Screening for antifolate and artemisinin resistance in <i>Plasmodium falciparum</i> clinical isolates from three hospitals of Eritrea

Harriet Natabona Mukhongo; Johnson Kang'ethe Kinyua; Yishak Gebrekidan Weldemichael; Remmy Wekesa Kasili

doi:10.12688/f1000research.54195.2

Home Browse Screening for antifolate and artemisinin resistance in Plasmodium...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Revised

Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea

[version 2; peer review: 2 not approved]

Harriet Natabona Mukhongo ¹, Johnson Kang'ethe Kinyua¹, Yishak Gebrekidan Weldemichael², Remmy Wekesa Kasili³

PUBLISHED 02 Feb 2023

Author details Author details

¹ College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya
² College of Science; Department of Biology, Eritrea Institute of Technology, Asmara, P.O. Box 12676, Mai-Nefhi, Asmara, Eritrea
³ Department of Biological Sciences, Louisiana State University, Baton Rouge, LA, 70803, USA

Harriet Natabona Mukhongo
Roles: Formal Analysis, Investigation, Methodology, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Johnson Kang'ethe Kinyua
Roles: Formal Analysis, Methodology, Supervision, Validation, Visualization, Writing – Review & Editing

Yishak Gebrekidan Weldemichael
Roles: Conceptualization, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Writing – Review & Editing

Remmy Wekesa Kasili
Roles: Conceptualization, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Pathogens gateway.

Abstract

Background: Antimalarial drug resistance is a major challenge hampering malaria control and elimination. Plasmodium falciparum, the leading causative parasite species, has developed resistance to basically all antimalarials. Continued surveillance of drug resistance using genetic markers provides important molecular data for treatment policies. This study sought to verify the genetic mechanism of resistance to sulfadoxine-pyrimethamine and assess the occurrence of point mutations associated with artemisinin resistance in P. falciparum clinical isolates from Eritrea.
Methods: Nineteen dried blood spot samples were collected from patients visiting Adi Quala, Keren and Gash Barka Hospitals, Eritrea. The patients were followed up after receiving treatment with first line artesunate-amodiaquine. Nested polymerase chain reaction and Sanger sequencing techniques were employed to genotype point mutations in the P. falciparum bifunctional dihydrofolate reductase-thymidylate synthase (Pfdhfr, PF3D7_0417200), dihydropteorate synthase (Pfdhps, PF3D7_0810800) and kelch 13 (PfK13, PF3D7_1343700) genes.
Results: Eight of nineteen (42%) of the dried blood spot samples were successful for PCR-amplification. Data analyses of the PCR-positive isolates revealed the following point mutations: Pfdhfr N51I in four isolates, C59R in one isolate, S108N in four isolates, a rare non-synonymous substitution V45A in four isolates and Pfdhps K540E in four isolates. No PfK13 point mutations were reported.
Conclusions: Pfdhfr C59R and Pfdhps K540E point mutations are reliable markers for the sulfadoxine-pyrimethamine quintuple mutant haplotype combination. These findings highlight first reports in Eritrea, which verify the underlying genetic mechanism of antifolate resistance. Continuous monitoring of the PfK13 marker is recommended.

Keywords

drug resistance, Plasmodium falciparum, antifolate, artemisinin, genetic markers, Eritrea

Corresponding authors: Harriet Natabona Mukhongo, Remmy Wekesa Kasili

Competing interests: No competing interests were disclosed.

Grant information: This work was supported by Japan International Cooperation Agency (JICA) – Eritrea (Reference no. ODA/2014-TC/13) to YGW and RWK and Association of African Universities (AAU) small grants for theses and dissertations program to HNM (Reference no. PC/6/2016-2017).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2023 Mukhongo HN et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Mukhongo HN, Kinyua JK, Weldemichael YG and Kasili RW. Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea [version 2; peer review: 2 not approved]. F1000Research 2023, 10:628 (https://doi.org/10.12688/f1000research.54195.2) First published: 21 Jul 2021, 10:628 (https://doi.org/10.12688/f1000research.54195.1) Latest published: 12 Jun 2024, 10:628 (https://doi.org/10.12688/f1000research.54195.4)

Revised Amendments from Version 1

Paper changes for: Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea
Sample characteristics
A statement was added at the end of the paragraph describing the isolate serial number
PCR amplification and point mutation analyses
The number of Pfdhps substitutions analyzed was changed from one to two – this has been described as Pfdhps substitution at position 1347 translating as a synonymous mutation (R449R) at the amino acid level.
The change described above in (a) was also added in the caption for Figure 1
Changes were made in Table 4 under Pfdhps and PfK-13 respectively clearly indicating the corresponding nucleotide- (depicted in a yellow highlight ) and amino acid base changes analyzed in the study.

See the authors' detailed response to the review by Sam L Nsobya
See the authors' detailed response to the review by Olusola Ojurongbe

Introduction

Malaria is a major vector-borne disease, endemic in 87 tropical and sub-tropical countries, causing over 400,000 deaths yearly (WHO World Malaria Report 2020). Eritrea, which is situated in the Horn of Africa, has experienced a significant decline in deaths and cases of malaria over the past 20 years (WHO World Malaria Report 2019). This reduction, according to the Ministry of Health (MOH) reports, is mainly due to extensive interventions employed towards the control of malaria since the establishment of the Eritrea National Malaria Control Program (NMCP) in 1995.¹ Working hand-in-hand with Roll Back Malaria (RBM) collaborators and stakeholders,² NMCP set up a combination of strategies including integrated vector management (IVM), early diagnosis and prompt treatment³ consequently leading to a remarkable decrease in incidence and mortality rates, following the gruesome 1998 malaria epidemic in the country.⁴ The disease is generally endemic in the Western lowlands of Gash Barka, Anseba, Debub and Semenawi Keih Bahri (Northern Red Sea) zobas (regions) whereas the Central highlands and Eastern lowlands of Maekel and Debubawi Keih Bahri (Southern Red Sea) zobas respectively have unstable, seasonal transmission. July–September is the common rainy season and hence malaria transmission peaks between October–November in a majority of the endemic areas while in the Coastal region the rainy season mostly occurs between December–January leading to a heightened transmission in March–April.^5,6 About three-quarters of confirmed malaria cases in Eritrea are caused by Plasmodium falciparum and the remaining one-quarter is attributed to Plasmodium vivax, as well as small proportions of mixed infections (WHO African Region: Eritrea 2018). Currently, case management in Eritrea exclusively entails World Health Organisation (WHO) recommended first line treatment of uncomplicated malaria using artesunate-amodiaquine (AS-AQ), an artemisinin-based combination therapy (ACT) adopted in 2007, while quinine (Q) has been used for severe cases of infection since 2002 (WHO African Region: Eritrea 2018). Monitoring for drug resistance plays a major role in governing the efficacy of antimalarials, which subsequently influences their use in a population.

The emergence of drug resistance, especially among P. falciparum parasites, is a major hindrance to malaria control due to its increasing prevalence to essentially all antimalarials including sulfadoxine-pyrimethamine (SP) and lately artemisinins (ARTs).⁷ Genetic markers are invaluable tools in screening and detection of drug resistance, in addition to predicting the efficacy of antimalarials.⁸ Sulfadoxine-pyrimethamine P. falciparum resistance (SPR), which is well-studied, results from the occurrence and accumulation of mutations in the dihydrofolate reductase gene (Pfdhfr) and in the dihydropteorate synthase gene (Pfdhps) leading to a gradual reduction of sensitivity to pyrimethamine and sulfadoxine respectively.⁹ In vitro and in vivo studies have shown that SPR is mainly associated with point mutations at codons N51I, C59R, S108N and I164L of Pfdhfr and S436A, A437G, K540E, A581G and A613S of Pfdhps.^10,11 Various combinations of these mutations have been used to classify SP resistant parasites according to different levels of resistance i.e. partially-, fully- or super resistant parasites and this has subsequently affected SP treatment policy. Partial resistance is demonstrated by a combination of triple mutant Pfdhfr, N51I, C59R, S108N and Pfdhps, A437G whereas full resistance is shown by a combination of triple mutant Pfdhfr, N51I, C59R, S108N and double mutant Pfdhfr, A437G, K540E. Finally, the sextuple mutant genotype involving a combination of triple mutant Pfdhfr, N51I, C59R, S108N and triple mutant Pdhfr, A437G, K540E and A581G defines super resistance.¹²

The development of artemisinin (ART) resistant P. falciparum parasites was first independently described in Western Cambodia, South East Asia.¹³ To date, resistance is commonly associated with five non-synonymous mutations including M476I, Y493H, R539T, I543T, and C580Y in the propeller domain of P. falciparum kelch 13 gene (Pfk13).^14,15 ART resistance is primarily characterized by delayed parasite clearance rates in clinical studies as well as reduced in vitro drug susceptibility of the ring stage of parasite development.^16,17 Considering the significant malaria control interventions accomplished in Eritrea, this pilot study aimed at availing supplementary molecular data by screening for SP and ART resistance-associated mutations from a cohort of patients, treated with first line AS-AQ, visiting selected hospitals located in malaria endemic regions of Eritrea. Generally, despite WHO’s change in treatment policy from the chloroquine (CQ) - sulfadoxine-pyrimethamine (SP) combination, adopted in 2002 to ACT, little is documented on the genetic mechanism underlying SPR using genetic markers. Additionally, a continuous detection for ART-resistance using genetic markers is important to keep track of changes at the genetic level.

Methods

Ethical statement

The ethical approval for this study was obtained from the Eritrea Institute of Technology, Research and Postgraduate Studies (RPS) Ethics Review Committee (Reference no. RPS/169/14) and the Ethics Review Board of the National Commission for Higher Education, Eritrea (NCHE) (Reference no. BHEAIL/3/656-568/14).

Study sites and sample collection.

Sample collection was conducted from 1^st July to 1^st October 2014 at three hospitals located in malaria-endemic zobas of Eritrea: Adi Quala Hospital, Adi Quala (14°38′07′′N, 38°50′03′′E) in Zoba Debub, Keren Hospital, Keren (15°46′40′′N, 38°27′03′′E) in Zoba Anseba and Gash Barka Referral Hospital, Barentu (15°06′20′′N, 37°35′26′′E) in Zoba Gash Barka. Three time ranges were employed for the study at the three hospitals: from 1^st July to 31^st August 2014 for Adi Qualla Hospital, 16^th July to 15^th September 2014 for Keren Hospital and 15^th August to 1^st October 2014 for Gash Barka Referral Hospital.

Blood samples were obtained from patients with febrile illness, who visited the three hospitals within the study period. The samples were spotted on Whatman 903^TM paper (GE Healthcare Bioscience Corp.), stored in individual plastic bags with silica desiccant and transported for further molecular studies at the Institute for Biotechnology Research (IBR) in Jomo Kenyatta University of Agriculture and Technology (JKUAT), Kenya.

Genomic DNA extraction and PCR amplification

Genomic DNA extraction was performed on the dried blood spot (DBS) samples using Schneeberger’s protocol with slight modifications, comprising 1.5M guanidine thiocyanate and 100mM Tris with 0.1% sodium dodecyl sulfate (SDS) at pH 8.¹⁸ Concentration of DNA ranged from 0.05 ng/uL to 6.03 ng/uL whereas the ratio obtained from analysis of DNA purity (260 nm/280 nm) ranged from 1.4 to 2.17. The DNA extracts were stored at -20°C and used for PCR amplification.

Outer and nested PCR amplification was conducted using the AB 9800 Fast Thermocycler machine (Applied Biosystems, UK) on regions flanking identified point mutations of the following P. falciparum genes: bifunctional dihydrofolate reductase-thymidylate synthase – DHFR-TS (PF3D7_0417200), i.e. N51I, C59R, and S108N, hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase – PPPK-DHPS (PF3D7_0810800) i.e. K540E and kelch protein – kelch 13 (PF3D7_1343700) i.e. Y493H, R539T, I543T, and C580Y which confer drug resistance to SP and ART respectively. The respective gene sequences were retrieved from PlasmoDB release 46 (http://PlasmoDB.org) and primer design (Table 1) was performed using PrimerQuest and OligoAnalyzer tools from Integrated DNA technologies online platform (https://www.idtdna.com/). Selection of primers considered characteristics such as: Guanine-Cytosine (G+C) content of greater than 50, five degrees difference between melting temperatures and absence of hair-pin formation and self-annealing properties. A total PCR volume of 25 uL containing 12.5 uL of 2× DreamTaq PCR master mix (Thermo Scientific^TM), 3.75 uL of the DNA template and 0.25 uL of the forward and reverse primers respectively were obtained for all the reactions. A volume of 3.75 uL of DNA template in the outer primary PCR reaction, as well as for the PCR amplicon in the nested secondary reaction was used. Step-down PCR cycling conditions for the outer and nested reactions were set as follows: an initial denaturation of 94°C for three minutes, a denaturation of 94°C for 15 seconds, an annealing temperature range of 55°C–60°C for 30 seconds, an elongation of 72°C for one minute and a final elongation of 72°C for 10 minutes.

Table 1. Outer and nested primer sets used for PCR amplification of target gene regions.

Gene name	Gene ID	Primer sequences	Amplicon band size (bp)	Targeted point mutations	Primer reference
Bifunctional dihydrofolate reductase thymidylate synthase – DHFR-TS (Pfdhfr)	PF3D7_0417200	Outer primer set: PF_0417200_OF 5′ CCAACATTTTCAAGATTGATAC 3′			This study
		PF_0417200_OR 5′CGCTAACAGAAATAATTTGATACTC3′
		Nested primer set: PF_0417200_NF 5' GGTCTAGGAAATAAAGGAG 3'	397	N51I, C59R, N108S
		PF_0417200_NR 5′ GATAAACAACGGAACCTCC 3′	397	N51I, C59R, N108S
hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase – PPPK-DHPS (Pfdhps)	PF3D7_0810800	Outer primer set: PF_0810800_OF 5′ GTGATTGTGTGGATCAGAAG 3′			This study
		PF_0810800_OR 5′ GTTTCTTCGCAAATCCTAATCC 3′
		Nested primer set: PF_0810800_NF 5′ GGTGGAGAATCCTCTGGT 3′	457	K540E
		PF_0810800_OR 5′ GTTTCTTCGCAAATCCTAATCC 3′	457	K540E
Kelch protein-K-13 (PfK-13)	PF3D7_1343700	Outer primer set: PF_1343700_OF 5′ CGGAGTGACCAAATCTGGGA 3′			This study
		PF_1343700_OR 5′ GCCTTGTTGAAAGAAGCAG 3′
		Nested primer sets: PF_1343700_OF	532	C580Y, A578S, A569S, N554S, V566I
		PF_1343700_NR1 5′ GGGGGATATGATGGCTCTTCT 3′	532	C580Y, A578S, A569S, N554S, V566I
		PF_1343700_NF2 5'AGAAGAGCCATCATATCCCCC 3'	372	Y493H, R539T, I543T,
		PF_1343700_NR2 5′ GCCTTGTTGAAAGAAGCAG 3′	372	Y493H, R539T, I543T,

Resolution of PCR amplicons was run in 1.5% agarose gel, 1× TAE buffer, at 70 V, 58 mA for one hour 30 minutes using a gel electrophoresis system (IBI-Shelton Scientific MP-1015 multipurpose) and an electrophoresis power voltage supplier (Pharmacia LKB ECPS 3000V/150mA). GelRed ® Nucleic Acid Gel stain (Biotium) was used for pre-cast gel staining, 1 kb DNA ladder (Thermo Scientific^TM) for DNA quantification of resolved PCR amplicons. P. falciparum 3D7 purified DNA laboratory strain obtained from Kenya Medical Research Institute (KEMRI) was used as the main control for wild-type and mutant alleles of each gene. Purification of nested PCR amplicons depicting a single band was performed using the QIAquick PCR purification kit (Qiagen) whereas for amplicons showing double bands, the targets were processed using QIAquick gel extraction kit (Qiagen) as per the manufacturer’s protocol respectively. The PCR amplicons were shipped to Macrogen (Seoul, Korea) for Sanger sequencing.

Bioinformatics analysis

QIAGEN CLC Main Workbench v21.0.4 was used to perform sequence data editing, consensus sequence assembly and identification of nucleotide base conflicts against the 3D7 reference gene sequences of PF3D7_0417200, PF3D7_0810800 and PF3D7_1343700. Multiple sequence alignment (MSA), was carried out in MEGA v7.0¹⁹ using the Muscle algorithm²⁰ to identify nucleotide base changes, including translation to amino acid sequences using the standard genetic code for the identification of amino acid changes and their respective positions. Further visualisation of sequence alignments was performed in Jalview v2.11.1.4²¹ to identify non-synonymous point mutations.

Results

Sample characteristics

After consent was given for participation and follow up, 19 dried blood spot (DBS) samples were successfully collected from a total of 131 patients who visited the three hospitals during the study period,²² 10 samples from Adi Quala Hospital (AQH = 10), three samples from Keren Hospital (KH = 3) and six samples from Gash Barka Referral Hospital (GBH = 6). Eight DBS samples were from patients treated with ACT (artesunate [AS] 100 mg + amodiaquine [AQ] 200 mg) and did not respond to treatment. These underwent re-treatment with quinine (Q) and were cured. Five DBS samples were from patients who responded to ACT treatment. The remaining six were from patients presenting severe illness and were treated with quinine (Q) (Table 2). The isolate serial number is depicted as the hospital code preceding a unique identifier i.e. AQHxxx, KHxxx, GBHxxx.

Table 2. Patient description and treatment regimen data for dried blood spot samples collected from the hospital sites.

AS = artesunate, AQ = amodiaquine, Q = quinine.

Treatment regimen
Hospital name (code) and region	Patient serial no.	Gender	First treatment	Treatment outcome	Second treatment (re-treatment with quinine)
Aqi Quala Hospital (AQH): Adi Quala	AQH001	M	AS + AQ	Did not respond	Responded
	AQH002	M	AS + AQ	Did not respond	Responded
	AQH003	M	AS + AQ	Did not respond	Responded
	AQH004	F	AS + AQ	Did not respond	Responded
	AQH005	M	AS + AQ	Did not respond	Responded
	AQH006	F	AS + AQ	Did not respond	Responded
	AQH007	F	Q	Responded
	AQH008	M	Q	Responded
	AQH009	M	AS + AQ	Responded
	AQH010	M	AS + AQ	Responded
Keren Hospital (KH): Debub	KH011	M	AS + AQ	Did not respond	Responded
	KH012	M	Q	Responded
	KH013	M	AS + AQ	Responded
Gash Barka Hospital (GBH): Anseba	GBH014	M	AS + AQ	Did not respond	Responded
	GBH015	F	AS + AQ	Responded
	GBH016	M	AS + AQ	Responded
	GBH017	M	Q	Responded
	GBH018	F	Q	Responded
	GBH019	F	Q	Responded

PCR amplification and point mutation analyses

On PCR amplification of targeted gene regions, sequence data from eight samples (AQH = 2, KH = 2, GBH = 4) was eventually analyzed for point mutations (Table 3). The nucleotide base changes comprised of four Pfdhfr substitutions, adenine (A) to cytosine (C) at position 152, thymine (T) to cytosine (C) at position 175, guanine (G) to adenine (A) at position 323, thymine (T) to cytosine (C) at position 134; two Pfdhps substitutions, adenine (A) to guanine (G) at position 1618 and 1347 and none identified for PfK-13 (Table 4). Subsequent translation to amino acid sequences constituted changes as follows: asparagine (N) to isoleucine (I) at codon 51, cysteine (C) to arginine (R) at codon 59, serine (S) to asparagine (N) at codon 108 and valine (V) to alanine (A) at codon 45 for Pfdhfr; lysine (K) to glutamate (E) at codon 540 and arginine (R) retained at codon 449 for Pfdhps and wild-type amino acids retained for Pfkelch-13 (Table 4). Multiple sequence alignment (MSA) and visualization of consensus sequence assemblies for Pfdhfr, Pfdhps and Pfkelch-13 against their 3D7 reference sequences distinguished four non-synonymous (nsy) point mutations for Pfdhfr (N51I, C59R, S108N, V45A), one non-synonymous (nsy) point mutation (K540E) and one synonymous (sy) point mutation (R449R) for Pfdhps while Pfkelch-13 retained wild-type amino acids (Figure 1).

Table 3. P. falciparum nested-PCR results for PfK-13, Pfdhps and Pfdhfr genes from the hospital sites in Eritrea.

Hospital site (code)	Total no. of samples collected	No. of PCR positive isolates N (%)	Isolate serial no.	PCR positive isolates N per molecular marker
Hospital site (code)	Total no. of samples collected	No. of PCR positive isolates N (%)	Isolate serial no.	PfK-13	Pfdhps	Pfdhfr
Adi Quala Hospital (AQH)	10	2 (20%)	AQH009, AQH010	2	0	2
Keren Hospital (KH)	3	2 (67%)	KH012, KH013	1	2	1
Gash Barka Hospital (GBH)	6	4 (67%)	GBH014, GBH015, GBH017, GBH018, GBH019	3	4	2

Table 4. Pfdhfr, Pfdhps and PfK-13 results for corresponding nucleotide- and amino acid-changes across the hospital sites in Eritrea.

N = asparagine, I = isoleucine, C = cysteine, R = arginine, S = serine, V = valine, A = alanine.

Molecular marker	Nucleotide base change			Amino acid change		No. of isolates per hospital
Molecular marker	Position (p)	From	To	Codon (c)	Wild-type	Mutant	Adi Quala (AQH)	Keren (KH)	Gash Barka (GBH)
Pfdhfr	152	AaT	AtT	51	N	I	2	1	1
	175	tGT	cGT	59	C	R	0	1	0
	323	AgC	AaC	108	S	N	2	1	1
	134	GtA	GcA	45	V	A	2	1	1
Pfdhps	1618	aAA	gAA	540	K	E	0	1	3
Pfdhps	1347	AGa	AGg	449	R	R	0	0	1
PfK-13	1738	TgT	TaT	580	Y	C	0	-	0
	1660	AaT	AgT	554	N	S	0	-	0
	1705	gCA	aCA	569	A	S	0	-	0
	1696	gTA	aTA	566	V	I	0	-	0
	1732	gCT	tCT	578	A	S	0	-	0
	1477	tAC	cAC	493	Y	H	0	0	0
	1615	AgA	AcA	539	R	T	0	0	0
	1627	AtT	AcT	543	I	T	0	0	0

Note: The bold depicts the respective nucleotide base changes. The numeral ‘0’ indicates absence of isolates with the respective nucleotide/amino acid changes The dash (-) symbol implies no sequence data generated from the respective hospital sites.

Figure 1.

Jalview visualization of multiple sequence alignments depicting nsy- and sy-point mutations: Pfdhfr (N51I, S108N, V45A) occurred in all four isolates (KH013, GBH017, AQH010, AQH009), C59R was identified in one isolate (KH013); Pfdhps (K540E) occurred in all four isolates (KH013, GBH017, AQH010, AQH009), R449R was identified in one isolate (GBH015) and Pfdhps (K540E) occurred in all four isolates (KH012, GBH014, GBH015, GBH017) PfK-13, established no point mutations in all six isolates, wild type amino acids retained at c.554(S), c.566(V), c.569(A), c.578(A), c.580(C), c.493(Y), c.539(R), c.543 (I).

Discussion

In this study, we present findings from a pilot survey assessing the occurrence of point mutations in PfK-13, Pfdhfr and Pfdhps genes from clinical isolates obtained from three zobas of Eritrea: Adi Quala (Adi Quala Hospital), Debub (Keren Hospital) and Anseba (Gash Barka Hospital). We targeted PCR-amplification of PfK-13 point mutations associated with artemisinin (ART) resistant phenotype in western Cambodia, South-East Asia Y493H, R539T, I543T, C580Y,¹⁴ non-synonymous point mutations, V566I, A578S, identified in isolates from five Sub-Saharan countries²³ and N554S, A569S reported in a previous study from islands in Lake Victoria, Kenya.²⁴ This study found none of the corresponding point mutations in PfK-13, which is similar to other studies from Eritrea²⁵ and Kenya^26,27 including other malaria endemic sub-Saharan countries.²⁸ Data from the treatment outcome with the prescribed artemisinin (artesunate [AS]) indicated susceptibility responses corresponding with our findings and suggesting a likely absence of ART resistance. Only one isolate from these analyses was obtained from a patient who did not respond to first line treatment with AS-AQ – this could be attributed to possible causes of treatment failure such as non-compliance to the treatment regimen, incorrect drug usage, drug pharmacokinetics as well as host immunity.^29,30

Pfdhfr point mutations, N51I, C59R and S108N observed in our study correspond with previous reports from Senegal,³¹ South Africa,³² Malawi, Mali, Kenya, Tanzania,^33,34 including Venezuela in South America.³⁵ Additionally, the single Pfdhfr C59R and Pfdhps K540E point mutations seen in our findings, have been shown to predict the occurrence of the Pfdhfr-Pfdhps quintuple mutant haplotype (Pfdhfr 51I/59R/108N + Pfdhps 437G/540E),³⁶ which is associated with fully resistant SP parasites¹² as well as SP treatment failure.³⁷ The selection of these Pfdhfr-Pfdhps mutations from our findings, is attributable to the prior use of the CQ-SP combination as first-line treatment for clinical management of febrile disease especially at the primary health care level in Eritrea. Additionally, prior evidence shows that SP resistant parasites originated from South East Asia and consecutively spread into Sub-Saharan Africa,^38,39 which eventually reached Eritrea too, as demonstrated in these findings. The valine (V) to alanine (A) change at codon 45 in Pfdhfr from this study, has not been previously reported, although, a converse occurrence of alanine (A) to valine (V) at codon 16 has been associated, both singly and doubly in combination to S108N mutation, with resistance to another antifolate, cycloguanil.^40,41 Further investigation with a larger sample size is recommended to validate the selection of the V45A mutation in the population, as well as understand its implications to protein function in association with other established Pfdhfr mutations. Additionally, further detection of other SP resistance associated mutations not reported herein is recommended.

Although this study design availed treatment outcome information to compare with corresponding generated molecular data, limitation of sample size as well as DNA quality and quantity constrained further detection of PfK13 mutations associated with artemisinin resistance. Nonetheless, the general findings reported here, are not affected by these limitations and essentially provides useful molecular inference for further investigations.

Conclusions

Here, we provide molecular data verifying the genetic mechanism underlying SP resistance from selected participants of three regions of Eritrea. Pfdhfr C59R and Pfdhps K540E are reliable markers for the quintuple mutant haplotype conferring full resistance to SP. This study provides the molecular status of SP resistance in Eritrea. Continued monitoring of artemisinin resistance is recommended. Future studies should be carried out on a larger sample size since this study was a pilot survey involving a small sample size.

Data availability

Underlying data

This project contains the following underlying data:

NCBI Gene: bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322415, https://www.ncbi.nlm.nih.gov/nuccore/MZ322415.

NCBI Gene: bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322416, https://www.ncbi.nlm.nih.gov/nuccore/MZ322416.

NCBI Gene: bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322417, https://www.ncbi.nlm.nih.gov/nuccore/MZ322417.

NCBI Gene: bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322418, https://www.ncbi.nlm.nih.gov/nuccore/MZ322418.

NCBI Gene: hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase (PPPK-DHPS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322419, https://www.ncbi.nlm.nih.gov/nuccore/MZ322419.

NCBI Gene: hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase (PPPK-DHPS) [Plasmodium falciparum (malaria parasite)] Accession number MZ322420, https://www.ncbi.nlm.nih.gov/nuccore/MZ322420.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322423, https://www.ncbi.nlm.nih.gov/nuccore/MZ322423.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322424, https://www.ncbi.nlm.nih.gov/nuccore/MZ322424.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322425, https://www.ncbi.nlm.nih.gov/nuccore/MZ322425.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322426, https://www.ncbi.nlm.nih.gov/nuccore/MZ322426.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322427, https://www.ncbi.nlm.nih.gov/nuccore/MZ322427.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322428, https://www.ncbi.nlm.nih.gov/nuccore/MZ322428.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322429, https://www.ncbi.nlm.nih.gov/nuccore/MZ322429.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322430, https://www.ncbi.nlm.nih.gov/nuccore/MZ322430.

NCBI Gene: kelch protein (K13) (Kelch13) [Plasmodium falciparum (malaria parasite)] Accession number MZ322431, https://www.ncbi.nlm.nih.gov/nuccore/MZ322431.

Extended data

Dryad: Extended data for ‘Screening for Antifolate and Artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea’, https://doi.org/10.5061/dryad.sbcc2fr6q.²²

This project contains the following extended data:

• the total number of patients grouped according to age, who visited the three hospitals during the study period.
• gel images of Pfdhfr, Pfdhps and PfK13 genetic markers.

Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication).

Consent

All participants were informed concerning the aim of the study, assent and written informed consent was given by patients, voluntary participation was allowed, and confidentiality of information collected ensured.

Acknowledgements

The authors are grateful to all the participants of the study from the three hospitals and to Mr. Moses Ogugo (International Livestock Research Institute – Kenya) for the technical support.

References

1. MOH Ministry of Health: Malaria and other vector-borne diseases control strategy 2015-2019 in Eritrea. The national malaria control program .State of Eritrea:Ministry of Health;2014; 2014.
2. Nabarro DN, Tayler EM: The “roll back malaria” campaign. Science. 1998; 280(5372): 2067–8. PubMed Abstract | Publisher Full Text Reference Source
3. NMCP National Malaria Control Program Ministry of Health, State of Eritrea: Mandefera Declaration on Malaria control in Eritrea.2013.
4. Mufunda J, Nyarango P, Usman A, et al.: Roll back malaria - An African success story in Eritrea. S Afr Med J. 2007; 97(1): 46–50. PubMed Abstract Reference Source
5. Berhane A, Mihreteab S, Ahmed H, et al.: Gains attained in malaria control coverage within settings earmarked for pre-elimination: malaria indicator and prevalence surveys 2012, Eritrea. Malar J. 2015; 14(467): 1–10. PubMed Abstract | Publisher Full Text | Free Full Text
6. Kifle MM, Teklemariam TT, Teweldeberhan AM, et al.: Malaria Risk Stratification and Modeling the Effect of Rainfall on Malaria Incidence in Eritrea. J Environ Public Health. 2019; 2019: 1–11. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
7. Cui L, Mharakurwa S, Ndiaye D, et al.: Antimalarial drug resistance: Literature review and activities and findings of the ICEMR network. Am J Trop Med Hyg. 2015; 93: 57–68. PubMed Abstract | Publisher Full Text | Free Full Text
8. Vestergaard LS, Ringwald P: Responding to the challenge of antimalarial drug resistance by routine monitoring to update national malaria treatment policies. Am J Trop Med Hyg. 2007; 77(SUPPL. 6): 153–9. PubMed Abstract Reference SourceNBK1708/
9. Vinayak S, Alam MT, Mixson-Hayden T, et al.: Origin and evolution of sulfadoxine resistant Plasmodium falciparum. PLoS Pathog. 2010; 6(3): e1000830. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
10. Constanzo MS, Hartl DL: The evolutionary landscape of antifolate resistance in Plasmodium falciparum. J Genet. 2011; 90(2): 187–90. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
11. Plowe CV: The evolution of drug-resistant malaria. Trans R Soc Trop Med Hyg. 2009; 103(1 SUPPL): S11. PubMed Abstract | Publisher Full Text | Free Full Text
12. Naidoo I, Roper C: Mapping “partially resistant”, “fully resistant”, and “super resistant” malaria. Vol. 29, Trends in Parasitology. Trends Parasitol. 2013: 505–15. PubMed Abstract | Publisher Full Text
13. Takala-Harrison S, Jacob CG, Arze C, et al.: Independent emergence of artemisinin resistance mutations among Plasmodium falciparum in Southeast Asia. J Infect Dis. 2015; 211(5): 670–9. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
14. Ariey F, Witkowski B, Amaratunga C, et al.: A molecular marker of artemisinin- resistant Plasmodium falciparum malaria. Nature. 2013; 505(7481): 50–5. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
15. Ashley EA, Dhorda M, Fairhurst RM, et al.: Spread of Artemisinin Resistance in Plasmodium falciparum Malaria. N Engl J Med. 2014; 371(5): 411–23. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
16. Witkowski B, Khim N, Chim P, et al.: Reduced Artemisinin Susceptibility of Plasmodium falciparum Ring Stages in Western Cambodia. Antimicrob Agents Chemother. 2013; 57(2): 914–23. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
17. Dondorp AM, Nosten F, Yi P, et al.: Artemisinin Resistance in Plasmodium falciparum Malaria. N Engl J Med. 2009; 361(5): 455–67. PubMed Abstract | Publisher Full Text | Free Full Text
18. Schneeberger C, Kury F, Larsen J, et al.: A simple method for extraction of DNA from guthrie cards. Genome Res. 1992; 2(2): 177–9. PubMed Abstract | Publisher Full Text Reference Source
19. Kumar S, Stecher G, Tamura K: MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016; 33(7): 1870–4. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
20. Edgar RC: MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics. 2004; 5. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
21. Waterhouse AM, Procter JB, Martin DMA, et al.: Jalview Version 2-A multiple sequence alignment editor and analysis workbench. Bioinformatics. 2009; 25(9): 1189–91. PubMed Abstract | Publisher Full Text | Free Full Text
22. Mukhongo Natabona H, Kinyua Kang’ethe J, Gebrekidan Weldemichael Y, et al.: Extended data for: Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea. Dryad. 2021. Publisher Full Text
23. Kamau E, Campino S, Amenga-Etego L, et al.: K13-propeller polymorphisms in Plasmodium falciparum parasites from sub-Saharan Africa. J Infect Dis. 2015; 211(8): 1352–5. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
24. Isozumi R, Uemura H, Kimata I, et al.: Novel mutations in K13 propeller gene of artemisinin-resistant Plasmodium falciparum. Emerg Infect Dis. 2015; 21(3): 490–2. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
25. Menegon M, Nurahmed AM, Talha AA, et al.: Molecular surveillance of antimalarial drug resistance related genes in Plasmodium falciparum isolates from Eritrea. Acta Trop. 2016; 157: 158–61. PubMed Abstract | Publisher Full Text Reference Source
26. Hemming-Schroeder E, Umukoro E, Lo E, et al.: Impacts of antimalarial drugs on plasmodium falciparum drug resistance markers, Western Kenya, 2003-2015. Am J Trop Med Hyg. 2018; 98(3): 692–9. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
27. Wamae K, Okanda D, Ndwiga L, et al.: No Evidence of Plasmodium falciparum k13 Artemisinin Resistance-Conferring Mutations over a 24-Year Analysis in Coastal Kenya but a near Complete Reversion to Chloroquine-Sensitive Parasites. Antimicrob Agents Chemother. 2019; 63(12). PubMed Abstract | Publisher Full Text | Free Full Text
28. Taylor SM, Parobek CM, DeConti DK, et al.: Absence of putative artemisinin resistance mutations among Plasmodium falciparum in Sub-Saharan Africa: a molecular epidemiologic study. J Infect Dis. 2015; 211(5): 680–8. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
29. Klein EY: Antimalarial drug resistance: A review of the biology and strategies to delay emergence and spread. Int J Antimicrob Agents . Elsevier B.V.;2013; 41: p. 311–7. PubMed Abstract | Publisher Full Text | Free Full Text
30. Petersen I, Eastman R, Lanzer M: Drug-resistant malaria: Molecular mechanisms and implications for public health. FEBS Lett. 2011; 585(11): 1551–62. PubMed Abstract | Publisher Full Text
31. Ndiaye D, Daily JP, Sarr O, et al.: Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in Senegal. Trop Med Int Heal. 2005; 10(11): 1176–9. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
32. Roper C, Pearce R, Bredenkamp B, et al.: Antifolate antimalarial resistance in southeast Africa: A population-based analysis. Lancet. 2003; 361(9364): 1174–81. PubMed Abstract | Publisher Full Text Reference Source
33. Plowe CV, Cortese JF, Djimde A, et al.: Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase and epidemiologic patterns of pyrimethamine-sulfadoxine use and resistance. J Infect Dis. 1997; 176(6): 1590–6. PubMed Abstract | Publisher Full Text Reference Source
34. Wang P, Lee CS, Bayoumi R, et al.: Resistance to antifolates in Plasmodium falciparum monitored by sequence analysis of dihydropteroate synthetase and dihydrofolate reductase alleles in a large number of field samples of diverse origins. Mol Biochem Parasitol. 1997; 89(2): 161–77. PubMed Abstract | Publisher Full Text Reference Source
35. Urdaneta L, Plowe C, Goldman I, et al.: Point mutations in dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum isolates from Venezuela. Am J Trop Med Hyg. 1999; 61(3): 457–62. PubMed Abstract | Publisher Full Text Reference Source
36. Kublin JG, Dzinjalamala FK, Kamwendo DD, et al.: Molecular markers for failure of sulfadoxine-pyrimethamine and chlorproguanil-dapsone treatment of Plasmodium falciparum malaria. J Infect Dis. 2002; 185: 380–8. PubMed Abstract | Publisher Full Text Reference Source
37. Okell LC, Griffin JT, Roper C: Mapping sulphadoxine-pyrimethamine-resistant Plasmodium falciparum malaria in infected humans and in parasite populations in Africa. Sci Rep. 2017; 7(1): 7389. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
38. Mita T, Venkatesan M, Ohashi J, et al.: Limited geographical origin and global spread of sulfadoxine-resistant dhps alleles in plasmodium falciparum populations. J Infect Dis. 2011; 204(12): 1980–8. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
39. Roper C, Pearce R, Nair S, et al.: Intercontinental spread of pyrimethamine-resistant malaria. Science (80-). 2004; 305(5687): 1124. PubMed Abstract | Publisher Full Text Reference Source
40. Sirawaraporn W, Sathitkul T, Sirawaraporn R, et al.: Antifolate-resistant mutants of Plasmodium falciparum dihydrofolate reductase. Proc Natl Acad Sci U S A. 1997; 94(4): 1124–9. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
41. Sridaran S, McClintock SK, Syphard LM, et al.: Anti-folate drug resistance in Africa: Meta-analysis of reported dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) mutant genotype frequencies in African Plasmodium falciparum parasite populations. Malaria Journal. BioMed Central. 2010; 9: 247. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

Comments on this article Comments (0)

Version 4

VERSION 4 PUBLISHED 21 Jul 2021

Author details Author details

Harriet Natabona Mukhongo
Roles: Formal Analysis, Investigation, Methodology, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Johnson Kang'ethe Kinyua
Roles: Formal Analysis, Methodology, Supervision, Validation, Visualization, Writing – Review & Editing

Yishak Gebrekidan Weldemichael
Roles: Conceptualization, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

This work was supported by Japan International Cooperation Agency (JICA) – Eritrea (Reference no. ODA/2014-TC/13) to YGW and RWK and Association of African Universities (AAU) small grants for theses and dissertations program to HNM (Reference no. PC/6/2016-2017).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (4)

version 4

Revised

Published: 12 Jun 2024, 10:628

https://doi.org/10.12688/f1000research.54195.4

version 3

Revised

Published: 02 May 2024, 10:628

https://doi.org/10.12688/f1000research.54195.3

version 2

Revised

Published: 02 Feb 2023, 10:628

https://doi.org/10.12688/f1000research.54195.2

version 1

Published: 21 Jul 2021, 10:628

https://doi.org/10.12688/f1000research.54195.1

© 2023 Mukhongo HN et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Mukhongo HN, Kinyua JK, Weldemichael YG and Kasili RW. Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea [version 2; peer review: 2 not approved]. F1000Research 2023, 10:628 (https://doi.org/10.12688/f1000research.54195.2)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 2

VERSION 2

PUBLISHED 02 Feb 2023

Revised

Views

Reviewer Report 25 Apr 2023

Sam L Nsobya, Infectious Disease Research Collaboration (IDRC),, Kampala, Uganda

Not Approved

https://doi.org/10.5256/f1000research.142771.r163672

The study was about screening known single nucleotide polymorphisms mediating resistance in pfdhfr, pfdhps and K13 genes from the clinical samples collected from Eritrea health facilities.

Comments:

The objective was not smart and

The study was about screening known single nucleotide polymorphisms mediating resistance in pfdhfr, pfdhps and K13 genes from the clinical samples collected from Eritrea health facilities.

Comments:

The objective was not smart and study poorly designed
The sample size was inadequate i.e only 19 samples analyzed and out of those 42% samples did not generate results and no reason was given. It is also not explained: why after consent,19 dried blood spot (DBS) samples were successfully collected from a total of 131 patients who visited the three hospitals during the study period
The inclusion criteria: blood samples were obtained from patients with febrile illness. No screening using microscopy or rapid diagnostic test.
Methodology section was poorly written
Statistical and bioinformatics poorly analyzed and written
The conclusion does not reflect the data generated and the write up is ambiguous i.e statement like Pfdhfr C59R and Pfdhps K540E are reliable markers for the quintuple mutant haplotype conferring full resistance to SP.

My conclusion: This article is not worthy of indexing because the way it was designed and written.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

No

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: PhD holder in malaria drug resistance expert for the past 27 years

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

CITE

Report a concern

Author Response 02 May 2024

Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya

02 May 2024

Author Response

Response to 1st comment:
Thank you for your feedback. The objectives have been reviewed and included in the introduction.

Response to 2nd and 3rd comment:
Thank you for your ... Continue reading Response to 1st comment:
Thank you for your feedback. The objectives have been reviewed and included in the introduction.

Response to 2nd and 3rd comment:
Thank you for your feedback. This has been reviewed in the methods.

Response to 4th comment:
Thank you for your feedback. The methodology has been reviewed.

Response to 5th comment:
Thank you for your feedback. The methodology and results have been reviewed.

Response to 6th comment:
Thank you for your feedback. The abstract and write-up have been reviewed.

Please also view the responses in the file linked here.
Response to 1st comment:
Thank you for your feedback. The objectives have been reviewed and included in the introduction.

Response to 2nd and 3rd comment:
Thank you for your feedback. This has been reviewed in the methods.

Response to 4th comment:
Thank you for your feedback. The methodology has been reviewed.

Response to 5th comment:
Thank you for your feedback. The methodology and results have been reviewed.

Response to 6th comment:
Thank you for your feedback. The abstract and write-up have been reviewed.

Please also view the responses in the file linked here.
Competing Interests: No competing interests disclosed Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 02 May 2024

Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya

02 May 2024

Author Response

Response to 1st comment:
Thank you for your feedback. The objectives have been reviewed and included in the introduction.

Response to 2nd and 3rd comment:
Thank you for your ... Continue reading Response to 1st comment:
Thank you for your feedback. The objectives have been reviewed and included in the introduction.

Response to 2nd and 3rd comment:
Thank you for your feedback. This has been reviewed in the methods.

Response to 4th comment:
Thank you for your feedback. The methodology has been reviewed.

Response to 5th comment:
Thank you for your feedback. The methodology and results have been reviewed.

Response to 6th comment:
Thank you for your feedback. The abstract and write-up have been reviewed.

Please also view the responses in the file linked here.
Response to 1st comment:
Thank you for your feedback. The objectives have been reviewed and included in the introduction.

Response to 2nd and 3rd comment:
Thank you for your feedback. This has been reviewed in the methods.

Response to 4th comment:
Thank you for your feedback. The methodology has been reviewed.

Response to 5th comment:
Thank you for your feedback. The methodology and results have been reviewed.

Response to 6th comment:
Thank you for your feedback. The abstract and write-up have been reviewed.

Please also view the responses in the file linked here.
Competing Interests: No competing interests disclosed Close
Report a concern

Views

Reviewer Report 20 Feb 2023

Olusola Ojurongbe, Department of Medical Microbiology & Parasitology, Ladoke Akintola University of Technology, Ogbomoso, Nigeria

Not Approved

https://doi.org/10.5256/f1000research.142771.r162212

Thanks for your detailed response to my review.

I will suggest you include some of the information in your response to my comment that justifies the need to carry out pfdhfr and pfdhps mutations in the introduction. For example,

Thanks for your detailed response to my review.

I will suggest you include some of the information in your response to my comment that justifies the need to carry out pfdhfr and pfdhps mutations in the introduction. For example, “Eritrea changed drug policy from SP to ACT in 2007” and the fact “SP has only been used as a first-line treatment in combination with Chloroquine in malaria treatment for the general population” this information will help the reader to appreciate the need for pfdhfr and pfdhps mutations surveillance in your study.
Although the scope of your study did not include in vivo study, the reported drug outcomes needed to be explained for reproducibility purposes. On what day after treatment was the “responded” or “did not respond” determined? Eight patients underwent re-treatment with quinine, how many days after the initial treatment? This information should be presented since this is a standardized research.

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Medical Parasitology

CITE

Report a concern

Author Response 02 May 2024

Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya

02 May 2024

Author Response

Response to comment 1:
Thank you for your suggestion. This information has been included in the introduction and discussion sections of the article.

Response to comment 2:
Thank you ... Continue reading Response to comment 1:
Thank you for your suggestion. This information has been included in the introduction and discussion sections of the article.

Response to comment 2:
Thank you for your suggestion. This information has been included 'sample characteristics and collection' and 'microscopy analyses' sub-sections of the article

Please also view the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.

Please kindly note that in the above PDF file, the authors' responses to Reviewer 1's report for Version 2 of the article are found under the "Responses to 2nd set of comments from reviewer 1: Olusola Ojurongbe" section.
Response to comment 1:
Thank you for your suggestion. This information has been included in the introduction and discussion sections of the article.

Response to comment 2:
Thank you for your suggestion. This information has been included 'sample characteristics and collection' and 'microscopy analyses' sub-sections of the article

Please also view the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.

Please kindly note that in the above PDF file, the authors' responses to Reviewer 1's report for Version 2 of the article are found under the "Responses to 2nd set of comments from reviewer 1: Olusola Ojurongbe" section.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 02 May 2024

Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya

02 May 2024

Author Response

Response to comment 1:
Thank you for your suggestion. This information has been included in the introduction and discussion sections of the article.

Response to comment 2:
Thank you ... Continue reading Response to comment 1:
Thank you for your suggestion. This information has been included in the introduction and discussion sections of the article.

Response to comment 2:
Thank you for your suggestion. This information has been included 'sample characteristics and collection' and 'microscopy analyses' sub-sections of the article

Please also view the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.

Please kindly note that in the above PDF file, the authors' responses to Reviewer 1's report for Version 2 of the article are found under the "Responses to 2nd set of comments from reviewer 1: Olusola Ojurongbe" section.
Response to comment 1:
Thank you for your suggestion. This information has been included in the introduction and discussion sections of the article.

Response to comment 2:
Thank you for your suggestion. This information has been included 'sample characteristics and collection' and 'microscopy analyses' sub-sections of the article

Please also view the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.

Please kindly note that in the above PDF file, the authors' responses to Reviewer 1's report for Version 2 of the article are found under the "Responses to 2nd set of comments from reviewer 1: Olusola Ojurongbe" section.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Version 1

VERSION 1

PUBLISHED 21 Jul 2021

Views

Reviewer Report 25 Oct 2021

Olusola Ojurongbe, Department of Medical Microbiology & Parasitology, Ladoke Akintola University of Technology, Ogbomoso, Nigeria

Not Approved

https://doi.org/10.5256/f1000research.57655.r95573

Mukhongo et al. presented a study highlighting the prevalence of P. falciparum dhfr, dhps, and K13 gene mutations in parasites collected in Eritrea. The subject of P. falciparum drug-resistant and gene mutations is very germane in malaria research, making this ... Continue reading

The focus of this study is quite confusing. It is not clear why the authors are investigating dhfr and dhps mutations in this cohort. The country is not currently using sulfadoxine-pyrimethamine (SP) for treatment, and the cohort being investigated also did not use SP either. WHO currently recommends SP for prevention among pregnant women and children (in some cases). Neither of these groups is being studied. The author needs to justify the reason for SP mutation analysis in this study. What would have been more interesting would have been PFCRT gene mutations since amodiaquine is still being used as a partner drug for artesunate.
The authors stated in the abstract section that the "study sought to verify the genetic mechanism of resistance to sulfadoxine-pyrimethamine." The genetic mechanism was not performed as stated by the authors in conclusion. All that the author did was report the mutations in dhps and dhfr genes. The identified mutations were not studied for their contributions to resistance in this cohort. While these mutations are well known for their contributions to resistance, many studies have reported these mutations without much compromise in SP cure rate, meaning that other additional factors are needed for resistance to occur. So for the authors to state that "we provide molecular data verifying the genetic mechanism underlying SP resistance" is not correct.
The authors stated that the patients were followed up. In Malaria studies, the standard WHO method of following up patients is to be observed on days 0,1,2,3, 7, 14, 21, and 28 or up to day 42. This will allow the definition of treatment failures (early, late, clinical, and parasitological) and adequate cure. The authors stated "responded" or "Did not respond." How did they arrive at this outcome? Was this outcome based on fever or parasite detection? What type of failures are they considering? is it re-infection or recrudescence? All these are important in the analysis of and contribution of gene mutations to resistance. In my view, since the authors did not genotype the samples collected on the days that the patient "Did not respond," this part should be expunged as it has little or no contribution to the data being presented.
It would be nice if the author could explain why only eight samples were successfully sequenced out of nineteen.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

No

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Medical Parasitology

CITE

Report a concern

Author Response 01 May 2024

Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya

01 May 2024

Author Response

Please find the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.
Competing Interests: No competing evidence disclosed
Please find the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.
Please find the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.
Competing Interests: No competing evidence disclosed Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 01 May 2024

Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya

01 May 2024

Author Response

Please find the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.
Competing Interests: No competing evidence disclosed
Please find the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.
Please find the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.
Competing Interests: No competing evidence disclosed Close
Report a concern

Comments on this article Comments (0)

Version 4

VERSION 4 PUBLISHED 21 Jul 2021

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 4 (revision) 12 Jun 24
Version 3 (revision) 02 May 24	read	read
Version 2 (revision) 02 Feb 23	read	read
Version 1 21 Jul 21	read

Olusola Ojurongbe, Ladoke Akintola University of Technology, Ogbomoso, Nigeria
Sam L Nsobya, Infectious Disease Research Collaboration (IDRC),, Kampala, Uganda

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

11 Views

04 Jun 2024 | for Version 3

Sam L Nsobya, Infectious Disease Research Collaboration (IDRC),, Kampala, Uganda

11 Views Cite this report Responses(1)

Approved

I approved the revised article.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

PhD holder in malaria drug resistance expert for the past 27 years

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (1)

Back to all reports

Reviewer Report

22 Views

09 May 2024 | for Version 3

Olusola Ojurongbe, Department of Medical Microbiology & Parasitology, Ladoke Akintola University of Technology, Ogbomoso, Nigeria

22 Views Cite this report Responses(1)

Approved

After reviewing the manuscript, I am pleased to see that the author has diligently incorporated my previous comments, resulting in significant improvements to the work.

I will suggest that the author should delete this statement in the introduction section- 'Hence, this study did not target the pregnant women or children groups'

'Generally, despite WHO’s change in treatment policy from the chloroquine (CQ)—sulfadoxine-pyrimethamine (SP) combination, adopted in 2002, to ACT in 2007, little is documented on the point mutations underlying SPR Pfdhfr and Pfdhps using genetic markers.' The author should explain what led to this change in policy. Was it that the mutation was high or, as a result, resistant observed in vivo?

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Medical Parasitology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (1)

Back to all reports

Reviewer Report

33 Views

25 Apr 2023 | for Version 2

Sam L Nsobya, Infectious Disease Research Collaboration (IDRC),, Kampala, Uganda

33 Views Cite this report Responses(1)

Not Approved

The study was about screening known single nucleotide polymorphisms mediating resistance in pfdhfr, pfdhps and K13 genes from the clinical samples collected from Eritrea health facilities.

Comments:

The objective was not smart and study poorly designed
The sample size was inadequate i.e only 19 samples analyzed and out of those 42% samples did not generate results and no reason was given. It is also not explained: why after consent,19 dried blood spot (DBS) samples were successfully collected from a total of 131 patients who visited the three hospitals during the study period
The inclusion criteria: blood samples were obtained from patients with febrile illness. No screening using microscopy or rapid diagnostic test.
Methodology section was poorly written
Statistical and bioinformatics poorly analyzed and written
The conclusion does not reflect the data generated and the write up is ambiguous i.e statement like Pfdhfr C59R and Pfdhps K540E are reliable markers for the quintuple mutant haplotype conferring full resistance to SP.

My conclusion: This article is not worthy of indexing because the way it was designed and written.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

No

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

PhD holder in malaria drug resistance expert for the past 27 years

Respond to this report

Responses (1)

Author Response

02 May 2024

Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya

Response to 1st comment:
Thank you for your feedback. The objectives have been reviewed and included in the introduction.

Response to 2nd and 3rd comment:
Thank you for your feedback. This has been reviewed in the methods.

Response to 4th comment:
Thank you for your feedback. The methodology has been reviewed.

Response to 5th comment:
Thank you for your feedback. The methodology and results have been reviewed.

Response to 6th comment:
Thank you for your feedback. The abstract and write-up have been reviewed.

Please also view the responses in the file linked here.

View more View less

Competing Interests

No competing interests disclosed

Back to all reports

Reviewer Report

32 Views

20 Feb 2023 | for Version 2

Olusola Ojurongbe, Department of Medical Microbiology & Parasitology, Ladoke Akintola University of Technology, Ogbomoso, Nigeria

32 Views Cite this report Responses(1)

Not Approved

Thanks for your detailed response to my review.

I will suggest you include some of the information in your response to my comment that justifies the need to carry out pfdhfr and pfdhps mutations in the introduction. For example, “Eritrea changed drug policy from SP to ACT in 2007” and the fact “SP has only been used as a first-line treatment in combination with Chloroquine in malaria treatment for the general population” this information will help the reader to appreciate the need for pfdhfr and pfdhps mutations surveillance in your study.
Although the scope of your study did not include in vivo study, the reported drug outcomes needed to be explained for reproducibility purposes. On what day after treatment was the “responded” or “did not respond” determined? Eight patients underwent re-treatment with quinine, how many days after the initial treatment? This information should be presented since this is a standardized research.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Medical Parasitology

Respond to this report

Responses (1)

Author Response

02 May 2024

Harriet Mukhongo, College of Health Sciences; Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology, Juja, P.O. Box 62000-00200, Nairobi, Kenya

Response to comment 1:
Thank you for your suggestion. This information has been included in the introduction and discussion sections of the article.

Response to comment 2:
Thank you for your suggestion. This information has been included 'sample characteristics and collection' and 'microscopy analyses' sub-sections of the article

Please also view the authors' response to Reviewer 1 (Dr. Olusola Ojurongbe) linked here.

Please kindly note that in the above PDF file, the authors' responses to Reviewer 1's report for Version 2 of the article are found under the "Responses to 2nd set of comments from reviewer 1: Olusola Ojurongbe" section.

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

54 Views

25 Oct 2021 | for Version 1

Olusola Ojurongbe, Department of Medical Microbiology & Parasitology, Ladoke Akintola University of Technology, Ogbomoso, Nigeria

54 Views Cite this report Responses(1)

Not Approved

The focus of this study is quite confusing. It is not clear why the authors are investigating dhfr and dhps mutations in this cohort. The country is not currently using sulfadoxine-pyrimethamine (SP) for treatment, and the cohort being investigated also did not use SP either. WHO currently recommends SP for prevention among pregnant women and children (in some cases). Neither of these groups is being studied. The author needs to justify the reason for SP mutation analysis in this study. What would have been more interesting would have been PFCRT gene mutations since amodiaquine is still being used as a partner drug for artesunate.
The authors stated in the abstract section that the "study sought to verify the genetic mechanism of resistance to sulfadoxine-pyrimethamine." The genetic mechanism was not performed as stated by the authors in conclusion. All that the author did was report the mutations in dhps and dhfr genes. The identified mutations were not studied for their contributions to resistance in this cohort. While these mutations are well known for their contributions to resistance, many studies have reported these mutations without much compromise in SP cure rate, meaning that other additional factors are needed for resistance to occur. So for the authors to state that "we provide molecular data verifying the genetic mechanism underlying SP resistance" is not correct.
The authors stated that the patients were followed up. In Malaria studies, the standard WHO method of following up patients is to be observed on days 0,1,2,3, 7, 14, 21, and 28 or up to day 42. This will allow the definition of treatment failures (early, late, clinical, and parasitological) and adequate cure. The authors stated "responded" or "Did not respond." How did they arrive at this outcome? Was this outcome based on fever or parasite detection? What type of failures are they considering? is it re-infection or recrudescence? All these are important in the analysis of and contribution of gene mutations to resistance. In my view, since the authors did not genotype the samples collected on the days that the patient "Did not respond," this part should be expunged as it has little or no contribution to the data being presented.
It would be nice if the author could explain why only eight samples were successfully sequenced out of nineteen.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

No

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Medical Parasitology

Respond to this report

Responses (1)

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. MOH Ministry of Health: Malaria and other vector-borne diseases control strategy 2015-2019 in Eritrea. The national malaria control program .State of Eritrea:Ministry of Health;2014; 2014.

[2] 2. Nabarro DN, Tayler EM: The “roll back malaria” campaign. Science. 1998; 280(5372): 2067–8. PubMed Abstract | Publisher Full Text Reference Source

[3] 3. NMCP National Malaria Control Program Ministry of Health, State of Eritrea: Mandefera Declaration on Malaria control in Eritrea.2013.

[4] 4. Mufunda J, Nyarango P, Usman A, et al.: Roll back malaria - An African success story in Eritrea. S Afr Med J. 2007; 97(1): 46–50. PubMed Abstract Reference Source

[5] 5. Berhane A, Mihreteab S, Ahmed H, et al.: Gains attained in malaria control coverage within settings earmarked for pre-elimination: malaria indicator and prevalence surveys 2012, Eritrea. Malar J. 2015; 14(467): 1–10. PubMed Abstract | Publisher Full Text | Free Full Text

[6] 6. Kifle MM, Teklemariam TT, Teweldeberhan AM, et al.: Malaria Risk Stratification and Modeling the Effect of Rainfall on Malaria Incidence in Eritrea. J Environ Public Health. 2019; 2019: 1–11. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[7] 7. Cui L, Mharakurwa S, Ndiaye D, et al.: Antimalarial drug resistance: Literature review and activities and findings of the ICEMR network. Am J Trop Med Hyg. 2015; 93: 57–68. PubMed Abstract | Publisher Full Text | Free Full Text

[8] 8. Vestergaard LS, Ringwald P: Responding to the challenge of antimalarial drug resistance by routine monitoring to update national malaria treatment policies. Am J Trop Med Hyg. 2007; 77(SUPPL. 6): 153–9. PubMed Abstract Reference SourceNBK1708/

[9] 9. Vinayak S, Alam MT, Mixson-Hayden T, et al.: Origin and evolution of sulfadoxine resistant Plasmodium falciparum. PLoS Pathog. 2010; 6(3): e1000830. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[10] 10. Constanzo MS, Hartl DL: The evolutionary landscape of antifolate resistance in Plasmodium falciparum. J Genet. 2011; 90(2): 187–90. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[11] 11. Plowe CV: The evolution of drug-resistant malaria. Trans R Soc Trop Med Hyg. 2009; 103(1 SUPPL): S11. PubMed Abstract | Publisher Full Text | Free Full Text

[12] 12. Naidoo I, Roper C: Mapping “partially resistant”, “fully resistant”, and “super resistant” malaria. Vol. 29, Trends in Parasitology. Trends Parasitol. 2013: 505–15. PubMed Abstract | Publisher Full Text

[13] 13. Takala-Harrison S, Jacob CG, Arze C, et al.: Independent emergence of artemisinin resistance mutations among Plasmodium falciparum in Southeast Asia. J Infect Dis. 2015; 211(5): 670–9. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[14] 14. Ariey F, Witkowski B, Amaratunga C, et al.: A molecular marker of artemisinin- resistant Plasmodium falciparum malaria. Nature. 2013; 505(7481): 50–5. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[15] 15. Ashley EA, Dhorda M, Fairhurst RM, et al.: Spread of Artemisinin Resistance in Plasmodium falciparum Malaria. N Engl J Med. 2014; 371(5): 411–23. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[16] 16. Witkowski B, Khim N, Chim P, et al.: Reduced Artemisinin Susceptibility of Plasmodium falciparum Ring Stages in Western Cambodia. Antimicrob Agents Chemother. 2013; 57(2): 914–23. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[17] 17. Dondorp AM, Nosten F, Yi P, et al.: Artemisinin Resistance in Plasmodium falciparum Malaria. N Engl J Med. 2009; 361(5): 455–67. PubMed Abstract | Publisher Full Text | Free Full Text

[18] 18. Schneeberger C, Kury F, Larsen J, et al.: A simple method for extraction of DNA from guthrie cards. Genome Res. 1992; 2(2): 177–9. PubMed Abstract | Publisher Full Text Reference Source

[19] 19. Kumar S, Stecher G, Tamura K: MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016; 33(7): 1870–4. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[20] 20. Edgar RC: MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics. 2004; 5. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[21] 21. Waterhouse AM, Procter JB, Martin DMA, et al.: Jalview Version 2-A multiple sequence alignment editor and analysis workbench. Bioinformatics. 2009; 25(9): 1189–91. PubMed Abstract | Publisher Full Text | Free Full Text

[22] 22. Mukhongo Natabona H, Kinyua Kang’ethe J, Gebrekidan Weldemichael Y, et al.: Extended data for: Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea. Dryad. 2021. Publisher Full Text

[23] 23. Kamau E, Campino S, Amenga-Etego L, et al.: K13-propeller polymorphisms in Plasmodium falciparum parasites from sub-Saharan Africa. J Infect Dis. 2015; 211(8): 1352–5. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[24] 24. Isozumi R, Uemura H, Kimata I, et al.: Novel mutations in K13 propeller gene of artemisinin-resistant Plasmodium falciparum. Emerg Infect Dis. 2015; 21(3): 490–2. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[25] 25. Menegon M, Nurahmed AM, Talha AA, et al.: Molecular surveillance of antimalarial drug resistance related genes in Plasmodium falciparum isolates from Eritrea. Acta Trop. 2016; 157: 158–61. PubMed Abstract | Publisher Full Text Reference Source

[26] 26. Hemming-Schroeder E, Umukoro E, Lo E, et al.: Impacts of antimalarial drugs on plasmodium falciparum drug resistance markers, Western Kenya, 2003-2015. Am J Trop Med Hyg. 2018; 98(3): 692–9. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[27] 27. Wamae K, Okanda D, Ndwiga L, et al.: No Evidence of Plasmodium falciparum k13 Artemisinin Resistance-Conferring Mutations over a 24-Year Analysis in Coastal Kenya but a near Complete Reversion to Chloroquine-Sensitive Parasites. Antimicrob Agents Chemother. 2019; 63(12). PubMed Abstract | Publisher Full Text | Free Full Text

[28] 28. Taylor SM, Parobek CM, DeConti DK, et al.: Absence of putative artemisinin resistance mutations among Plasmodium falciparum in Sub-Saharan Africa: a molecular epidemiologic study. J Infect Dis. 2015; 211(5): 680–8. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[29] 29. Klein EY: Antimalarial drug resistance: A review of the biology and strategies to delay emergence and spread. Int J Antimicrob Agents . Elsevier B.V.;2013; 41: p. 311–7. PubMed Abstract | Publisher Full Text | Free Full Text

[30] 30. Petersen I, Eastman R, Lanzer M: Drug-resistant malaria: Molecular mechanisms and implications for public health. FEBS Lett. 2011; 585(11): 1551–62. PubMed Abstract | Publisher Full Text

[31] 31. Ndiaye D, Daily JP, Sarr O, et al.: Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in Senegal. Trop Med Int Heal. 2005; 10(11): 1176–9. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[32] 32. Roper C, Pearce R, Bredenkamp B, et al.: Antifolate antimalarial resistance in southeast Africa: A population-based analysis. Lancet. 2003; 361(9364): 1174–81. PubMed Abstract | Publisher Full Text Reference Source

[33] 33. Plowe CV, Cortese JF, Djimde A, et al.: Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase and epidemiologic patterns of pyrimethamine-sulfadoxine use and resistance. J Infect Dis. 1997; 176(6): 1590–6. PubMed Abstract | Publisher Full Text Reference Source

[34] 34. Wang P, Lee CS, Bayoumi R, et al.: Resistance to antifolates in Plasmodium falciparum monitored by sequence analysis of dihydropteroate synthetase and dihydrofolate reductase alleles in a large number of field samples of diverse origins. Mol Biochem Parasitol. 1997; 89(2): 161–77. PubMed Abstract | Publisher Full Text Reference Source

[35] 35. Urdaneta L, Plowe C, Goldman I, et al.: Point mutations in dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum isolates from Venezuela. Am J Trop Med Hyg. 1999; 61(3): 457–62. PubMed Abstract | Publisher Full Text Reference Source

[36] 36. Kublin JG, Dzinjalamala FK, Kamwendo DD, et al.: Molecular markers for failure of sulfadoxine-pyrimethamine and chlorproguanil-dapsone treatment of Plasmodium falciparum malaria. J Infect Dis. 2002; 185: 380–8. PubMed Abstract | Publisher Full Text Reference Source

[37] 37. Okell LC, Griffin JT, Roper C: Mapping sulphadoxine-pyrimethamine-resistant Plasmodium falciparum malaria in infected humans and in parasite populations in Africa. Sci Rep. 2017; 7(1): 7389. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[38] 38. Mita T, Venkatesan M, Ohashi J, et al.: Limited geographical origin and global spread of sulfadoxine-resistant dhps alleles in plasmodium falciparum populations. J Infect Dis. 2011; 204(12): 1980–8. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[39] 39. Roper C, Pearce R, Nair S, et al.: Intercontinental spread of pyrimethamine-resistant malaria. Science (80-). 2004; 305(5687): 1124. PubMed Abstract | Publisher Full Text Reference Source

[40] 40. Sirawaraporn W, Sathitkul T, Sirawaraporn R, et al.: Antifolate-resistant mutants of Plasmodium falciparum dihydrofolate reductase. Proc Natl Acad Sci U S A. 1997; 94(4): 1124–9. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[41] 41. Sridaran S, McClintock SK, Syphard LM, et al.: Anti-folate drug resistance in Africa: Meta-analysis of reported dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) mutant genotype frequencies in African Plasmodium falciparum parasite populations. Malaria Journal. BioMed Central. 2010; 9: 247. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

Screening for antifolate and artemisinin resistance in Plasmodium falciparum clinical isolates from three hospitals of Eritrea

Abstract

Keywords

Revised Amendments from Version 1

Introduction

Methods

Ethical statement

Study sites and sample collection.

Genomic DNA extraction and PCR amplification

Table 1. Outer and nested primer sets used for PCR amplification of target gene regions.

Bioinformatics analysis

Results

Sample characteristics

Table 2. Patient description and treatment regimen data for dried blood spot samples collected from the hospital sites.

PCR amplification and point mutation analyses

Table 3. P. falciparum nested-PCR results for PfK-13, Pfdhps and Pfdhfr genes from the hospital sites in Eritrea.

Table 4. Pfdhfr, Pfdhps and PfK-13 results for corresponding nucleotide- and amino acid-changes across the hospital sites in Eritrea.

Figure 1.

Discussion

Conclusions

Data availability

Underlying data

Extended data

Consent

Acknowledgements

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated