine thiocyanate and 100mM Tris with 0.1% sodium dodecyl sulfate (SDS) at pH 8.18 Concentration of DNA ranged from 0.05 ng/uL to 6.03 ng/uL whereas the ratio obtained from analysis of DNA purity (260 nm/280 nm) ranged from 1.4 to 2.17. The DNA extracts were stored at -20°C and used for PCR amplification.

Outer and nested PCR amplification was conducted using the AB 9800 Fast Thermocycler machine (Applied Biosystems, UK) on regions flanking identified point mutations of the following P. falciparum genes: bifunctional dihydrofolate reductase-thymidylate synthase – DHFR-TS (PF3D7_0417200), i.e. N51I, C59R, and S108N, hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase – PPPK-DHPS (PF3D7_0810800) i.e. K540E and kelch protein – kelch 13 (PF3D7_1343700) i.e. Y493H, R539T, I543T, and C580Y which confer drug resistance to SP and ART respectively. The respective gene sequences were retrieved from PlasmoDB release 46 (http://PlasmoDB.org) and primer design (Table 1) was performed using PrimerQuest and OligoAnalyzer tools from Integrated DNA technologies online platform (https://www.idtdna.com/). Selection of primers considered characteristics such as: Guanine-Cytosine (G+C) content of greater than 50, five degrees difference between melting temperatures and absence of hair-pin formation and self-annealing properties. A total PCR volume of 25 uL containing 12.5 uL of 2× DreamTaq PCR master mix (Thermo ScientificTM), 3.75 uL of the DNA template and 0.25 uL of the forward and reverse primers respectively were obtained for all the reactions. A volume of 3.75 uL of DNA template in the outer primary PCR reaction, as well as for the PCR amplicon in the nested secondary reaction was used. Step-down PCR cycling conditions for the outer and nested reactions were set as follows: an initial denaturation of 94°C for three minutes, a denaturation of 94°C for 15 seconds, an annealing temperature range of 55°C–60°C for 30 seconds, an elongation of 72°C for one minute and a final elongation of 72°C for 10 minutes.

Table 1. Outer and nested primer sets used for PCR amplification of target gene regions.

Gene nameGene IDPrimer sequencesAmplicon band size (bp)Targeted point mutationsPrimer reference
Bifunctional dihydrofolate reductase thymidylate synthase – DHFR-TS
(Pfdhfr)
PF3D7_0417200Outer primer set:
PF_0417200_OF
5′ CCAACATTTTCAAGATTGATAC 3′
This study
PF_0417200_OR
5′CGCTAACAGAAATAATTTGATACTC3′
Nested primer set:
PF_0417200_NF
5' GGTCTAGGAAATAAAGGAG 3'
397N51I, C59R, N108S
PF_0417200_NR
5′ GATAAACAACGGAACCTCC 3′
hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase – PPPK-DHPS
(Pfdhps)
PF3D7_0810800Outer primer set:
PF_0810800_OF
5′ GTGATTGTGTGGATCAGAAG 3′
This study
PF_0810800_OR
5′ GTTTCTTCGCAAATCCTAATCC 3′
Nested primer set:
PF_0810800_NF
5′ GGTGGAGAATCCTCTGGT 3′
457K540E
PF_0810800_OR
5′ GTTTCTTCGCAAATCCTAATCC 3′
Kelch protein-K-13
(PfK-13)
PF3D7_1343700Outer primer set:
PF_1343700_OF
5′ CGGAGTGACCAAATCTGGGA 3′
This study
PF_1343700_OR
5′ GCCTTGTTGAAAGAAGCAG 3′
Nested primer sets:
PF_1343700_OF
532C580Y, A578S, A569S, N554S, V566I
PF_1343700_NR1
5′ GGGGGATATGATGGCTCTTCT 3′
PF_1343700_NF2
5'AGAAGAGCCATCATATCCCCC 3'
372Y493H, R539T, I543T,
PF_1343700_NR2
5′ GCCTTGTTGAAAGAAGCAG 3′

Resolution of PCR amplicons was run in 1.5% agarose gel, 1× TAE buffer, at 70 V, 58 mA for one hour 30 minutes using a gel electrophoresis system (IBI-Shelton Scientific MP-1015 multipurpose) and an electrophoresis power voltage supplier (Pharmacia LKB ECPS 3000V/150mA). GelRed ® Nucleic Acid Gel stain (Biotium) was used for pre-cast gel staining, 1 kb DNA ladder (Thermo ScientificTM) for DNA quantification of resolved PCR amplicons. P. falciparum 3D7 purified DNA laboratory strain obtained from Kenya Medical Research Institute (KEMRI) was used as the main control for wild-type and mutant alleles of each gene. Purification of nested PCR amplicons depicting a single band was performed using the QIAquick PCR purification kit (Qiagen) whereas for amplicons showing double bands, the targets were processed using QIAquick gel extraction kit (Qiagen) as per the manufacturer’s protocol respectively. The PCR amplicons were shipped to Macrogen (Seoul, Korea) for Sanger sequencing.

Bioinformatics analysis

QIAGEN CLC Main Workbench v21.0.4 was used to perform sequence data editing, consensus sequence assembly and identification of nucleotide base conflicts against the 3D7 reference gene sequences of PF3D7_0417200, PF3D7_0810800 and PF3D7_1343700. Multiple sequence alignment (MSA), was carried out in MEGA v7.019 using the Muscle algorithm20 to identify nucleotide base changes, including translation to amino acid sequences using the standard genetic code for the identification of amino acid changes and their respective positions. Further visualisation of sequence alignments was performed in Jalview v2.11.1.421 to identify non-synonymous point mutations.

Results

Sample characteristics

After consent was given for participation and follow up, 19 dried blood spot (DBS) samples were successfully collected from a total of 131 patients who visited the three hospitals during the study period,22 10 samples from Adi Quala Hospital (AQH = 10), three samples from Keren Hospital (KH = 3) and six samples from Gash Barka Referral Hospital (GBH = 6). Eight DBS samples were from patients treated with ACT (artesunate [AS] 100 mg + amodiaquine [AQ] 200 mg) and did not respond to treatment. These underwent re-treatment with quinine (Q) and were cured. Five DBS samples were from patients who responded to ACT treatment. The remaining six were from patients presenting severe illness and were treated with quinine (Q) (Table 2).

Table 2. Patient description and treatment regimen data for dried blood spot samples collected from the hospital sites.

AS = artesunate, AQ = amodiaquine, Q = quinine.

Treatment regimen
Hospital name (code) and regionPatient serial no.GenderFirst treatmentTreatment outcomeSecond treatment (re-treatment with quinine)
Aqi Quala Hospital (AQH): Adi QualaAQH001MAS + AQDid not respondResponded
AQH002MAS + AQDid not respondResponded
AQH003MAS + AQDid not respondResponded
AQH004FAS + AQDid not respondResponded
AQH005MAS + AQDid not respondResponded
AQH006FAS + AQDid not respondResponded
AQH007FQResponded
AQH008MQResponded
AQH009MAS + AQResponded
AQH010MAS + AQResponded
Keren Hospital (KH): DebubKH011MAS + AQDid not respondResponded
KH012MQResponded
KH013MAS + AQResponded
Gash Barka Hospital (GBH): AnsebaGBH014MAS + AQDid not respondResponded
GBH015FAS + AQResponded
GBH016MAS + AQResponded
GBH017MQResponded
GBH018FQResponded
GBH019FQResponded

PCR amplification and point mutation analyses

On PCR amplification of targeted gene regions, sequence data from eight samples (AQH = 2, KH = 2, GBH = 4) was eventually analyzed for point mutations (Table 3). The nucleotide base changes comprised of four Pfdhfr substitutions, adenine (A) to cytosine (C) at position 152, thymine (T) to cytosine (C) at position 175, guanine (G) to adenine (A) at position 323, thymine (T) to cytosine (C) at position 134; one Pfdhps substitutions, adenine (A) to guanine (G) at position 1618 and none identified for PfK-13 (Table 4). Subsequent translation to amino acid sequences constituted changes as follows: asparagine (N) to isoleucine (I) at codon 51, cysteine (C) to arginine (R) at codon 59, serine (S) to asparagine (N) at codon 108 and valine (V) to alanine (A) at codon 45 for Pfdhfr; lysine (K) to glutamate (E) at codon 540 for Pfdhps and wild-type amino acids retained for Pfkelch-13 (Table 4). Multiple sequence alignment (MSA) and visualization of consensus sequence assemblies for Pfdhfr, Pfdhps and Pfkelch-13 against their 3D7 reference sequences distinguished four non-synonymous (nsy) point mutations for Pfdhfr (N51I, C59R, S108N, V45A), one non-synonymous (nsy) point mutation (K540E) for Pfdhps while Pfkelch-13 retained wild-type amino acids (Figure 1).

e7fa377c-8b29-45b4-96e1-f5b0dc94575e_figure1.gif

Figure 1.

Jalview visualization of multiple sequence alignments depicting nsy-point mutations: Pfdhfr (N51I, S108N, V45A) occurred in all four isolates (KH013, GBH017, AQH010, AQH009), C59R was identified in one isolate (KH013); Pfdhps (K540E) occurred in all four isolates (KH013, GBH017, AQH010, AQH009), C59R was identified in one isolate (KH013) and Pfdhps (K540E) occurred in all four isolates (KH012, GBH014, GBH015, GBH017) PfK-13, established no point mutations in all six isolates, wild type amino acids retained at c.554(S), c.566(V), c.569(A), c.578(A), c.580(C), c.493(Y), c.539(R), c.543 (I).

Table 3. P. falciparum nested-PCR results for PfK-13, Pfdhps and Pfdhfr genes from the hospital sites in Eritrea.

Hospital site (code)Total no. of samples collectedNo. of PCR positive isolates N (%)Isolate serial no.PCR positive isolates N per molecular marker
PfK-13PfdhpsPfdhfr
Adi Quala Hospital (AQH)102 (20%)AQH009, AQH010202
Keren Hospital (KH)32 (67%)KH012, KH013121
Gash Barka Hospital (GBH)64 (67%)GBH014, GBH015, GBH017, GBH018, GBH019342

Table 4. Pfdhfr, Pfdhps and PfK-13 results for corresponding nucleotide- and amino acid-changes across the hospital sites in Eritrea.

N = asparagine, I = isoleucine, C = cysteine, R = arginine, S = serine, V = valine, A = alanine.

Molecular markerNucleotide base changeAmino acid changeNo. of isolates per hospital
Position (p)FromToCodon (c)Wild-typeMutantAdi Quala
(AQH)
Keren
(KH)
Gash Barka
(GBH)
Pfdhfr152AaTAtT51NI211
175tGTcGT59CR010
323AgCAaC108SN211
134GtAGcA45VA211
Pfdhps1618AGaAGg540KE013
PfK-13G1739Aretained580Yretained0-0
A1661Gretained554Nretained0-0
G1705Aretained569Aretained0-0
G1696Aretained566Vretained0-0
G1732Aretained578Aretained0-0
T1477Cretained493Yretained000
G1615Cretained539Rretained000
T1627Cretained543Iretained000

Note: The numeral ‘0’ indicates absence of isolates with the respective nucleotide/amino acid changes The dash (-) symbol implies no sequence data generated from the respective hospital sites.

Discussion

In this study, we present findings from a pilot survey assessing the occurrence of point mutations in PfK-13, Pfdhfr and Pfdhps genes from clinical isolates obtained from three zobas of Eritrea: Adi Quala (Adi Quala Hospital), Debub (Keren Hospital) and Anseba (Gash Barka Hospital). We targeted PCR-amplification of PfK-13 point mutations associated with artemisinin (ART) resistant phenotype in western Cambodia, South-East Asia Y493H, R539T, I543T, C580Y,14 non-synonymous point mutations, V566I, A578S, identified in isolates from five Sub-Saharan countries23 and N554S, A569S reported in a previous study from islands in Lake Victoria, Kenya.24 This study found none of the corresponding point mutations in PfK-13, which is similar to other studies from Eritrea25 and Kenya26,27 including other malaria endemic sub-Saharan countries.28 Data from the treatment outcome with the prescribed artemisinin (artesunate [AS]) indicated susceptibility responses corresponding with our findings and suggesting a likely absence of ART resistance. Only one isolate from these analyses was obtained from a patient who did not respond to first line treatment with AS-AQ – this could be attributed to possible causes of treatment failure such as non-compliance to the treatment regimen, incorrect drug usage, drug pharmacokinetics as well as host immunity.29,30

Pfdhfr point mutations, N51I, C59R and S108N observed in our study correspond with previous reports from Senegal,31 South Africa,32 Malawi, Mali, Kenya, Tanzania,33,34 including Venezuela in South America.35 Additionally, the single Pfdhfr C59R and Pfdhps K540E point mutations seen in our findings, have been shown to predict the occurrence of the Pfdhfr-Pfdhps quintuple mutant haplotype (Pfdhfr 51I/59R/108N + Pfdhps 437G/540E),36 which is associated with fully resistant SP parasites12 as well as SP treatment failure.37 The selection of these Pfdhfr-Pfdhps mutations from our findings, is attributable to the prior use of the CQ-SP combination as first-line treatment for clinical management of febrile disease especially at the primary health care level in Eritrea. Additionally, prior evidence shows that SP resistant parasites originated from South East Asia and consecutively spread into Sub-Saharan Africa,38,39 which eventually reached Eritrea too, as demonstrated in these findings. The valine (V) to alanine (A) change at codon 45 in Pfdhfr from this study, has not been previously reported, although, a converse occurrence of alanine (A) to valine (V) at codon 16 has been associated, both singly and doubly in combination to S108N mutation, with resistance to another antifolate, cycloguanil.40,41 Further investigation with a larger sample size is recommended to validate the selection of the V45A mutation in the population, as well as understand its implications to protein function in association with other established Pfdhfr mutations. Additionally, further detection of other SP resistance associated mutations not reported herein is recommended.

Although this study design availed treatment outcome information to compare with corresponding generated molecular data, limitation of sample size as well as DNA quality and quantity constrained further detection of PfK13 mutations associated with artemisinin resistance. Nonetheless, the general findings reported here, are not affected by these limitations and essentially provides useful molecular inference for further investigations.

Conclusions

Here, we provide molecular data verifying the genetic mechanism underlying SP resistance from selected participants of three regions of Eritrea. Pfdhfr C59R and Pfdhps K540E are reliable markers for the quintuple mutant haplotype conferring full resistance to SP. This study provides the molecular status of SP resistance in Eritrea. Continued monitoring of artemisinin resistance is recommended. Future studies should be carried out on a larger sample size since this study was a pilot survey involving a small sample size.

Data availability

Underlying data

This project contains the following underlying data:

NCBI Gene: bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322415, https://www.ncbi.nlm.nih.gov/nuccore/MZ322415.

NCBI Gene: bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322416, https://www.ncbi.nlm.nih.gov/nuccore/MZ322416.

NCBI Gene: bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322417, https://www.ncbi.nlm.nih.gov/nuccore/MZ322417.

NCBI Gene: bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322418, https://www.ncbi.nlm.nih.gov/nuccore/MZ322418.

NCBI Gene: hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase (PPPK-DHPS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322419, https://www.ncbi.nlm.nih.gov/nuccore/MZ322419.

NCBI Gene: hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase (PPPK-DHPS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322420, https://www.ncbi.nlm.nih.gov/nuccore/MZ322420.

NCBI Gene: hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase (PPPK-DHPS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322421, https://www.ncbi.nlm.nih.gov/nuccore/MZ322421.

NCBI Gene: hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase (PPPK-DHPS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322422, https://www.ncbi.nlm.nih.gov/nuccore/MZ322422.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322423, https://www.ncbi.nlm.nih.gov/nuccore/MZ322423.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322424, https://www.ncbi.nlm.nih.gov/nuccore/MZ322424.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322425, https://www.ncbi.nlm.nih.gov/nuccore/MZ322425.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322426, https://www.ncbi.nlm.nih.gov/nuccore/MZ322426.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322427, https://www.ncbi.nlm.nih.gov/nuccore/MZ322427.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322428, https://www.ncbi.nlm.nih.gov/nuccore/MZ322428.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322429, https://www.ncbi.nlm.nih.gov/nuccore/MZ322429.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322430, https://www.ncbi.nlm.nih.gov/nuccore/MZ322430.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322431, https://www.ncbi.nlm.nih.gov/nuccore/MZ322431.

Extended data

Dryad: Extended data for ‘Screening for Antifolate and Artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea’, https://doi.org/10.5061/dryad.sbcc2fr6q.22

This project contains the following extended data:

  • the total number of patients grouped according to age, who visited the three hospitals during the study period.

  • gel images of Pfdhfr, Pfdhps and PfK13 genetic markers.

Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication).

Consent

All participants were informed concerning the aim of the study, assent and written informed consent was given by patients, voluntary participation was allowed, and confidentiality of information collected ensured.

Comments on this article Comments (0)

Version 4
VERSION 4 PUBLISHED 21 Jul 2021
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Mukhongo HN, Kinyua JK, Weldemichael YG and Kasili RW. Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea [version 1; peer review: 1 not approved]. F1000Research 2021, 10:628 (https://doi.org/10.12688/f1000research.54195.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 21 Jul 2021
Views
60
Cite
Reviewer Report 25 Oct 2021
Olusola Ojurongbe, Department of Medical Microbiology & Parasitology, Ladoke Akintola University of Technology, Ogbomoso, Nigeria 
Not Approved
VIEWS 60
Mukhongo et al. presented a study highlighting the prevalence of P. falciparum dhfr, dhps, and K13 gene mutations in parasites collected in Eritrea. The subject of P. falciparum drug-resistant and gene mutations is very germane in malaria research, making this ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Ojurongbe O. Reviewer Report For: Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea [version 1; peer review: 1 not approved]. F1000Research 2021, 10:628 (https://doi.org/10.5256/f1000research.57655.r95573)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 01 May 2024
    Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya
    01 May 2024
    Author Response
    Please find the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.
    Competing Interests: No competing evidence disclosed
COMMENTS ON THIS REPORT
  • Author Response 01 May 2024
    Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya
    01 May 2024
    Author Response
    Please find the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.
    Competing Interests: No competing evidence disclosed

Comments on this article Comments (0)

Version 4
VERSION 4 PUBLISHED 21 Jul 2021
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.