A human mesenchymal spheroid prototype to replace moderate severity animal procedures in leukaemia drug testing

Aaron Wilson; Sean Hockney; Jessica Parker; Sharon Angel; Helen Blair; Deepali Pal

doi:10.12688/f1000research.123084.1

Home Browse A human mesenchymal spheroid prototype to replace moderate severity...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Brief Report

A human mesenchymal spheroid prototype to replace moderate severity animal procedures in leukaemia drug testing

[version 1; peer review: 2 approved with reservations]

Aaron Wilson¹, Sean Hockney², Jessica Parker², Sharon Angel¹, Helen Blair¹, Deepali Pal ^1,2

Aaron Wilson¹, Sean Hockney², [...] Jessica Parker², Sharon Angel¹, Helen Blair¹, Deepali Pal ^1,2

PUBLISHED 09 Nov 2022

Author details Author details

¹ Wolfson Childhood Cancer Research Centre, Translational and Clinical Research Institute, Newcastle University, UK, Newcastle upon Tyne, NE1 7RU, UK
² Applied Sciences, Northumbria University, Newcastle upon Tyne, NE1 8ST, UK

Aaron Wilson
Roles: Investigation, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Sean Hockney
Roles: Investigation, Visualization, Writing – Review & Editing

Jessica Parker
Roles: Investigation, Visualization, Writing – Review & Editing

Sharon Angel
Roles: Investigation, Visualization, Writing – Review & Editing

Helen Blair
Roles: Investigation, Methodology, Project Administration, Resources, Supervision, Visualization, Writing – Review & Editing

Deepali Pal
Roles: Conceptualization, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Supervision, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the NC3Rs gateway.

Abstract

Patient derived xenograft (PDX) models are regarded as gold standard preclinical models in leukaemia research, especially in testing new drug combinations where typically 45-50 mice are used per assay. 9000 animal experiments are performed annually in the UK in leukaemia research with these expensive procedures being classed as moderate severity, meaning they cause significant pain, suffering and visible distress to animal’s state. Furthermore, not all clinical leukaemia samples engraft and when they do data turnaround time can be between 6-12 months. Heavy dependence on animal models is because clinical leukaemia samples do not proliferate in vitro. Alternative cell line models though popular for drug testing are not biomimetic – they are not dependent on the microenvironment for survival, growth and treatment response and being derived from relapse samples they do not capture the molecular complexity observed at disease presentation. Here we have developed an in vitro platform to rapidly establish co-cultures of patient-derived leukaemia cells with 3D bone marrow mesenchyme spheroids, BM-MSC-spheroids. We optimise protocols for developing MSC-spheroid leukaemia co-culture using clinical samples and deliver drug response data within a week. Using three patient samples representing distinct cytogenetics we show that patient-derived-leukaemia cells show enhanced proliferation when co-cultured with MSC-spheroids. In addition, MSC-spheroids provided improved protection against treatment. This makes our spheroids suitable to model treatment resistance – a major hurdle in current day cancer management
Given this 3Rs approach is 12 months faster (in delivering clinical data), is a human cell-based biomimetic model and uses 45-50 fewer animals/drug-response assay the anticipated target end-users would include academia and pharmaceutical industry. This animal replacement prototype would facilitate clinically translatable research to be performed with greater ethical, social and financial sustainability.

Keywords

Animal replacement, 3D models, Preclinical models, cancer research, leukaemia

Corresponding author: Deepali Pal

Competing interests: No competing interests were disclosed.

Grant information: This work was supported by the National Centre for the Replacement Refinement and Reduction of Animals in Research (NC3Rs) (NC/P002412/1 [DP] and NC/V001639/1 [DP]); the Children's Cancer and Leukaemia Group (CCLGA 2016 05 BH160568); and Wellcome (OSR/0190/DPAL/NUSC).

Copyright: © 2022 Wilson A et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Wilson A, Hockney S, Parker J et al. A human mesenchymal spheroid prototype to replace moderate severity animal procedures in leukaemia drug testing [version 1; peer review: 2 approved with reservations]. F1000Research 2022, 11:1280 (https://doi.org/10.12688/f1000research.123084.1) First published: 09 Nov 2022, 11:1280 (https://doi.org/10.12688/f1000research.123084.1) Latest published: 06 Nov 2023, 11:1280 (https://doi.org/10.12688/f1000research.123084.2)

Research highlights

Scientific benefit

A 3D spheroid-based approach with improved clinical relevance for ex vivo co-culture of clinical leukaemia samples for further investigation into cancer biology such as blast-niche interactions, blast proliferation and treatment resistance.

3Rs benefit

To replace moderate severity animal (mice) procedures in leukaemia research and drug testing.

Practical benefit

3Rs approach that yields drug response data quickly and is more ethically, socially and financially sustainable than its in vivo counterparts.

Current applications

Exploration of leukaemia biology such as blasts proliferation, blast-niche interactions, niche-impacted treatment resistance and obtain drug response data.

Potential applications

Adapt the approach to include other haematological cancers as well as bone cancers.

Introduction

Leukaemia management is hindered by two chief obstacles: 1. Treatment still involves toxic chemotherapy drugs¹^,² 2. 15-20% of patients go into relapse at which point the disease can be treatment resistant.³ The nature of relapse disease highlights the need for safer and improved treatments such as targeted therapy. While many novel therapeutics have been identified, high drug attrition rates have been a major hindrance against anti-cancer drug development. 95% of bench side drugs that make it to phase 1 clinical trial never reach patients.⁴^–⁶ Three key areas⁵ have been identified that must be addressed in order to reduce attrition rates: 1. Increase in scientific collaboration 2. Preclinical studies and clinical trials must be tumour biology driven for the drug to be more therapeutically effective. 3. Lack of robust and translatable preclinical cancer models that could be used to screen out many unsuccessful therapeutics before going to trial.⁵

The gold standard preclinical model in leukaemia research is a patient derived xenograft model.⁷^–⁹ Recent Home Office annual returns show that 195,407 mice are used annually in cancer research. Indeed, cancer research remains the most common applied sciences area to use animal procedures. Given leukaemia research is heavily dependent on mouse models combining these metrics with financial data from major cancer funders in the UK suggest that 5% of these mice or at least 9000 mice are used in leukaemia research every year. Although leukaemia is a very aggressive disease, leukaemia cells do not maintain viability outside the body.⁹ This has led to the development of patient-derived xenograft (PDX) models where leukaemia cells are engrafted into the BM of immunocompromised mice. PDX models are currently the most clinically relevant models in blood cancer preclinical studies. Mouse PDX models (which are regarded as moderate severity procedures) are used to amplify patient-derived leukaemia cells, to study leukaemia biology and perform translational studies.⁸^,¹⁰ Patient-derived leukaemia cells can take anywhere between 2-12 months to engraft in mice before any preclinical drug testing can be carried out, hence these mice experiments are very time consuming. In addition, most of these procedures are considered to be moderate severity and often involve mice developing significant adverse effects such as weight loss, fur ruffling, back hunching as well as increased white cell counts.

The pipeline for preclinical testing using mouse PDX models are as documented in literature is: 1. Toxicity analysis to determine no observed adverse effect limit (NOAEL)/maximum tolerated dose (MTD): 15-20 mice per drug.¹¹ 2. Pharmacokinetic studies to determine drug maximum plasma/tissue levels and kinetics of drug clearance:15-30 mice per drug.¹² 3. Drug efficacy studies and pharmacodynamics assays on tumour cell response: 5-10 mice needed per drug treatment group.¹³ Per drug group a total of 40-50 animals are needed for single drug assays and twice as many for drug combination assays.¹¹^–¹³ In addition, in vitro cancer models preceding in vivo validation experiments rely on cell lines that show limited in vivo predictability. Cell lines retain cytogenic characteristics of acute lymphoblastic leukaemia (ALL), but being derived from patients with relapsed disease these samples do not represent the molecular complexity of disease at presentation.¹⁴^,¹⁵ Cell lines have also artificially adapted to grow in suspension culture which eliminates a key feature of leukaemia biology: microenvironment and its role in treatment resistance. Furthermore, these models are restricted by limited in vivo predictability and often lead to in vitro to in vivo drug attrition rates. This in turn results in unnecessary animal experiments which could have been avoided for these failed drug candidates, i.e., false positive data from cell line models.

ALL is a disease primarily of the bone marrow (BM) microenvironment (or leukemic niche), a compartment within the bone composed of cell types including mesenchymal stroma cells (MSC), osteoblasts, osteoclasts, endothelia, immune cells and supporting perivascular cells. Difficulty in growing and maintaining patient derived samples once they removed from the patient alludes to the vital role that the niche plays in cancer biology. Study into blast-niche interaction has unveiled some of the supportive roles the niche plays in disease, including cell-cell signalling, growth factors, cell adhesion and evidence has shown the niche providing an element of chemoprotection.¹⁶^,¹⁷ The niche particularly mesenchyme-blast interaction gives rise to two lymphoblast subpopulations, the first being a slow cycling, dormant population and the second being actively cycling disease propagating blasts.¹⁴^,¹⁸ Many treatments are effective in reducing the populations of active cycling blasts; however, it is reported that the dormant populations can survive treatment, seeking refuge within the niche. These dormant cells can later shift into the cycling state post treatment, leading to relapse disease.¹⁵^,¹⁸

Targeting of niche-blast interactions opens a door into a variety of potential therapeutic approaches. An example would be CXCL12, a chemokine secreted by stroma cells and upregulated in disease, it was discovered that CXCL12 induces a non-cycling state within LSCs, reducing the effectiveness of tyrosine kinase inhibitors. Mesenchymal cell CXCL12 knockout reversed this change and caused a phenotypic switch into disease propagating cycling blasts, temporarily increasing disease load but allowing once chemo resistant blasts to be treated.¹⁹ In preceding studies, we have developed ex vivo 2D co-culture platforms,¹⁴^,¹⁵ the purpose of which has been to 1. conduct preclinical drug screening using patient-derived leukaemia cells thereby reducing dependence on cell lines and consequently minimising in vitro to in vivo drug attrition rates and 2. Explore the impact of human BM cells in driving key elements of cancer biology such as leukaemia proliferation, dormancy and treatment resistance.¹⁴ Importantly, to build proof of confidence in application we show that such human relevant ex vivo platforms have 1. the potential to detect therapeutically exploitable targets that disrupt leukaemia-BM cell interactions conferring treatment resistance to the cancer cells. For example, using our ex vivo approach we reveal that CDH2 drives niche-mediated treatment resistance in leukaemia and that this interaction can be targeted via a drug ADH-1. In addition, we validate that CDH2 is indeed significantly upregulated in human leukaemia bone marrow thereby corroborating the strength of our ex vivo model in predicting human/clinical data. Such models also have greater experimental accessibility than in vivo procedures and thus mitigate reliance on mouse experiments to perform such mechanistic studies 2. We use our ex vivo approach to conduct ADH-1 drug testing on 15 different patient-derived clinical samples (i.e., biological replicates. We used previously cryopreserved PDX clinical samples generated historically in older projects) and drug combination testing on 3 patient-derived clinical samples. These ex vivo experiments informed our in vivo validation experiments so these could be streamlined to achieve optimal animal replacement. Although such 2D studies aim to successfully capture interaction of patient-derived leukaemia cells with cell components of the human BM niche/leukaemia microenvironment, 2D models do not portray functional biomimicry and consequently improved clinical relevance displayed by 3D models.

Recent advances in medicine have utilised 3D models as miniature in vitro representations of specific organs, they are produced in 3D and retain a realistic microanatomy, allowing a representational human model.²⁰ 3D models recapitulate their respective organ function and have been proven to be useful models of human disease, particularly in cancer research.²¹ 2D models cannot recapitulate the leukemic niche or the complex and varied interactions that influence leukemic cell growth.²² Current medicine is making use of organ-on-a-chip systems which have led to advances in liver and lung drug screening, providing more accurate toxicological reports than 2D systems.²⁰ The complex and dynamic nature of ALL and the bone marrow mesenchymal microenvironment makes it an ideal candidate for a more representative drug screening platform, this paper aims to do this by developing mesenchymal spheroids, which will support the culture of patient derived leukaemia samples allowing patient-specific therapeutic investigation.²³

Methods

Materials

Ethical approval

Patient-derived leukaemia blasts were obtained from the Newcastle Biobank (REC reference number 07/H0906/109+5). All samples were obtained following written informed consent. Animal data shown here reflect unpublished data that were existing from past experiments. PDX samples used in this project are from our cryopreserved PDX bank where the samples were generated in previous/earlier projects. All animal studies were carried out in accordance with UK Animals (Scientific Procedures) Act, 1986 under project licence P74687DB5 following approval of Newcastle University animal ethical review body (AWERB).

2D Niche-Blast co-culture

Patient derived ALL samples were cultured on 2D monolayers of MSC cells. MSC were seeded on Matrigel coated 48 well plates at 2×10⁴ cells/0.5 mL/2 cm² in their respective media (MSC media, Table 1). After 24 hours, the media was aspirated and the cells rinsed with 1 mL SFEM, Leukaemia blasts were then plated at a density of 0.25×10⁵ cells/mL per well suspended in SFEMII.

Table 1. Materials used.

Material	Manufacturer	Catalogue Identifier
General
Trypsin-EDTA Solution 10X	Sigma-Aldrich, Dorset, UK	59418C
Phosphate-Buffered Saline	Thermo Fisher Scientific, Hertfordshire, UK	10010023
Gentle Cell Dissociation Reagent	Stem Cell Technologies, Stem Cell, UK	100-0485
Heat Inactivated Foetal Bovine Serum	Thermo Fisher Scientific, Hertfordshire, UK	10500064
Matrigel HESC-Qualified Matrix	Corning, Kennebunk, USA	CLS354277
Low-glucose Dulbecco's Modified Eagle's Medium	Sigma-Aldrich, Dorset, UK	D5546
Cells
Primary Mesenchymal Stem Cells	Obtained from patients undergoing total hip replacement in view of osteoarthritis
PDX sample L707	Obtained from patient with E2A-HLF translocation
PDX sample L49120	Obtained from patient with BCR-ABL translocation
PDX sample MS40	Obtained from patient with MLL rearrangement
MSC culture media
Low-glucose Dulbecco's Modified Eagle's Medium	Sigma-Aldrich, Dorset, UK	D5546
Heat Inactivated Foetal Bovine Serum	Thermo Fisher Scientific, Hertfordshire, UK	10500064
Penicillin/Streptomycin	Sigma-Aldrich, Dorset, UK	P4333
Basic FGF	Sigma-Aldrich, Dorset, UK	PHG0024
L-Glutamine	Sigma-Aldrich, Dorset, UK	59202C
Matrigel HESC-Qualified Matrix	Corning, Kennebunk, USA	CLS354277
Leukaemia Blast Co-Culture
SFEM, Serum-Free Medium for Culture and Expansion	Stem Cell Technologies, Stem Cell, UK	09650
Organoid formation
AggreWellM 400 24-well Plate	Stem Cell Technologies, Cambridge, UK	34411
AggreWell Rinsing Solution	Stem Cell Technologies, Cambridge, UK	07010
Costar Ultra-low Attachment 6 Well Plate	Corning, Kennebunk, USA	3471
Real-Time PCR Analysis
QIAShredder	Qiagen, Manchester, UK	79656
Beta-mercaptoethanol	Sigma-Aldrich, Dorset, UK	M6250
RNEasy Mini Kit	Qiagen, Manchester, UK	74104
RNase-Free DNase Set	Qiagen, Manchester, UK	79254
Primer Sequences
CDH2 forward primer, Sigma-Aldrich, Dorset, UK	GGTGGAGGAGAAGAAGACCAG	OLIGO
CDH2 reverse primer, Sigma-Aldrich, Dorset, UK	GGCATCAGGCTCCACAGT	OLIGO
CD90 forward primer, Sigma-Aldrich, Dorset, UK	CACACATACCGCTCCCGAAC C	OLIGO
CD90 reverse primer, Sigma-Aldrich, Dorset, UK	GCTGATGCCCTCACACTT	OLIGO
NES forward primer, Sigma-Aldrich, Dorset, UK	AGAGGGGAATTCCTGGAG	OLIGO
NES reverse primer, Sigma-Aldrich, Dorset, UK	CTGAGGACCAGGACTCTCTA	OLIGO
GAPDH forward primer, Sigma-Aldrich, Dorset, UK	GAAGGTGAAGGTCGGAGTC	OLIGO
GAPDH reverse primer, Sigma-Aldrich, Dorset, UK	GAAGATGGTGATGGGATTTC	OLIGO

3D culture of BM-MSC

MSC cells were transferred to a 6-well low adhesion plate for suspension culture and cultured in 2 mL MSC media (Table 1) 3D for 48 hours, after which, MSC spheres were seen to form. Spheroids obtained thus were irregular in shape and therefore optimised experiments using Aggrewell400 plates were used to create uniform MSC spheres. Aggrewell plates were prepared by rinsing each well with 0.5 mL of Aggrewell rinsing solution, spinning at 1500 g for 5 minutes and aspirating. MSC cells were seeded at varying concentrations depending on desired sphere size. Cells were split using 1x trypsin solution and seeded in single cells on Aggrewell plates at desired concentration in MSC media. Aggrewell plates were spun at 100g for 3 minutes to ensure all cells reached the bottom of the microwells. After 48 hours, MSC spheroids were ready for harvest and transferred manually for culture onto low adhesion plates. Using a stereomicroscope fitted within a Class II biological safety cabinet the spheroids were transferred using a Gilson p1000 pipette tip with the end cut off using sterile scissors.

3D BM-Blast co-culture

Leukaemia cells from PDX samples were co-cultured with the MSC spheres in SFEMII at 2×10⁵ cells/mL in 5 ml of media in low adhesion 48 well plates over a 5 day period. On day of harvest, the cells and spheroids were harvested into a 30 ml conical flask. This was centrifuged at 1500 RPM for 5 minutes. After aspirating the supernatant, 0.5 ml of X1 Trypsin EDTA was added and cultures incubated at 37°C, 5% CO₂ for 2 minutes. Cells were mechanically dissociated into single cells by resuspending with a pipette. To the cells 4ml of FBS was added and this was centrifuged at 1500 RPM for 5 minutes. Supernatant was aspirated and cells were resuspended in 1ml of fresh SFEM media. During cell count leukaemia cells were distinguished from MSC based on their morphology and size difference, the MSC are 3-4 times the size of leukaemia cells.

Dexamethasone 3D drug assay

Investigation into Dexamethasone mediated treatment resistance was carried out through cell fate tracing. 10 million blasts were span at 500 g and resuspended in 10 mL of 5 uM CellTrace violet, incubated for 20 minutes at 37 degrees Celsius, 1 mL FBS was added and cells were span once more at 500 g for 5 minutes and resuspended in fresh SFEMII. Cells were then plated on 3D MSC spheres in 48 well plates as described above. 5 nM Dexamethasone (stock dissolved in ethanol to generate 10 mM Dexamethasone concentration, working concentration of dexamethasone was made by performing serial dilutions using SFEM media) was added to desired wells and blasts were cultured for 5 days. Experiments include 3 biological replicates with each replicate including 3 experimental replicates.

Extraction of mRNA

RNA was purified from cell pellets (viable cells centrifuged at 5000 g × 5 minutes followed by aspiration of supernatant media) using the RNeasy mini kit. Cells were resuspended in buffer RLT plus (containing 10 μl beta-mercaptoethanol/10 ml RLT) at either <5×10⁶ cells/350 μl buffer RLT plus or 1×10⁷ cells/600 μl buffer RLT plus. 1 volume of 70% ethanol was added to the RNA lysate and 700 μl of the cell suspension was transferred to a RNeasy mini spin column placed in a 2 ml collection tube, this was centrifuged at maximum speed for 30 seconds and the flow through discarded. The RNase-free DNase kit was used to remove contaminating DNA. 10 μl DNase I stock solution was added to 70 μl buffer RDD and mixed by gently inverting the tube, this solution was added directly to the column membrane and the sample incubated at room temperature for 15 minutes. 350 μl buffer RW1 was added and centrifuged at maximum speed for 30 seconds, the flow through was discarded. Next, 500 μl buffer RPE was added to the spin column, centrifuged at maximum speed for 30 seconds, and flowthrough discarded. Another 500 μl buffer RPE was added to the spin column, centrifuged at maximum speed for 2 minutes and the flow through discarded. The RNeasy spin column was transferred to a new 2 ml collection tube and centrifuged at maximum speed for 1 minute with the column lid open to dry the membrane. 30 μl RNase free water was then added to elute the sample, centrifuged for 1 minute at maximum speed and the flow through was collected. The RNA yield and quality was checked using the nanodrop ND-1000 spectrophotometer.

cDNA synthesis

RevertAidTMH Minus First Strand cDNA Synthesis Kit was used to synthesise cDNA from the RNA isolated. 500 ng RNA was collected and added to RNase/DEPC free water to a final volume of 11 μl. 1 μl (dN)6 (200 mg/l) random hexamers was added, mixed gently by inverting the vial and briefly centrifuged. Using a GeneAmp PCR system 2700 the sample was incubated at 65°C for 5 minutes, after which the sample was immediately placed on ice, 8 μl of the master mix (Table 2) was added, the samples were vortexed and briefly centrifuged. The samples were placed back in the PCR machine to incubate at 25°C for 10 minutes, 42°C for 60 minutes and 75°C for 10 minutes to terminate the reaction. The product was either used immediately for RT-PCR or stored at -20°C for short term storage.

Table 2. cDNA master mix constituents.

Reagents	Volume (μl)
5x Reaction Buffer	4
RNase Inhibitor	1
10mM dNTP	2
RevertAid H Minus MMLV RT	1
Total Volume	8

qRT-PCR

Upon receipt, primers were reconstituted in RNase/DNase free water to a final stock concentration of 100 μM. PCR Mix (Table 3) was loaded onto PCR plate in triplicates. The plate was sealed and centrifuged for 1 minute at 1000 RPM and placed in an applied Biosystems 7900HT Sequence Detection System. ViiA7TM System was used to run the qRT-PCR plate and cycle threshold (Ct) and melting curves were obtained for analysis.

Table 3. qRT-PCR mix constituents.

Reagents	Volume (μl)
SYBR Green	5
10μM Working Primer	0.3
RNase-free water	2.7
cDNA Sample	2
Total	10

Costings analysis of in vivo versus in vitro models

Costings of in vitro models were estimated using list prices of media, reagents and other materials associated with developing and using the models for a 2 drug combination dose finding assay. This included 5 biological replicates, 3 experimental repeats with each having 3 technical repeats with a total number of experiments of 45. These costs were divided into the following categories: Production of clinical/patient-derived leukaemia samples; in vitro CRISPR/RNAi organoid generation; Dose/IC50 finding for 2 drug combination; and evaluation of drug combination.

In vivo costings were calculated using figures obtained from the Comparative Biology Centre, Newcastle University. This included fixed costs including mouse purchase from an NSG in-house colony, housing and IVIS use. Comparative in vivo equivalents to the in vitro design accounted for: production of PDX engrafted tissue (5 PDX, 6 NSG mice/PDX); in vivo CRISPR/RNAi (control and treatment groups, 5 NSG mice each); Dose finding for 2 drug combination (3 mice per sex); and evaluation of the combination (4 arms, 6 mice per arm). All total costings were calculated using Microsoft Excel and figures were created using Microsoft Excel.

Data analysis

Microscopy images were analysed using the Windows download bundled with Java 8. Version 1.4.3. Real time qPCR data were captured and analysed using the StepOne Plus Real-Time PCR System (ThermoFisher Catalog No: 4376600) and Software package StepOne Software v23.

Results

Development and validation of BM-MSC spheres

We first show that BM-MSC/leukaemia 2D co-culture platform generates drug dose response data that is comparable with drug response observed in vivo in mouse models (Figure 1).²⁴ These data where we compare our in vitro data with in vivo data (unpublished data existing in the lab from earlier studies) show the predictive capacity of our 2D co-culture platform against mouse experiments. Improved in vivo predictability is important in ex vivo animal replacement models if these platforms are to meaningfully replace mouse experiments. We further perform pilot studies where we show that such ex vivo co-culture platforms have the ability to bring about significant replacement of animals for PDX models, which are the current gold standard preclinical leukaemia model (Figure 2). In order to fully recapitulate the complexity of the leukaemia niche, a 3D Model with improved biomimicry is required. 3D BM-MSC-spheroids were created by subculturing cells onto low adhesion non-tissue culture treated plates (Figure 3a,b). These spheroids were tested for expression levels of their respective niche markers using QT-PCR. It was found that both niche sphere types expressed mesenchymal markers CD90, CDH2 and Nestin (Figure 3c) similar to their 2D counterparts.

Figure 1. 2D in vitro platform delivers drug response data with high in vivo predictability to minimise in vitro to in vivo drug attrition rates.

Leukaemia cells from patient A is a responder to ABT199 (targets BCL2 in BCL2 positive ALL) and Dexamethasone drug combination in vitro and in vivo. On the other hand leukaemia cells from patient B do not respond to this drug combination in vitro and subsequently poor response is also noted in vivo using PDX mice models. Error bars shown refer to standard error (SE) using 4 mice per treatment group. Total flux is a surrogate of blast number in vivo. Dexamethasone and ABT-199 are used in the clinics to treat ALL.

Figure 2. Comparison of existing in vivo preclinical leukaemia models with newly developed ex vivo animal replacement organoid models.

Key benefits of the animal replacement organoid models include species specificity and consequently higher biomimicry.

Figure 3. Advancing the 2D ex vivo platform to develop 3D spheroid models.

Development and validation of MSC spheroid cultures through 3D suspension culture. Aggrewell plates allow for the creation of uniform 3D spheroids from single cell suspension of the desired cell-type. SD from three independent experiments (using MSC from same patient) are plotted as error bars. 2D (a), scale bar = 100 μM and 3D MSC (b), scale bar = 200 μM after 96 hours of growth. (c) mesenchymal marker levels quantified through qPCR and normalised to GAPDH. (d,e) MSC spheroids obtained through Aggrewell plate culture. Scale bar = 1000 μM (f) Cell seeding densities directly correlate to size of spheroids obtained. Data captured following 48 hours of seeding.

Aggrewell400 plates are designed for higher throughput and more uniform production of MSC spheres. Each well on these plates house 400 conical microwells, funnelling single cells and encouraging them to conglomerate into spheroids (Figure 3d). These microwells were utilised to create uniform niche spheres allowing standardisation of the technique when producing assays involving 3D spheres (Figure 3e). A direct correlation was observed with seeding cell density and size of spheroids with higher seeding densities resulting in generation of more uniformly sized spheroids (Figure 3f).

Patient-derived leukaemia cells co-cultured with MSC show superior proliferation and enhanced treatment resistance

ALL blasts from three different clinical samples were co-cultured with BM-MSC in routine 2D cultures and with 3D spheroids. Cell proliferation was monitored over a 5 day period through tryphan blue cell counts. We observed that when co-cultured with BM-MSC-spheroids the blasts showed 2-fold higher cell proliferation compared to 2D co-cultures (Figure 4a-c). Next, we repeated the co-cultures under treatment with the steroid Dexamethasone which is used to treat ALL. We observed that blasts showed marked reduction in sensitivity to Dexamethasone in 3D MSC organoid co-cultures compared to 2D co-cultures (Figure 4d-f). These data show the advantage of 3D organoid based co-culture systems over routine 2D cultures in two respects: 1. Achieving blast cycling which is essential for the action or testing of majority of anti-cancer treatments 2. Modelling treatment resistance in the laboratory – a major current day clinical challenge in cancer management. Finally, we perform a costs analysis and show improved financial sustainability in our ex vivo organoid platform compared to animal models (Figure 5).

Figure 4. Co-culture of patient derived leukaemia samples on both 2D and 3D MSC +/- treatment pressure.

N= 3 Error bars = SD. Increased growth kinetics of L49120 (a,d), MS40 (b,e) and L707D (c,f) across a 5 day period on 3D MSC feeder cells compared to a 2D monoculture. L49120, MS40 and L707D refer to three different patient samples, i.e., 3 biological repeats. Dexamethasone treatment is less effective in a 3D microenvironment (d,e,f).

Figure 5. A comparative costs analysis between 3D ex vivo and in vivo preclinical models show an approximate 30% costs benefit and consequently increased financial sustainability when using ex vivo organoid models.

Discussion

Relapse is still a major concern within the treatment of leukaemia, relapse disease is often chemo resistant, meaning many therapies cease working in patients with relapse disease leading to an increased mortality.³ Differing cytogenic abnormalities in this disease are known and patient stratification and precision medicine are implemented in an effort to treat individual disease in the most effective way possible, allowing weaknesses in tumour biology to be exploited therapeutically. However, high drug attrition rates remain a challenge when developing such improved treatments in ALL. High drug attrition has been attributed to preclinical models not being clinically translatable. Key barriers hindering bench to bedside translation when using complex in vivo models include species specificity, high financial costs, and lengthy experiments. Patient samples do not always engraft in mice. Samples that do engraft form successful xenograft models in 3-6 months at which point drug testing can be started which takes another 3-4 weeks.

A 3D BM-mesenchyme-leukaemia spheroid model will provide researchers with a biomimetic platform where clinical samples can be cultured within the context of their microenvironment, and patient specific drug testing performed within a week. Besides delivering drug response data within clinically relevant timeframes the relative simplicity of ex vivo spheroid models mean that they are tractable, transferrable and sustainable. Consequently, such models have wide applications in translational research in academia and industry alike. These models can be set up in laboratories and SMEs locally, nationally and globally that do not contain infrastructure for animal procedures. Following further extensive validation, such spheroid biobanks also have the potential to be embedded within clinical trials and healthcare systems for the purposes of detecting responders as well as to aid risk stratification.

In this paper we show that our 2D model itself brought about significant animal replacement locally. Leukaemia research at Newcastle requires 3600 animal procedures every year. Local metrics confirmed that using the 2D pilot approach we replaced mice in 67 drug tests last year. Given minimum of 40 animals are needed per drug test we replaced 2680 animals (out of 3600) which constituted a minimum 73% local animal replacement. To improve biomimicry and consequently translatability and transferability of our model, we develop 3D BM-mesenchyme spheroids. We show that these 3D spheroids show superior ability in supporting culture of leukaemia patient samples. We also show sensitivity of leukaemia cells to drugs such as dexamethasone is reduced when these cells are being co-cultured with 3D spheroids. This means that compared to 2D MSC cultures, MSC spheroids provide superior protection to leukaemia cells against dexamethasone treatment. are appropriate in modelling treatment resistance which remains a major clinical challenge in cancer management. This simple and tractable 3D prototype will form the first steppingstone in developing next generation 3D preclinical models with improved in vivo and patient drug response predictability. Such sustainable ex vivo models will ultimately replace existing moderate severity procedures in leukaemia research with models that successfully impact clinical outcome.

Data availability

Mendeley Data. A human mesenchymal spheroid prototype to replace moderate severity animal procedures in leukaemia drug testing. https://doi.org/10.17632/56npmkbpfb.1.²⁴

This project contains the following underlying data:

- 3D spheres.tif
- 3D Sphere.tif
- drug combination.xlsx
- in vivo Vs in vitro costs.xlsx
- Raw Figure Data.xlsx

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Acknowledgements

This study was funded by NC3Rs grants to DP. We thank NECCR for funding technical assistance at Newcastle University. We thank Professor Josef Vormoor, Professor Olaf Heidenreich and Dr. Kenneth Rankin, Newcastle University for provision of samples.

References

1. O'Connor D, et al.: Infection-related mortality in children with acute lymphoblastic leukemia: an analysis of infectious deaths on UKALL2003. Blood. 2014; 124: 1056–1061. PubMed Abstract | Publisher Full Text
2. Roberts KG: Genetics and prognosis of ALL in children vs adults. Hematology Am Soc Hematol Educ Program. 2018; 2018: 137–145. PubMed Abstract | Publisher Full Text
3. Locatelli F, Schrappe M, Bernardo ME, et al.: How I treat relapsed childhood acute lymphoblastic leukemia. Blood. 2012; 120: 2807–2816. Publisher Full Text
4. Seyhan AA: Lost in translation: the valley of death across preclinical and clinical divide – identification of problems and overcoming obstacles. Transl Med Commun. 2019; 4: 18. Publisher Full Text
5. Moreno L, Pearson AD: How can attrition rates be reduced in cancer drug discovery? Expert Opin Drug Discov. 2013; 8: 363–368. PubMed Abstract | Publisher Full Text
6. Hutchinson L, Kirk R: High drug attrition rates--where are we going wrong? Nat Rev Clin Oncol. 2011; 8: 189–190. PubMed Abstract | Publisher Full Text
7. Bomken S, et al.: Lentiviral marking of patient-derived acute lymphoblastic leukaemic cells allows in vivo tracking of disease progression. Leukemia. 2013; 27: 718–721. PubMed Abstract | Publisher Full Text
8. Martinez-Soria N, et al.: The Oncogenic Transcription Factor RUNX1/ETO Corrupts Cell Cycle Regulation to Drive Leukemic Transformation. Cancer Cell. 2018; 34: 626–642.e8. PubMed Abstract | Publisher Full Text
9. Pal D, et al.: Long-term in vitro maintenance of clonal abundance and leukaemia-initiating potential in acute lymphoblastic leukaemia. Leukemia. 2016; 30: 1691–1700. PubMed Abstract | Publisher Full Text
10. Matheson EC, et al.: Glucocorticoids and selumetinib are highly synergistic in RAS pathway-mutated childhood acute lymphoblastic leukemia through upregulation of BIM. Haematologica. 2019; 104: 1804–1811. PubMed Abstract | Publisher Full Text
11. Thomas HD, et al.: Preclinical selection of a novel poly (ADP-ribose) polymerase inhibitor for clinical trial. Mol Cancer Ther. 2007; 6: 945–956. PubMed Abstract | Publisher Full Text
12. Munck JM, et al.: Chemosensitization of cancer cells by KU-0060648, a dual inhibitor of DNA-PK and PI-3K. Mol Cancer Ther. 2012; 11: 1789–1798.
13. Scherr M, et al.: Differential expression of miR-17~92 identifies BCL2 as a therapeutic target in BCR-ABL-positive B-lineage acute lymphoblastic leukemia. Leukemia. 2014; 28: 554–565.
14. Pal D, et al.: hiPSC-derived bone marrow milieu identifies a clinically actionable driver of niche-mediated treatment resistance in leukemia. Cell Rep Med. 2022; 3: 100717. Publisher Full Text
15. Pal D, Heidenreich O, Vormoor J: Dormancy stems the tide of chemotherapy. Cancer cell. 2016; 30: 825–826. PubMed Abstract | Publisher Full Text
16. Baryawno N, et al.: A Cellular Taxonomy of the Bone Marrow Stroma in Homeostasis and Leukemia. Cell. 2019; 177: 1915–1932.e16. PubMed Abstract | Publisher Full Text
17. Duan CW, et al.: Leukemia propagating cells rebuild an evolving niche in response to therapy. Cancer Cell. 2014; 25: 778–793. Publisher Full Text
18. Ebinger S, et al.: Characterization of Rare, Dormant, and Therapy-Resistant Cells in Acute Lymphoblastic Leukemia. Cancer Cell. 2016; 30: 849–862. PubMed Abstract | Publisher Full Text
19. Agarwal P, et al.: Mesenchymal Niche-Specific Expression of Cxcl12 Controls Quiescence of Treatment-Resistant Leukemia Stem Cells. Cell Stem Cell. 2019; 24: 769–784.e6. PubMed Abstract | Publisher Full Text
20. Skardal A, Shupe T, Atala A: Organoid-on-a-chip and body-on-a-chip systems for drug screening and disease modeling. Drug Discov Today. 2016; 21: 1399–1411. PubMed Abstract | Publisher Full Text
21. Drost J, Clevers H: Organoids in cancer research. Nat Rev Cancer. 2018; 18: 407–418. Publisher Full Text
22. Garreta E, et al.: Fine tuning the extracellular environment accelerates the derivation of kidney organoids from human pluripotent stem cells. Nat Mater. 2019; 18: 397–405. Publisher Full Text
23. Shih YR, et al.: In vivo engineering of bone tissues with hematopoietic functions and mixed chimerism. Proc Natl Acad Sci U S A. 2017; 114: 5419–5424. PubMed Abstract | Publisher Full Text
24. Pal D, Wilson A, Blair H, et al.:A human mesenchymal spheroid prototype to replace moderate severity animal procedures in leukaemia drug testing. [Dataset]. Mendeley Data. 2022; V1. Publisher Full Text

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 09 Nov 2022

Author details Author details

Aaron Wilson
Roles: Investigation, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Sean Hockney
Roles: Investigation, Visualization, Writing – Review & Editing

Jessica Parker
Roles: Investigation, Visualization, Writing – Review & Editing

Sharon Angel
Roles: Investigation, Visualization, Writing – Review & Editing

Helen Blair
Roles: Investigation, Methodology, Project Administration, Resources, Supervision, Visualization, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

This work was supported by the National Centre for the Replacement Refinement and Reduction of Animals in Research (NC3Rs) (NC/P002412/1 [DP] and NC/V001639/1 [DP]); the Children's Cancer and Leukaemia Group (CCLGA 2016 05 BH160568); and Wellcome (OSR/0190/DPAL/NUSC).

Article Versions (2)

version 2

Revised

Published: 06 Nov 2023, 11:1280

https://doi.org/10.12688/f1000research.123084.2

version 1

Published: 09 Nov 2022, 11:1280

https://doi.org/10.12688/f1000research.123084.1

© 2022 Wilson A et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Wilson A, Hockney S, Parker J et al. A human mesenchymal spheroid prototype to replace moderate severity animal procedures in leukaemia drug testing [version 1; peer review: 2 approved with reservations]. F1000Research 2022, 11:1280 (https://doi.org/10.12688/f1000research.123084.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 09 Nov 2022

Views

Reviewer Report 31 Jan 2023

Helen Wheadon, Paul O'Gorman Leukaemia Research Centre, School of Cancer Sciences, University of Glasgow, Glasgow, UK

Approved with Reservations

https://doi.org/10.5256/f1000research.135152.r159730

The manuscript by Wilson et al. provides a convincing argument for the requirement of additional in vitro models to improve drug testing in acute lymphocytic leukaemia (ALL) and reduce the reliance on Xenograft mouse models. Preliminary data is presented supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid/primary ALL co-cultures for the use in preclinical testing of drugs. Proof of principle data is provided showing that simple 2D co-culture on MSCs gives a similar range of drug responses to dexamethasone and the BCL2 mimetic drug ABT199 as observed in in vivo studies for 2 primary ALL patient samples. The authors then show optimisation data using Aggrewell plates, demonstrating uniform spheroid formation and a corresponding increase in spheroid diameter when cell seeding density is increased. The final figure then compares primary ALL cell proliferation in 2D and 3D culture and drug responses to dexamethasone. Using 3 independent patient samples they show that MSC spheroids support cell proliferation over a 5 day time frame and provide protection to dexamethasone. These are important observations and support the introduction of a more physiologically relevant humanised system for drug screening prior to conducting in vivo studies. Another potential advantage would be if the authors had data demonstrating that the system supports patients' samples which do not engraft, as there is a high engraftment failure rate in Xenograft models with not all patient samples being successful. This could potentially lead to more robust data on patient’s responses. Given patient heterogeneity mouse models may be biasing certain traits/genetics due to the engraftment limitations observed.

Overall, the system if adopted by other researchers could potentially reduce animal numbers and suffering, reduce the cost and select the most promising drugs for additional testing. It would therefore have impact on replacement and reduction of mouse experiments.

However, there are some limitations in the results shown that would be strengthened by additional experiments:

The MSC are characterised by gene expression, it would be good to include flow cytometry data; CD90⁺105⁺73⁺34^-45^- are key markers demonstrating stemness. The culture conditions using FCS can also lead to changes in the MSCs so it would be good to include passage number. Figure 3 live/dead staining of the spheroids especially for the size used in the drug treatment assays in Figure 4 would be important to include.
Data showing that dexamethasone and ABT199 do not detrimentally affect the MSC monoculture and MSC spheroids would also be important to include.
Figure 4 looks at proliferation, apoptosis assays would be good to include to show whether cell death was occurring.
Data showing similar results in ALL patient samples known to fail to engraft in vivo would strengthen the rationale for adopting the 3D system.
Although the potential costs and animal savings presented are feasible, the system is quite simplistic and is more likely to be incorporated as an additional test rather than be adopted as a replacement. It would be more attractive if the time frame could be extended and more details on the application for high throughput screening development was discussed. Also, in vivo toxicity testing of novel compounds will still be required in order for regulatory approval for any Phase 1 clinical trial in humans to be progressed.

Minor corrections:

Research highlights - blasts would only be appropriate for certain types of leukaemia, either need to define it’s ALL specifically or change to stem/progenitor.

Scientific benefit:
A 3D spheroid-based approach with improved clinical relevance for ex vivo co-culture of primary patient leukaemia samples for further investigation into cancer biology such as stem/progenitor cell-niche interactions, stem/progenitor cell proliferation and treatment resistance.

3Rs benefit:
To replace moderate severity animal (mice) procedures in leukaemia research and early pre-clinical drug testing.

Current applications:
Exploration of leukaemia biology such as stem/progenitor cell proliferation, stem/progenitor cell -niche interactions, niche-impacted treatment resistance and obtain drug response data.

Introduction:

Need to define at the start that you are talking about ALL as it reads like a general overview which means some of the % incidence rates etc. are not correct. It would be good to mention what type of ALL as well, is it B-ALL, T-ALL, childhood, adult?
Paragraph 3 page 3: Most research groups would use primary patient samples in vitro prior to moving to in vivo models. This should be included.
Paragraph 2 Page 4: Remove blasts and replace with LSCs also include disease type chronic myeloid leukaemia.
Page 11 ‘such spheroid biobanks’: do they actually exist? Or are you planning on constructing a biobank?
‘MSC spheroids provide superior protection to leukaemia cells against dexamethasone treatment. are appropriate in modelling treatment resistance which remains a major clinical challenge in cancer management’.
Is this statement correct, not really looking at resistance, just reduced sensitivity to the drugs at that dose when in 3D rather than 2D culture. Need to amend and extend to include how you would look at resistance i.e. relapsed patients and the potential to interrogate resistance mechanisms.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Stem cells, leukaemia modelling, signalling, pre-clinical drug testing.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 28 Nov 2023

Deepali Pal, Wolfson Childhood Cancer Research Centre, Translational and Clinical Research Institute, Newcastle University, UK, Newcastle upon Tyne, NE1 7RU, UK

28 Nov 2023

Author Response

The manuscript by Wilson et al. provides a convincing argument for the requirement of additional in vitro models to improve drug testing in acute lymphocytic leukaemia (ALL) and reduce the ... Continue reading The manuscript by Wilson et al. provides a convincing argument for the requirement of additional in vitro models to improve drug testing in acute lymphocytic leukaemia (ALL) and reduce the reliance on Xenograft mouse models. Preliminary data is presented supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid/primary ALL co-cultures for the use in preclinical testing of drugs. Proof of principle data is provided showing that simple 2D co-culture on MSCs gives a similar range of drug responses to dexamethasone and the BCL2 mimetic drug ABT199 as observed in in vivo studies for 2 primary ALL patient samples. The authors then show optimisation data using Aggrewell plates, demonstrating uniform spheroid formation and a corresponding increase in spheroid diameter when cell seeding density is increased. The final figure then compares primary ALL cell proliferation in 2D and 3D culture and drug responses to dexamethasone. Using 3 independent patient samples they show that MSC spheroids support cell proliferation over a 5 day time frame and provide protection to dexamethasone. These are important observations and support the introduction of a more physiologically relevant humanised system for drug screening prior to conducting in vivo studies. Another potential advantage would be if the authors had data demonstrating that the system supports patients' samples which do not engraft, as there is a high engraftment failure rate in Xenograft models with not all patient samples being successful. This could potentially lead to more robust data on patient’s responses. Given patient heterogeneity mouse models may be biasing certain traits/genetics due to the engraftment limitations observed.
Overall, the system if adopted by other researchers could potentially reduce animal numbers and suffering, reduce the cost and select the most promising drugs for additional testing. It would therefore have impact on replacement and reduction of mouse experiments.
However, there are some limitations in the results shown that would be strengthened by additional experiments:
The MSC are characterised by gene expression, it would be good to include flow cytometry data; CD90+105+73+34-45- are key markers demonstrating stemness. The culture conditions using FCS can also lead to changes in the MSCs so it would be good to include passage number. Figure 3 live/dead staining of the spheroids especially for the size used in the drug treatment assays in Figure 4 would be important to include.
Response:
Additional data addressing these points have been added in Figure 2. We include flow cytometry data showing MSC in 3D spheroid format express CD105, CD90 and CD73. We include additional data showing the expression of casein Calcein (live cell dye) and Hoechst-33342 (live and dead cell dye) in MSC spheroids at a diameter of 100 µM, spheroid size used in subsequent experiments.
MSC passage number used was between p2 and p5, this has been clarified within Methods
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study9. MSC were used between passages ranging from p2 – p5. Data showing that dexamethasone and ABT199 do not detrimentally affect the MSC monoculture and MSC spheroids would also be important to include.
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for seven days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
Figure 4 looks at proliferation, apoptosis assays would be good to include to show whether cell death was occurring.
Response
We provide additional data showing propidium iodide, PI staining in ALL cells following treatment with dexamethasone.
We include following text within Results, Patient-derived leukaemia cells co-cultured with 3D MSC spheres show superior proliferation and enhanced treatment resistance.
“We find that ALL cells show greater reduction in sensitivity to dexamethasone when co-cultured with 3D BM-MSC (Fig.3.d-f). This could be owing to potentially improved functional cell-cell contacts and physiologically relevant cell polarity being achieved in a 3D format. This might have caused increased 3D versus 2D MSC-conferred ALL proliferation and/or improved ALL survival. However, reduced sensitivity could also be due to altered drug availability within 3D spheroids. These data highlight the advantage of 3D organoid-based co-culture systems over routine 2D cultures in two respects: 1. Achieving higher ALL cell cycling which is essential for the action or testing of majority of anti-cancer treatments 2. Obtaining reduced drug sensitivity, possibly owing to improved treatment resistance– a major current day clinical challenge in cancer management. We further investigate the ability of MSC-spheroids to reduce ALL cell death and find that when treated with a higher dose of dexamethasone, that is, at 10nM, then both 2D and 3D MSC-spheroids support survival of leukaemia cells (Fig.3.g.). We now progress to reveal proof-of-confidence-in-application data, justifying the suitability of our platform in conduction combinatorial drug testing.”
Data showing similar results in ALL patient samples known to fail to engraft in vivo would strengthen the rationale for adopting the 3D system.
Response
Unfortunately, we do not have ALL samples that fail to engraft. Nevertheless, we have previously shown the ability of the 2D MSC co-culture system to culture primary AML samples from t(8;21)-positive patients, which would not successfully engraft into mouse models available at the time. Given our finding that 3D-MSC-spheres provide superior support in in vitro proliferation of leukaemia cells, this study strengthens the rationale for adopting in vitro MSC-based co-culture systems.
Text entered in Discussion:
“Patient samples do not always engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system successfully cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8 which did not engraft any mouse model available at the time.”
Although the potential costs and animal savings presented are feasible, the system is quite simplistic and is more likely to be incorporated as an additional test rather than be adopted as a replacement. It would be more attractive if the time frame could be extended and more details on the application for high throughput screening development was discussed. Also, in vivo toxicity testing of novel compounds will still be required in order for regulatory approval for any Phase 1 clinical trial in humans to be progressed.
Response
We have aimed to successfully address these points in the discussion, via the additional text:
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor corrections:
Research highlights - blasts would only be appropriate for certain types of leukaemia, either need to define it’s ALL specifically or change to stem/progenitor.
Scientific benefit:
A 3D spheroid-based approach with improved clinical relevance for ex vivo co-culture of primary patient leukaemia samples for further investigation into leukaemia biology such as stem/progenitor cell-niche interactions, stem/progenitor cell proliferation and treatment resistance.
3Rs benefit:
To replace moderate severity animal (mice) procedures in leukaemia research and early pre-clinical drug testing.
Current applications:
Exploration of leukaemia biology such as stem/progenitor cell proliferation, stem/progenitor cell -niche interactions, niche-impacted treatment resistance and obtain drug response data.
Response
We have replaced “blasts” with “stem/progenitor” as appropriate.
Introduction:
Need to define at the start that you are talking about ALL as it reads like a general overview which means some of the % incidence rates etc. are not correct. It would be good to mention what type of ALL as well, is it B-ALL, T-ALL, childhood, adult?
Response
This has been clarified as below:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro platform to establish co-cultures of patient-derived leukaemia cells with 3D bone marrow mesenchyme spheroids, BM-MSC-spheroids.
Paragraph 3 page 3: Most research groups would use primary patient samples in vitro prior to moving to in vivo models. This should be included.
Response
This has been included as below:
Although several research groups would likely use primary patient for in vitro studies before moving into in vivo models, in vivo models are regarded as gold standard preclinical models, and are used as key models to expand primary samples as vital research resources.
Paragraph 2 Page 4: Remove blasts and replace with LSCs also include disease type chronic myeloid leukaemia.
Response
We apologise for using “blasts”, all of these have been replaced with “leukaemia cell” or “ALL”. Disease type chronic myeloid leukaemia has been added to the following sentence
Cell lines retain cytogenic characteristics of acute lymphoblastic leukaemia (ALL), and other diseases like chronic myeloid leukaemia, but being derived from patients with relapsed disease these samples do not represent the molecular complexity of disease at presentation14,15.
Page 11 ‘such spheroid biobanks’: do they actually exist? Or are you planning on constructing a biobank?
Response
We apologise for the ambiguity and have now re-worded the section below:
Following further extensive validation, such 3D-based preclinical models would furthermore have the potential to be embedded within clinical trials and healthcare systems for the purposes of detecting responders as well as to aid risk stratification.
‘MSC spheroids provide superior protection to leukaemia cells against dexamethasone treatment. are appropriate in modelling treatment resistance which remains a major clinical challenge in cancer management’.
Is this statement correct, not really looking at resistance, just reduced sensitivity to the drugs at that dose when in 3D rather than 2D culture. Need to amend and extend to include how you would look at resistance i.e. relapsed patients and the potential to interrogate resistance mechanisms.
Response
This statement has now been clarified:
This means that compared to 2D MSC cultures, MSC spheroid-based models, might be promising to study the biology of leukaemia cells from relapsed disease, consequently helping interrogate treatment resistance mechanisms, a major clinical challenge in cancer management.
The manuscript by Wilson et al. provides a convincing argument for the requirement of additional in vitro models to improve drug testing in acute lymphocytic leukaemia (ALL) and reduce the reliance on Xenograft mouse models. Preliminary data is presented supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid/primary ALL co-cultures for the use in preclinical testing of drugs. Proof of principle data is provided showing that simple 2D co-culture on MSCs gives a similar range of drug responses to dexamethasone and the BCL2 mimetic drug ABT199 as observed in in vivo studies for 2 primary ALL patient samples. The authors then show optimisation data using Aggrewell plates, demonstrating uniform spheroid formation and a corresponding increase in spheroid diameter when cell seeding density is increased. The final figure then compares primary ALL cell proliferation in 2D and 3D culture and drug responses to dexamethasone. Using 3 independent patient samples they show that MSC spheroids support cell proliferation over a 5 day time frame and provide protection to dexamethasone. These are important observations and support the introduction of a more physiologically relevant humanised system for drug screening prior to conducting in vivo studies. Another potential advantage would be if the authors had data demonstrating that the system supports patients' samples which do not engraft, as there is a high engraftment failure rate in Xenograft models with not all patient samples being successful. This could potentially lead to more robust data on patient’s responses. Given patient heterogeneity mouse models may be biasing certain traits/genetics due to the engraftment limitations observed.
Overall, the system if adopted by other researchers could potentially reduce animal numbers and suffering, reduce the cost and select the most promising drugs for additional testing. It would therefore have impact on replacement and reduction of mouse experiments.
However, there are some limitations in the results shown that would be strengthened by additional experiments:
The MSC are characterised by gene expression, it would be good to include flow cytometry data; CD90+105+73+34-45- are key markers demonstrating stemness. The culture conditions using FCS can also lead to changes in the MSCs so it would be good to include passage number. Figure 3 live/dead staining of the spheroids especially for the size used in the drug treatment assays in Figure 4 would be important to include.
Response:
Additional data addressing these points have been added in Figure 2. We include flow cytometry data showing MSC in 3D spheroid format express CD105, CD90 and CD73. We include additional data showing the expression of casein Calcein (live cell dye) and Hoechst-33342 (live and dead cell dye) in MSC spheroids at a diameter of 100 µM, spheroid size used in subsequent experiments.
MSC passage number used was between p2 and p5, this has been clarified within Methods
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study9. MSC were used between passages ranging from p2 – p5. Data showing that dexamethasone and ABT199 do not detrimentally affect the MSC monoculture and MSC spheroids would also be important to include.
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for seven days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
Figure 4 looks at proliferation, apoptosis assays would be good to include to show whether cell death was occurring.
Response
We provide additional data showing propidium iodide, PI staining in ALL cells following treatment with dexamethasone.
We include following text within Results, Patient-derived leukaemia cells co-cultured with 3D MSC spheres show superior proliferation and enhanced treatment resistance.
“We find that ALL cells show greater reduction in sensitivity to dexamethasone when co-cultured with 3D BM-MSC (Fig.3.d-f). This could be owing to potentially improved functional cell-cell contacts and physiologically relevant cell polarity being achieved in a 3D format. This might have caused increased 3D versus 2D MSC-conferred ALL proliferation and/or improved ALL survival. However, reduced sensitivity could also be due to altered drug availability within 3D spheroids. These data highlight the advantage of 3D organoid-based co-culture systems over routine 2D cultures in two respects: 1. Achieving higher ALL cell cycling which is essential for the action or testing of majority of anti-cancer treatments 2. Obtaining reduced drug sensitivity, possibly owing to improved treatment resistance– a major current day clinical challenge in cancer management. We further investigate the ability of MSC-spheroids to reduce ALL cell death and find that when treated with a higher dose of dexamethasone, that is, at 10nM, then both 2D and 3D MSC-spheroids support survival of leukaemia cells (Fig.3.g.). We now progress to reveal proof-of-confidence-in-application data, justifying the suitability of our platform in conduction combinatorial drug testing.”
Data showing similar results in ALL patient samples known to fail to engraft in vivo would strengthen the rationale for adopting the 3D system.
Response
Unfortunately, we do not have ALL samples that fail to engraft. Nevertheless, we have previously shown the ability of the 2D MSC co-culture system to culture primary AML samples from t(8;21)-positive patients, which would not successfully engraft into mouse models available at the time. Given our finding that 3D-MSC-spheres provide superior support in in vitro proliferation of leukaemia cells, this study strengthens the rationale for adopting in vitro MSC-based co-culture systems.
Text entered in Discussion:
“Patient samples do not always engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system successfully cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8 which did not engraft any mouse model available at the time.”
Although the potential costs and animal savings presented are feasible, the system is quite simplistic and is more likely to be incorporated as an additional test rather than be adopted as a replacement. It would be more attractive if the time frame could be extended and more details on the application for high throughput screening development was discussed. Also, in vivo toxicity testing of novel compounds will still be required in order for regulatory approval for any Phase 1 clinical trial in humans to be progressed.
Response
We have aimed to successfully address these points in the discussion, via the additional text:
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor corrections:
Research highlights - blasts would only be appropriate for certain types of leukaemia, either need to define it’s ALL specifically or change to stem/progenitor.
Scientific benefit:
A 3D spheroid-based approach with improved clinical relevance for ex vivo co-culture of primary patient leukaemia samples for further investigation into leukaemia biology such as stem/progenitor cell-niche interactions, stem/progenitor cell proliferation and treatment resistance.
3Rs benefit:
To replace moderate severity animal (mice) procedures in leukaemia research and early pre-clinical drug testing.
Current applications:
Exploration of leukaemia biology such as stem/progenitor cell proliferation, stem/progenitor cell -niche interactions, niche-impacted treatment resistance and obtain drug response data.
Response
We have replaced “blasts” with “stem/progenitor” as appropriate.
Introduction:
Need to define at the start that you are talking about ALL as it reads like a general overview which means some of the % incidence rates etc. are not correct. It would be good to mention what type of ALL as well, is it B-ALL, T-ALL, childhood, adult?
Response
This has been clarified as below:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro platform to establish co-cultures of patient-derived leukaemia cells with 3D bone marrow mesenchyme spheroids, BM-MSC-spheroids.
Paragraph 3 page 3: Most research groups would use primary patient samples in vitro prior to moving to in vivo models. This should be included.
Response
This has been included as below:
Although several research groups would likely use primary patient for in vitro studies before moving into in vivo models, in vivo models are regarded as gold standard preclinical models, and are used as key models to expand primary samples as vital research resources.
Paragraph 2 Page 4: Remove blasts and replace with LSCs also include disease type chronic myeloid leukaemia.
Response
We apologise for using “blasts”, all of these have been replaced with “leukaemia cell” or “ALL”. Disease type chronic myeloid leukaemia has been added to the following sentence
Cell lines retain cytogenic characteristics of acute lymphoblastic leukaemia (ALL), and other diseases like chronic myeloid leukaemia, but being derived from patients with relapsed disease these samples do not represent the molecular complexity of disease at presentation14,15.
Page 11 ‘such spheroid biobanks’: do they actually exist? Or are you planning on constructing a biobank?
Response
We apologise for the ambiguity and have now re-worded the section below:
Following further extensive validation, such 3D-based preclinical models would furthermore have the potential to be embedded within clinical trials and healthcare systems for the purposes of detecting responders as well as to aid risk stratification.
‘MSC spheroids provide superior protection to leukaemia cells against dexamethasone treatment. are appropriate in modelling treatment resistance which remains a major clinical challenge in cancer management’.
Is this statement correct, not really looking at resistance, just reduced sensitivity to the drugs at that dose when in 3D rather than 2D culture. Need to amend and extend to include how you would look at resistance i.e. relapsed patients and the potential to interrogate resistance mechanisms.
Response
This statement has now been clarified:
This means that compared to 2D MSC cultures, MSC spheroid-based models, might be promising to study the biology of leukaemia cells from relapsed disease, consequently helping interrogate treatment resistance mechanisms, a major clinical challenge in cancer management.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 28 Nov 2023

Deepali Pal, Wolfson Childhood Cancer Research Centre, Translational and Clinical Research Institute, Newcastle University, UK, Newcastle upon Tyne, NE1 7RU, UK

28 Nov 2023

Author Response

The manuscript by Wilson et al. provides a convincing argument for the requirement of additional in vitro models to improve drug testing in acute lymphocytic leukaemia (ALL) and reduce the ... Continue reading The manuscript by Wilson et al. provides a convincing argument for the requirement of additional in vitro models to improve drug testing in acute lymphocytic leukaemia (ALL) and reduce the reliance on Xenograft mouse models. Preliminary data is presented supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid/primary ALL co-cultures for the use in preclinical testing of drugs. Proof of principle data is provided showing that simple 2D co-culture on MSCs gives a similar range of drug responses to dexamethasone and the BCL2 mimetic drug ABT199 as observed in in vivo studies for 2 primary ALL patient samples. The authors then show optimisation data using Aggrewell plates, demonstrating uniform spheroid formation and a corresponding increase in spheroid diameter when cell seeding density is increased. The final figure then compares primary ALL cell proliferation in 2D and 3D culture and drug responses to dexamethasone. Using 3 independent patient samples they show that MSC spheroids support cell proliferation over a 5 day time frame and provide protection to dexamethasone. These are important observations and support the introduction of a more physiologically relevant humanised system for drug screening prior to conducting in vivo studies. Another potential advantage would be if the authors had data demonstrating that the system supports patients' samples which do not engraft, as there is a high engraftment failure rate in Xenograft models with not all patient samples being successful. This could potentially lead to more robust data on patient’s responses. Given patient heterogeneity mouse models may be biasing certain traits/genetics due to the engraftment limitations observed.
Overall, the system if adopted by other researchers could potentially reduce animal numbers and suffering, reduce the cost and select the most promising drugs for additional testing. It would therefore have impact on replacement and reduction of mouse experiments.
However, there are some limitations in the results shown that would be strengthened by additional experiments:
The MSC are characterised by gene expression, it would be good to include flow cytometry data; CD90+105+73+34-45- are key markers demonstrating stemness. The culture conditions using FCS can also lead to changes in the MSCs so it would be good to include passage number. Figure 3 live/dead staining of the spheroids especially for the size used in the drug treatment assays in Figure 4 would be important to include.
Response:
Additional data addressing these points have been added in Figure 2. We include flow cytometry data showing MSC in 3D spheroid format express CD105, CD90 and CD73. We include additional data showing the expression of casein Calcein (live cell dye) and Hoechst-33342 (live and dead cell dye) in MSC spheroids at a diameter of 100 µM, spheroid size used in subsequent experiments.
MSC passage number used was between p2 and p5, this has been clarified within Methods
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study9. MSC were used between passages ranging from p2 – p5. Data showing that dexamethasone and ABT199 do not detrimentally affect the MSC monoculture and MSC spheroids would also be important to include.
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for seven days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
Figure 4 looks at proliferation, apoptosis assays would be good to include to show whether cell death was occurring.
Response
We provide additional data showing propidium iodide, PI staining in ALL cells following treatment with dexamethasone.
We include following text within Results, Patient-derived leukaemia cells co-cultured with 3D MSC spheres show superior proliferation and enhanced treatment resistance.
“We find that ALL cells show greater reduction in sensitivity to dexamethasone when co-cultured with 3D BM-MSC (Fig.3.d-f). This could be owing to potentially improved functional cell-cell contacts and physiologically relevant cell polarity being achieved in a 3D format. This might have caused increased 3D versus 2D MSC-conferred ALL proliferation and/or improved ALL survival. However, reduced sensitivity could also be due to altered drug availability within 3D spheroids. These data highlight the advantage of 3D organoid-based co-culture systems over routine 2D cultures in two respects: 1. Achieving higher ALL cell cycling which is essential for the action or testing of majority of anti-cancer treatments 2. Obtaining reduced drug sensitivity, possibly owing to improved treatment resistance– a major current day clinical challenge in cancer management. We further investigate the ability of MSC-spheroids to reduce ALL cell death and find that when treated with a higher dose of dexamethasone, that is, at 10nM, then both 2D and 3D MSC-spheroids support survival of leukaemia cells (Fig.3.g.). We now progress to reveal proof-of-confidence-in-application data, justifying the suitability of our platform in conduction combinatorial drug testing.”
Data showing similar results in ALL patient samples known to fail to engraft in vivo would strengthen the rationale for adopting the 3D system.
Response
Unfortunately, we do not have ALL samples that fail to engraft. Nevertheless, we have previously shown the ability of the 2D MSC co-culture system to culture primary AML samples from t(8;21)-positive patients, which would not successfully engraft into mouse models available at the time. Given our finding that 3D-MSC-spheres provide superior support in in vitro proliferation of leukaemia cells, this study strengthens the rationale for adopting in vitro MSC-based co-culture systems.
Text entered in Discussion:
“Patient samples do not always engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system successfully cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8 which did not engraft any mouse model available at the time.”
Although the potential costs and animal savings presented are feasible, the system is quite simplistic and is more likely to be incorporated as an additional test rather than be adopted as a replacement. It would be more attractive if the time frame could be extended and more details on the application for high throughput screening development was discussed. Also, in vivo toxicity testing of novel compounds will still be required in order for regulatory approval for any Phase 1 clinical trial in humans to be progressed.
Response
We have aimed to successfully address these points in the discussion, via the additional text:
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor corrections:
Research highlights - blasts would only be appropriate for certain types of leukaemia, either need to define it’s ALL specifically or change to stem/progenitor.
Scientific benefit:
A 3D spheroid-based approach with improved clinical relevance for ex vivo co-culture of primary patient leukaemia samples for further investigation into leukaemia biology such as stem/progenitor cell-niche interactions, stem/progenitor cell proliferation and treatment resistance.
3Rs benefit:
To replace moderate severity animal (mice) procedures in leukaemia research and early pre-clinical drug testing.
Current applications:
Exploration of leukaemia biology such as stem/progenitor cell proliferation, stem/progenitor cell -niche interactions, niche-impacted treatment resistance and obtain drug response data.
Response
We have replaced “blasts” with “stem/progenitor” as appropriate.
Introduction:
Need to define at the start that you are talking about ALL as it reads like a general overview which means some of the % incidence rates etc. are not correct. It would be good to mention what type of ALL as well, is it B-ALL, T-ALL, childhood, adult?
Response
This has been clarified as below:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro platform to establish co-cultures of patient-derived leukaemia cells with 3D bone marrow mesenchyme spheroids, BM-MSC-spheroids.
Paragraph 3 page 3: Most research groups would use primary patient samples in vitro prior to moving to in vivo models. This should be included.
Response
This has been included as below:
Although several research groups would likely use primary patient for in vitro studies before moving into in vivo models, in vivo models are regarded as gold standard preclinical models, and are used as key models to expand primary samples as vital research resources.
Paragraph 2 Page 4: Remove blasts and replace with LSCs also include disease type chronic myeloid leukaemia.
Response
We apologise for using “blasts”, all of these have been replaced with “leukaemia cell” or “ALL”. Disease type chronic myeloid leukaemia has been added to the following sentence
Cell lines retain cytogenic characteristics of acute lymphoblastic leukaemia (ALL), and other diseases like chronic myeloid leukaemia, but being derived from patients with relapsed disease these samples do not represent the molecular complexity of disease at presentation14,15.
Page 11 ‘such spheroid biobanks’: do they actually exist? Or are you planning on constructing a biobank?
Response
We apologise for the ambiguity and have now re-worded the section below:
Following further extensive validation, such 3D-based preclinical models would furthermore have the potential to be embedded within clinical trials and healthcare systems for the purposes of detecting responders as well as to aid risk stratification.
‘MSC spheroids provide superior protection to leukaemia cells against dexamethasone treatment. are appropriate in modelling treatment resistance which remains a major clinical challenge in cancer management’.
Is this statement correct, not really looking at resistance, just reduced sensitivity to the drugs at that dose when in 3D rather than 2D culture. Need to amend and extend to include how you would look at resistance i.e. relapsed patients and the potential to interrogate resistance mechanisms.
Response
This statement has now been clarified:
This means that compared to 2D MSC cultures, MSC spheroid-based models, might be promising to study the biology of leukaemia cells from relapsed disease, consequently helping interrogate treatment resistance mechanisms, a major clinical challenge in cancer management.
The manuscript by Wilson et al. provides a convincing argument for the requirement of additional in vitro models to improve drug testing in acute lymphocytic leukaemia (ALL) and reduce the reliance on Xenograft mouse models. Preliminary data is presented supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid/primary ALL co-cultures for the use in preclinical testing of drugs. Proof of principle data is provided showing that simple 2D co-culture on MSCs gives a similar range of drug responses to dexamethasone and the BCL2 mimetic drug ABT199 as observed in in vivo studies for 2 primary ALL patient samples. The authors then show optimisation data using Aggrewell plates, demonstrating uniform spheroid formation and a corresponding increase in spheroid diameter when cell seeding density is increased. The final figure then compares primary ALL cell proliferation in 2D and 3D culture and drug responses to dexamethasone. Using 3 independent patient samples they show that MSC spheroids support cell proliferation over a 5 day time frame and provide protection to dexamethasone. These are important observations and support the introduction of a more physiologically relevant humanised system for drug screening prior to conducting in vivo studies. Another potential advantage would be if the authors had data demonstrating that the system supports patients' samples which do not engraft, as there is a high engraftment failure rate in Xenograft models with not all patient samples being successful. This could potentially lead to more robust data on patient’s responses. Given patient heterogeneity mouse models may be biasing certain traits/genetics due to the engraftment limitations observed.
Overall, the system if adopted by other researchers could potentially reduce animal numbers and suffering, reduce the cost and select the most promising drugs for additional testing. It would therefore have impact on replacement and reduction of mouse experiments.
However, there are some limitations in the results shown that would be strengthened by additional experiments:
The MSC are characterised by gene expression, it would be good to include flow cytometry data; CD90+105+73+34-45- are key markers demonstrating stemness. The culture conditions using FCS can also lead to changes in the MSCs so it would be good to include passage number. Figure 3 live/dead staining of the spheroids especially for the size used in the drug treatment assays in Figure 4 would be important to include.
Response:
Additional data addressing these points have been added in Figure 2. We include flow cytometry data showing MSC in 3D spheroid format express CD105, CD90 and CD73. We include additional data showing the expression of casein Calcein (live cell dye) and Hoechst-33342 (live and dead cell dye) in MSC spheroids at a diameter of 100 µM, spheroid size used in subsequent experiments.
MSC passage number used was between p2 and p5, this has been clarified within Methods
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study9. MSC were used between passages ranging from p2 – p5. Data showing that dexamethasone and ABT199 do not detrimentally affect the MSC monoculture and MSC spheroids would also be important to include.
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for seven days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
Figure 4 looks at proliferation, apoptosis assays would be good to include to show whether cell death was occurring.
Response
We provide additional data showing propidium iodide, PI staining in ALL cells following treatment with dexamethasone.
We include following text within Results, Patient-derived leukaemia cells co-cultured with 3D MSC spheres show superior proliferation and enhanced treatment resistance.
“We find that ALL cells show greater reduction in sensitivity to dexamethasone when co-cultured with 3D BM-MSC (Fig.3.d-f). This could be owing to potentially improved functional cell-cell contacts and physiologically relevant cell polarity being achieved in a 3D format. This might have caused increased 3D versus 2D MSC-conferred ALL proliferation and/or improved ALL survival. However, reduced sensitivity could also be due to altered drug availability within 3D spheroids. These data highlight the advantage of 3D organoid-based co-culture systems over routine 2D cultures in two respects: 1. Achieving higher ALL cell cycling which is essential for the action or testing of majority of anti-cancer treatments 2. Obtaining reduced drug sensitivity, possibly owing to improved treatment resistance– a major current day clinical challenge in cancer management. We further investigate the ability of MSC-spheroids to reduce ALL cell death and find that when treated with a higher dose of dexamethasone, that is, at 10nM, then both 2D and 3D MSC-spheroids support survival of leukaemia cells (Fig.3.g.). We now progress to reveal proof-of-confidence-in-application data, justifying the suitability of our platform in conduction combinatorial drug testing.”
Data showing similar results in ALL patient samples known to fail to engraft in vivo would strengthen the rationale for adopting the 3D system.
Response
Unfortunately, we do not have ALL samples that fail to engraft. Nevertheless, we have previously shown the ability of the 2D MSC co-culture system to culture primary AML samples from t(8;21)-positive patients, which would not successfully engraft into mouse models available at the time. Given our finding that 3D-MSC-spheres provide superior support in in vitro proliferation of leukaemia cells, this study strengthens the rationale for adopting in vitro MSC-based co-culture systems.
Text entered in Discussion:
“Patient samples do not always engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system successfully cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8 which did not engraft any mouse model available at the time.”
Although the potential costs and animal savings presented are feasible, the system is quite simplistic and is more likely to be incorporated as an additional test rather than be adopted as a replacement. It would be more attractive if the time frame could be extended and more details on the application for high throughput screening development was discussed. Also, in vivo toxicity testing of novel compounds will still be required in order for regulatory approval for any Phase 1 clinical trial in humans to be progressed.
Response
We have aimed to successfully address these points in the discussion, via the additional text:
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor corrections:
Research highlights - blasts would only be appropriate for certain types of leukaemia, either need to define it’s ALL specifically or change to stem/progenitor.
Scientific benefit:
A 3D spheroid-based approach with improved clinical relevance for ex vivo co-culture of primary patient leukaemia samples for further investigation into leukaemia biology such as stem/progenitor cell-niche interactions, stem/progenitor cell proliferation and treatment resistance.
3Rs benefit:
To replace moderate severity animal (mice) procedures in leukaemia research and early pre-clinical drug testing.
Current applications:
Exploration of leukaemia biology such as stem/progenitor cell proliferation, stem/progenitor cell -niche interactions, niche-impacted treatment resistance and obtain drug response data.
Response
We have replaced “blasts” with “stem/progenitor” as appropriate.
Introduction:
Need to define at the start that you are talking about ALL as it reads like a general overview which means some of the % incidence rates etc. are not correct. It would be good to mention what type of ALL as well, is it B-ALL, T-ALL, childhood, adult?
Response
This has been clarified as below:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro platform to establish co-cultures of patient-derived leukaemia cells with 3D bone marrow mesenchyme spheroids, BM-MSC-spheroids.
Paragraph 3 page 3: Most research groups would use primary patient samples in vitro prior to moving to in vivo models. This should be included.
Response
This has been included as below:
Although several research groups would likely use primary patient for in vitro studies before moving into in vivo models, in vivo models are regarded as gold standard preclinical models, and are used as key models to expand primary samples as vital research resources.
Paragraph 2 Page 4: Remove blasts and replace with LSCs also include disease type chronic myeloid leukaemia.
Response
We apologise for using “blasts”, all of these have been replaced with “leukaemia cell” or “ALL”. Disease type chronic myeloid leukaemia has been added to the following sentence
Cell lines retain cytogenic characteristics of acute lymphoblastic leukaemia (ALL), and other diseases like chronic myeloid leukaemia, but being derived from patients with relapsed disease these samples do not represent the molecular complexity of disease at presentation14,15.
Page 11 ‘such spheroid biobanks’: do they actually exist? Or are you planning on constructing a biobank?
Response
We apologise for the ambiguity and have now re-worded the section below:
Following further extensive validation, such 3D-based preclinical models would furthermore have the potential to be embedded within clinical trials and healthcare systems for the purposes of detecting responders as well as to aid risk stratification.
‘MSC spheroids provide superior protection to leukaemia cells against dexamethasone treatment. are appropriate in modelling treatment resistance which remains a major clinical challenge in cancer management’.
Is this statement correct, not really looking at resistance, just reduced sensitivity to the drugs at that dose when in 3D rather than 2D culture. Need to amend and extend to include how you would look at resistance i.e. relapsed patients and the potential to interrogate resistance mechanisms.
Response
This statement has now been clarified:
This means that compared to 2D MSC cultures, MSC spheroid-based models, might be promising to study the biology of leukaemia cells from relapsed disease, consequently helping interrogate treatment resistance mechanisms, a major clinical challenge in cancer management.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Views

Reviewer Report 19 Dec 2022

Simon E. Richardson, Wellcome - MRC Cambridge Stem Cell Institute, Cambridge, UK

Approved with Reservations

https://doi.org/10.5256/f1000research.135152.r158193

This manuscript by Wilson et al provides a rationale, methodological details and pilot data supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid co-cultures in the preclinical testing of drugs for acute leukaemia. The authors provide a detailed rationale for the potential benefits of this system, including: i) reduction in animal use/suffering; ii) reduced costs; and iii) the ability to model the protective impact of bone marrow micro-environmental influences in abrogating drug efficacy in vitro, reducing the number “false positive” drug hits taken forward to in vivo model systems. The authors provide data showing the equivalence of 2D in vitro drug sensitivity with PDX models (n=2) and compare 2D vs 3D co-culture of human leukaemias (n=3) in proliferation and dexamethasone sensitivity assays, showing consistently enhanced proliferation and reduced dexamethasone sensitivity in the 3D system. They also present methodological data on the establishment of MSC spheroids as well as modelling on the potential reduction in animal use and costs based on local experience.

Overall, the rationale to develop more physiologically relevant in vitro co-culture systems is a very worthwhile endeavour with clear potential benefits for animal welfare, costs and in streamlining drug development. It also has the potential advantage of being used in the study of leukaemias that do not engraft in current immunosuppressed mouse models.

In my opinion the work has three major limitations that would benefit from either additional data or acknowledgement in the discussion.

Whilst this work demonstrates the feasibility of the approach, it is not possible from the data presented to conclude that 3D systems perform better than either 2D co-culture or PDX systems. Specifically, the data presented uses a small number of patient samples (n=2 or 3) and drugs (Dexamethasone ± ABT199). The three systems are not directly compared and no example of an in vitro drug hit that proves “false-positive” when tested in vivo is tested in parallel 2D/3D co-culture.
There are a number of potential technical limitations of the co-culture approach that are not acknowledged: i) the requirement for access to a source of MSCs which are not readily available to most labs; ii) certain drugs (notably cytotoxic chemotherapy) are likely to have direct toxicity to the MSCs themselves; iii) the lack of a vascular component to this system might result in artificially high levels of physical protection from drug exposure by the 3D niche (i.e. potential for false negatives).
The potential costs and animal savings presented are feasible, but likely at the upper end of the spectrum and will differ between institutions. For example, the time to generate a novel PDX is indeed many months, but once established PDX models in ALL engraft much more quickly and reproducibly and established PDX material is readily available. In vivo toxicity testing is not needed for established drugs being re-purposed; conversely novel chemical agents will still need some in vivo toxicity data prior to regulatory approval for first-in-human studies.

Minor points:

In the introduction it would be helpful to specify the precise leukaemia being studied and at which age. In particular, relapse rates in adult B-ALL are much higher than those presented, which are indicative of the paediatric setting.
In the 2D co-culture methods, please provide a reference on how to process MSCs and specify the final volume of media per well used to plate the leukaemia cells.
For the response data presented in figures 1 and 4, please clarify in the legend or methods the nature of the readouts and timepoints used.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Leukaemia biology, disease modelling, stem cells, epigenetics, preclinical drug testing.

CITE

Report a concern

Author Response 28 Nov 2023

Deepali Pal, Wolfson Childhood Cancer Research Centre, Translational and Clinical Research Institute, Newcastle University, UK, Newcastle upon Tyne, NE1 7RU, UK

28 Nov 2023

Author Response
This manuscript by Wilson et al provides a rationale, methodological details and pilot data supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid co-cultures in the preclinical testing ... Continue reading
This manuscript by Wilson et al provides a rationale, methodological details and pilot data supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid co-cultures in the preclinical testing of drugs for acute leukaemia. The authors provide a detailed rationale for the potential benefits of this system, including: i) reduction in animal use/suffering; ii) reduced costs; and iii) the ability to model the protective impact of bone marrow micro-environmental influences in abrogating drug efficacy in vitro, reducing the number “false positive” drug hits taken forward to in vivo model systems. The authors provide data showing the equivalence of 2D in vitro drug sensitivity with PDX models (n=2) and compare 2D vs 3D co-culture of human leukaemias (n=3) in proliferation and dexamethasone sensitivity assays, showing consistently enhanced proliferation and reduced dexamethasone sensitivity in the 3D system. They also present methodological data on the establishment of MSC spheroids as well as modelling on the potential reduction in animal use and costs based on local experience.
Overall, the rationale to develop more physiologically relevant in vitro co-culture systems is a very worthwhile endeavour with clear potential benefits for animal welfare, costs and in streamlining drug development. It also has the potential advantage of being used in the study of leukaemias that do not engraft in current immunosuppressed mouse models.
In my opinion the work has three major limitations that would benefit from either additional data or acknowledgement in the discussion.

Whilst this work demonstrates the feasibility of the approach, it is not possible from the data presented to conclude that 3D systems perform better than either 2D co-culture or PDX systems. Specifically, the data presented uses a small number of patient samples (n=2 or 3) and drugs (Dexamethasone ± ABT199). The three systems are not directly compared and no example of an in vitro drug hit that proves “false-positive” when tested in vivo is tested in parallel 2D/3D co-culture.

Response:
We provide additional data comparing 2D co-culture and in vivo data with 3D sphere co-culture data. We find that patient-derived leukaemia cells show reduced sensitivity in 3D co-culture settings compared to 2D co-cultures, potentially indicating the superior ability of 3D models to screen out 2D “false-positive” hits. Furthermore, we show that patient-derived leukaemia cells from a leukaemia cytogenetic subgroup, subgroup A, showing high sensitivity to dex-ABT-199 combination in vivo, shows high combination sensitivity in 3D in vitro co-cultures. Similarly, we show that patient-derived leukaemia cells from the subgroup B shows reduced sensitivity to dex-ABT-199 combination both in vivo and in vitro, in 2D and 3D co-culture settings.
We add the following text within the main manuscript:
Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity
Improved in vivo predictivity is a key requisite for ex vivo animal replacement models, if these platforms are to effectively replace mouse experiments. We confirmed that BM-MSC/leukaemia 2D co-culture platform generated drug dose response data that was largely comparable with drug response observed in vivo in PDX-mouse models (Fig 4.a). Furthermore, we reveal that when leukaemia cells are co-cultured with 3D BM-MSC-spheroids they show greater reduced sensitivity, compared to the 2D co-culture arm, against dexamethasone, ABT-199 and the combination in a sample subgroup that exhibited reduced in vivo efficacy (previously unpublished data existing in the lab from earlier studies). This reveals the ability of our 3D co-culture model in being able to screen off false-positive hits derived from 2D models, consequently minimising in vitro to in vivo attrition rates. We further confirm that when co-cultured with 3D MSC spheres, ALL cells expectedly in 3D-MSC spheroid-co-cultures, however, fail to increase in cell counts on day five, in the dexamethasone treatment arm (Fig.4.b). Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
2. There are a number of potential technical limitations of the co-culture approach that are not acknowledged: i) the requirement for access to a source of MSCs which are not readily available to most labs; ii) certain drugs (notably cytotoxic chemotherapy) are likely to have direct toxicity to the MSCs themselves; iii) the lack of a vascular component to this system might result in artificially high levels of physical protection from drug exposure by the 3D niche (i.e. potential for false negatives).
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for five days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
We address remaining of points i), ii) and iii) in an additional “Study Limitations” section.
Study Limitations
Here we use primary human MSC, which indeed may be difficult to source, and which may lead to donor variability. Using induced pluripotent stem cell (iPSC) derived MSC to co-culture patient-derived leukaemia¹⁴ may be an attractive alternative, and would furthermore enable assay standardisation, thereby improving data reproducibility. Moreover, although we show that MSC showed no adverse effect to dexamethasone and ABT-199 treatment, many anti-cancer treatments notably cytotoxic chemotherapy may cause direct toxicity to the MSC. However, this further emphasises the need to include key microenvironment cell types when conducting anti-cancer drug testing, especially given cancer treatments influence interactions between leukaemia and their surrounding niche, with many cytotoxic treatments affecting both leukaemia and bone marrow cells in patients. Furthermore, we acknowledge that an ideal representation of 3D biomimetic human cell-based model would include capturing both mesenchymal and vascular bone marrow components within an immune-responsive context.
3. The potential costs and animal savings presented are feasible, but likely at the upper end of the spectrum and will differ between institutions. For example, the time to generate a novel PDX is indeed many months, but once established PDX models in ALL engraft much more quickly and reproducibly and established PDX material is readily available. In vivo toxicity testing is not needed for established drugs being re-purposed; conversely novel chemical agents will still need some in vivo toxicity data prior to regulatory approval for first-in-human studies.
Response
Indeed, the time taken to generate a novel PDX sample can span between months to a year, and this time is shortened when PDX samples are serially transplanted in subsequent mouse models. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully, before any drug response testing can begin.
We agree that in vivo toxicity is not needed for drugs being re-purposed, unless these involve testing of new combinatorial regimens, and furthermore note recent announcement by the U.S. Food and Drug Administration (FDA) that new drugs would not be mandated to be tested in animals prior to first-in-human trials.
We have reflected this in the manuscript within Discussion via the following additional text
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor points:
In the introduction it would be helpful to specify the precise leukaemia being studied and at which age. In particular, relapse rates in adult B-ALL are much higher than those presented, which are indicative of the paediatric setting.
Response:
We have addressed this both in the abstract and in the introduction via the following text:
Abstract:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro approach to co-culture patient-derived leukaemia cells with 3D mesenchymal stroma cell spheroids, MSC-spheroids.
Introduction:
Acute lymphoblastic leukaemia (ALL) management in children is hindered by two chief obstacles: 1. Treatment toxicity^1,2 2. 15-20% of patients go into relapse, when the disease can be treatment resistant³.
In the 2D co-culture methods, please provide a reference on how to process MSCs and specify the final volume of media per well used to plate the leukaemia cells.
This has been provided as below:
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study⁹. MSC were used between passages ranging from p2 – p5. MSC were seeded on Matrigel coated 48 well plates at 1x104 cells/0.5mL/cm2 in their respective media (MSC media, Table 1). After 24 hours, the media was aspirated, and the cells rinsed with 1mL SFEM. Leukaemia cells were then plated onto the MSC layers, at a density of 0.25x105 cells/1 mL per well, suspended in SFEM media.
For the response data presented in figures 1 and 4, please clarify in the legend or methods the nature of the readouts and timepoints used.
Figure 1, now Figure 4. Readouts have been clarified in legend as follows:
“In vitro data readout includes viable cell counts; in vivo data (right hand graphs) is shown as bioluminescence imaging from luciferase expressing PDX cells in total flux(p/s). Total flux is a surrogate of blast number in vivo.”
Figure 4, now Figure 3. Readouts have been clarified in legend as follows:
Figure 3. 3D MSC-spheroids show confer higher proliferation and improved survival onto patient-derived ALL. Growth kinetics, measured via viable cell counts of ALL samples (a,d) L49120, (b,e) MS40 and (c,f) L707D across a 5 day period, with and without low dose dexamethasone (10nM) pressure, as co-cultures with 3D MSC spheres versus 2D MSC-co-culture. L49120, MS40 and L707D refer to three different patient samples, i.e., 3 biological repeats. (d,e,f) Dexamethasone treatment, data shown for 5nM treatment, is less effective in a 3D microenvironment. N= 3. g. Flow cytometry data, representative plots, showing propidium iodide, PI, positive ALL cells (sample L707) following five days of 10nM dexamethasone treatment. The column graph shows % ALL cells stained positive for PI. N = 2
This manuscript by Wilson et al provides a rationale, methodological details and pilot data supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid co-cultures in the preclinical testing of drugs for acute leukaemia. The authors provide a detailed rationale for the potential benefits of this system, including: i) reduction in animal use/suffering; ii) reduced costs; and iii) the ability to model the protective impact of bone marrow micro-environmental influences in abrogating drug efficacy in vitro, reducing the number “false positive” drug hits taken forward to in vivo model systems. The authors provide data showing the equivalence of 2D in vitro drug sensitivity with PDX models (n=2) and compare 2D vs 3D co-culture of human leukaemias (n=3) in proliferation and dexamethasone sensitivity assays, showing consistently enhanced proliferation and reduced dexamethasone sensitivity in the 3D system. They also present methodological data on the establishment of MSC spheroids as well as modelling on the potential reduction in animal use and costs based on local experience.
Overall, the rationale to develop more physiologically relevant in vitro co-culture systems is a very worthwhile endeavour with clear potential benefits for animal welfare, costs and in streamlining drug development. It also has the potential advantage of being used in the study of leukaemias that do not engraft in current immunosuppressed mouse models.
In my opinion the work has three major limitations that would benefit from either additional data or acknowledgement in the discussion.

Whilst this work demonstrates the feasibility of the approach, it is not possible from the data presented to conclude that 3D systems perform better than either 2D co-culture or PDX systems. Specifically, the data presented uses a small number of patient samples (n=2 or 3) and drugs (Dexamethasone ± ABT199). The three systems are not directly compared and no example of an in vitro drug hit that proves “false-positive” when tested in vivo is tested in parallel 2D/3D co-culture.

Response:
We provide additional data comparing 2D co-culture and in vivo data with 3D sphere co-culture data. We find that patient-derived leukaemia cells show reduced sensitivity in 3D co-culture settings compared to 2D co-cultures, potentially indicating the superior ability of 3D models to screen out 2D “false-positive” hits. Furthermore, we show that patient-derived leukaemia cells from a leukaemia cytogenetic subgroup, subgroup A, showing high sensitivity to dex-ABT-199 combination in vivo, shows high combination sensitivity in 3D in vitro co-cultures. Similarly, we show that patient-derived leukaemia cells from the subgroup B shows reduced sensitivity to dex-ABT-199 combination both in vivo and in vitro, in 2D and 3D co-culture settings.
We add the following text within the main manuscript:
Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity
Improved in vivo predictivity is a key requisite for ex vivo animal replacement models, if these platforms are to effectively replace mouse experiments. We confirmed that BM-MSC/leukaemia 2D co-culture platform generated drug dose response data that was largely comparable with drug response observed in vivo in PDX-mouse models (Fig 4.a). Furthermore, we reveal that when leukaemia cells are co-cultured with 3D BM-MSC-spheroids they show greater reduced sensitivity, compared to the 2D co-culture arm, against dexamethasone, ABT-199 and the combination in a sample subgroup that exhibited reduced in vivo efficacy (previously unpublished data existing in the lab from earlier studies). This reveals the ability of our 3D co-culture model in being able to screen off false-positive hits derived from 2D models, consequently minimising in vitro to in vivo attrition rates. We further confirm that when co-cultured with 3D MSC spheres, ALL cells expectedly in 3D-MSC spheroid-co-cultures, however, fail to increase in cell counts on day five, in the dexamethasone treatment arm (Fig.4.b). Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
2. There are a number of potential technical limitations of the co-culture approach that are not acknowledged: i) the requirement for access to a source of MSCs which are not readily available to most labs; ii) certain drugs (notably cytotoxic chemotherapy) are likely to have direct toxicity to the MSCs themselves; iii) the lack of a vascular component to this system might result in artificially high levels of physical protection from drug exposure by the 3D niche (i.e. potential for false negatives).
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for five days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
We address remaining of points i), ii) and iii) in an additional “Study Limitations” section.
Study Limitations
Here we use primary human MSC, which indeed may be difficult to source, and which may lead to donor variability. Using induced pluripotent stem cell (iPSC) derived MSC to co-culture patient-derived leukaemia¹⁴ may be an attractive alternative, and would furthermore enable assay standardisation, thereby improving data reproducibility. Moreover, although we show that MSC showed no adverse effect to dexamethasone and ABT-199 treatment, many anti-cancer treatments notably cytotoxic chemotherapy may cause direct toxicity to the MSC. However, this further emphasises the need to include key microenvironment cell types when conducting anti-cancer drug testing, especially given cancer treatments influence interactions between leukaemia and their surrounding niche, with many cytotoxic treatments affecting both leukaemia and bone marrow cells in patients. Furthermore, we acknowledge that an ideal representation of 3D biomimetic human cell-based model would include capturing both mesenchymal and vascular bone marrow components within an immune-responsive context.
3. The potential costs and animal savings presented are feasible, but likely at the upper end of the spectrum and will differ between institutions. For example, the time to generate a novel PDX is indeed many months, but once established PDX models in ALL engraft much more quickly and reproducibly and established PDX material is readily available. In vivo toxicity testing is not needed for established drugs being re-purposed; conversely novel chemical agents will still need some in vivo toxicity data prior to regulatory approval for first-in-human studies.
Response
Indeed, the time taken to generate a novel PDX sample can span between months to a year, and this time is shortened when PDX samples are serially transplanted in subsequent mouse models. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully, before any drug response testing can begin.
We agree that in vivo toxicity is not needed for drugs being re-purposed, unless these involve testing of new combinatorial regimens, and furthermore note recent announcement by the U.S. Food and Drug Administration (FDA) that new drugs would not be mandated to be tested in animals prior to first-in-human trials.
We have reflected this in the manuscript within Discussion via the following additional text
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor points:
In the introduction it would be helpful to specify the precise leukaemia being studied and at which age. In particular, relapse rates in adult B-ALL are much higher than those presented, which are indicative of the paediatric setting.
Response:
We have addressed this both in the abstract and in the introduction via the following text:
Abstract:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro approach to co-culture patient-derived leukaemia cells with 3D mesenchymal stroma cell spheroids, MSC-spheroids.
Introduction:
Acute lymphoblastic leukaemia (ALL) management in children is hindered by two chief obstacles: 1. Treatment toxicity^1,2 2. 15-20% of patients go into relapse, when the disease can be treatment resistant³.
In the 2D co-culture methods, please provide a reference on how to process MSCs and specify the final volume of media per well used to plate the leukaemia cells.
This has been provided as below:
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study⁹. MSC were used between passages ranging from p2 – p5. MSC were seeded on Matrigel coated 48 well plates at 1x104 cells/0.5mL/cm2 in their respective media (MSC media, Table 1). After 24 hours, the media was aspirated, and the cells rinsed with 1mL SFEM. Leukaemia cells were then plated onto the MSC layers, at a density of 0.25x105 cells/1 mL per well, suspended in SFEM media.
For the response data presented in figures 1 and 4, please clarify in the legend or methods the nature of the readouts and timepoints used.
Figure 1, now Figure 4. Readouts have been clarified in legend as follows:
“In vitro data readout includes viable cell counts; in vivo data (right hand graphs) is shown as bioluminescence imaging from luciferase expressing PDX cells in total flux(p/s). Total flux is a surrogate of blast number in vivo.”
Figure 4, now Figure 3. Readouts have been clarified in legend as follows:
Figure 3. 3D MSC-spheroids show confer higher proliferation and improved survival onto patient-derived ALL. Growth kinetics, measured via viable cell counts of ALL samples (a,d) L49120, (b,e) MS40 and (c,f) L707D across a 5 day period, with and without low dose dexamethasone (10nM) pressure, as co-cultures with 3D MSC spheres versus 2D MSC-co-culture. L49120, MS40 and L707D refer to three different patient samples, i.e., 3 biological repeats. (d,e,f) Dexamethasone treatment, data shown for 5nM treatment, is less effective in a 3D microenvironment. N= 3. g. Flow cytometry data, representative plots, showing propidium iodide, PI, positive ALL cells (sample L707) following five days of 10nM dexamethasone treatment. The column graph shows % ALL cells stained positive for PI. N = 2
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 28 Nov 2023

Deepali Pal, Wolfson Childhood Cancer Research Centre, Translational and Clinical Research Institute, Newcastle University, UK, Newcastle upon Tyne, NE1 7RU, UK

28 Nov 2023

Author Response
This manuscript by Wilson et al provides a rationale, methodological details and pilot data supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid co-cultures in the preclinical testing ... Continue reading
This manuscript by Wilson et al provides a rationale, methodological details and pilot data supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid co-cultures in the preclinical testing of drugs for acute leukaemia. The authors provide a detailed rationale for the potential benefits of this system, including: i) reduction in animal use/suffering; ii) reduced costs; and iii) the ability to model the protective impact of bone marrow micro-environmental influences in abrogating drug efficacy in vitro, reducing the number “false positive” drug hits taken forward to in vivo model systems. The authors provide data showing the equivalence of 2D in vitro drug sensitivity with PDX models (n=2) and compare 2D vs 3D co-culture of human leukaemias (n=3) in proliferation and dexamethasone sensitivity assays, showing consistently enhanced proliferation and reduced dexamethasone sensitivity in the 3D system. They also present methodological data on the establishment of MSC spheroids as well as modelling on the potential reduction in animal use and costs based on local experience.
Overall, the rationale to develop more physiologically relevant in vitro co-culture systems is a very worthwhile endeavour with clear potential benefits for animal welfare, costs and in streamlining drug development. It also has the potential advantage of being used in the study of leukaemias that do not engraft in current immunosuppressed mouse models.
In my opinion the work has three major limitations that would benefit from either additional data or acknowledgement in the discussion.

Whilst this work demonstrates the feasibility of the approach, it is not possible from the data presented to conclude that 3D systems perform better than either 2D co-culture or PDX systems. Specifically, the data presented uses a small number of patient samples (n=2 or 3) and drugs (Dexamethasone ± ABT199). The three systems are not directly compared and no example of an in vitro drug hit that proves “false-positive” when tested in vivo is tested in parallel 2D/3D co-culture.

Response:
We provide additional data comparing 2D co-culture and in vivo data with 3D sphere co-culture data. We find that patient-derived leukaemia cells show reduced sensitivity in 3D co-culture settings compared to 2D co-cultures, potentially indicating the superior ability of 3D models to screen out 2D “false-positive” hits. Furthermore, we show that patient-derived leukaemia cells from a leukaemia cytogenetic subgroup, subgroup A, showing high sensitivity to dex-ABT-199 combination in vivo, shows high combination sensitivity in 3D in vitro co-cultures. Similarly, we show that patient-derived leukaemia cells from the subgroup B shows reduced sensitivity to dex-ABT-199 combination both in vivo and in vitro, in 2D and 3D co-culture settings.
We add the following text within the main manuscript:
Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity
Improved in vivo predictivity is a key requisite for ex vivo animal replacement models, if these platforms are to effectively replace mouse experiments. We confirmed that BM-MSC/leukaemia 2D co-culture platform generated drug dose response data that was largely comparable with drug response observed in vivo in PDX-mouse models (Fig 4.a). Furthermore, we reveal that when leukaemia cells are co-cultured with 3D BM-MSC-spheroids they show greater reduced sensitivity, compared to the 2D co-culture arm, against dexamethasone, ABT-199 and the combination in a sample subgroup that exhibited reduced in vivo efficacy (previously unpublished data existing in the lab from earlier studies). This reveals the ability of our 3D co-culture model in being able to screen off false-positive hits derived from 2D models, consequently minimising in vitro to in vivo attrition rates. We further confirm that when co-cultured with 3D MSC spheres, ALL cells expectedly in 3D-MSC spheroid-co-cultures, however, fail to increase in cell counts on day five, in the dexamethasone treatment arm (Fig.4.b). Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
2. There are a number of potential technical limitations of the co-culture approach that are not acknowledged: i) the requirement for access to a source of MSCs which are not readily available to most labs; ii) certain drugs (notably cytotoxic chemotherapy) are likely to have direct toxicity to the MSCs themselves; iii) the lack of a vascular component to this system might result in artificially high levels of physical protection from drug exposure by the 3D niche (i.e. potential for false negatives).
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for five days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
We address remaining of points i), ii) and iii) in an additional “Study Limitations” section.
Study Limitations
Here we use primary human MSC, which indeed may be difficult to source, and which may lead to donor variability. Using induced pluripotent stem cell (iPSC) derived MSC to co-culture patient-derived leukaemia¹⁴ may be an attractive alternative, and would furthermore enable assay standardisation, thereby improving data reproducibility. Moreover, although we show that MSC showed no adverse effect to dexamethasone and ABT-199 treatment, many anti-cancer treatments notably cytotoxic chemotherapy may cause direct toxicity to the MSC. However, this further emphasises the need to include key microenvironment cell types when conducting anti-cancer drug testing, especially given cancer treatments influence interactions between leukaemia and their surrounding niche, with many cytotoxic treatments affecting both leukaemia and bone marrow cells in patients. Furthermore, we acknowledge that an ideal representation of 3D biomimetic human cell-based model would include capturing both mesenchymal and vascular bone marrow components within an immune-responsive context.
3. The potential costs and animal savings presented are feasible, but likely at the upper end of the spectrum and will differ between institutions. For example, the time to generate a novel PDX is indeed many months, but once established PDX models in ALL engraft much more quickly and reproducibly and established PDX material is readily available. In vivo toxicity testing is not needed for established drugs being re-purposed; conversely novel chemical agents will still need some in vivo toxicity data prior to regulatory approval for first-in-human studies.
Response
Indeed, the time taken to generate a novel PDX sample can span between months to a year, and this time is shortened when PDX samples are serially transplanted in subsequent mouse models. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully, before any drug response testing can begin.
We agree that in vivo toxicity is not needed for drugs being re-purposed, unless these involve testing of new combinatorial regimens, and furthermore note recent announcement by the U.S. Food and Drug Administration (FDA) that new drugs would not be mandated to be tested in animals prior to first-in-human trials.
We have reflected this in the manuscript within Discussion via the following additional text
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor points:
In the introduction it would be helpful to specify the precise leukaemia being studied and at which age. In particular, relapse rates in adult B-ALL are much higher than those presented, which are indicative of the paediatric setting.
Response:
We have addressed this both in the abstract and in the introduction via the following text:
Abstract:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro approach to co-culture patient-derived leukaemia cells with 3D mesenchymal stroma cell spheroids, MSC-spheroids.
Introduction:
Acute lymphoblastic leukaemia (ALL) management in children is hindered by two chief obstacles: 1. Treatment toxicity^1,2 2. 15-20% of patients go into relapse, when the disease can be treatment resistant³.
In the 2D co-culture methods, please provide a reference on how to process MSCs and specify the final volume of media per well used to plate the leukaemia cells.
This has been provided as below:
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study⁹. MSC were used between passages ranging from p2 – p5. MSC were seeded on Matrigel coated 48 well plates at 1x104 cells/0.5mL/cm2 in their respective media (MSC media, Table 1). After 24 hours, the media was aspirated, and the cells rinsed with 1mL SFEM. Leukaemia cells were then plated onto the MSC layers, at a density of 0.25x105 cells/1 mL per well, suspended in SFEM media.
For the response data presented in figures 1 and 4, please clarify in the legend or methods the nature of the readouts and timepoints used.
Figure 1, now Figure 4. Readouts have been clarified in legend as follows:
“In vitro data readout includes viable cell counts; in vivo data (right hand graphs) is shown as bioluminescence imaging from luciferase expressing PDX cells in total flux(p/s). Total flux is a surrogate of blast number in vivo.”
Figure 4, now Figure 3. Readouts have been clarified in legend as follows:
Figure 3. 3D MSC-spheroids show confer higher proliferation and improved survival onto patient-derived ALL. Growth kinetics, measured via viable cell counts of ALL samples (a,d) L49120, (b,e) MS40 and (c,f) L707D across a 5 day period, with and without low dose dexamethasone (10nM) pressure, as co-cultures with 3D MSC spheres versus 2D MSC-co-culture. L49120, MS40 and L707D refer to three different patient samples, i.e., 3 biological repeats. (d,e,f) Dexamethasone treatment, data shown for 5nM treatment, is less effective in a 3D microenvironment. N= 3. g. Flow cytometry data, representative plots, showing propidium iodide, PI, positive ALL cells (sample L707) following five days of 10nM dexamethasone treatment. The column graph shows % ALL cells stained positive for PI. N = 2
This manuscript by Wilson et al provides a rationale, methodological details and pilot data supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid co-cultures in the preclinical testing of drugs for acute leukaemia. The authors provide a detailed rationale for the potential benefits of this system, including: i) reduction in animal use/suffering; ii) reduced costs; and iii) the ability to model the protective impact of bone marrow micro-environmental influences in abrogating drug efficacy in vitro, reducing the number “false positive” drug hits taken forward to in vivo model systems. The authors provide data showing the equivalence of 2D in vitro drug sensitivity with PDX models (n=2) and compare 2D vs 3D co-culture of human leukaemias (n=3) in proliferation and dexamethasone sensitivity assays, showing consistently enhanced proliferation and reduced dexamethasone sensitivity in the 3D system. They also present methodological data on the establishment of MSC spheroids as well as modelling on the potential reduction in animal use and costs based on local experience.
Overall, the rationale to develop more physiologically relevant in vitro co-culture systems is a very worthwhile endeavour with clear potential benefits for animal welfare, costs and in streamlining drug development. It also has the potential advantage of being used in the study of leukaemias that do not engraft in current immunosuppressed mouse models.
In my opinion the work has three major limitations that would benefit from either additional data or acknowledgement in the discussion.

Whilst this work demonstrates the feasibility of the approach, it is not possible from the data presented to conclude that 3D systems perform better than either 2D co-culture or PDX systems. Specifically, the data presented uses a small number of patient samples (n=2 or 3) and drugs (Dexamethasone ± ABT199). The three systems are not directly compared and no example of an in vitro drug hit that proves “false-positive” when tested in vivo is tested in parallel 2D/3D co-culture.

Response:
We provide additional data comparing 2D co-culture and in vivo data with 3D sphere co-culture data. We find that patient-derived leukaemia cells show reduced sensitivity in 3D co-culture settings compared to 2D co-cultures, potentially indicating the superior ability of 3D models to screen out 2D “false-positive” hits. Furthermore, we show that patient-derived leukaemia cells from a leukaemia cytogenetic subgroup, subgroup A, showing high sensitivity to dex-ABT-199 combination in vivo, shows high combination sensitivity in 3D in vitro co-cultures. Similarly, we show that patient-derived leukaemia cells from the subgroup B shows reduced sensitivity to dex-ABT-199 combination both in vivo and in vitro, in 2D and 3D co-culture settings.
We add the following text within the main manuscript:
Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity
Improved in vivo predictivity is a key requisite for ex vivo animal replacement models, if these platforms are to effectively replace mouse experiments. We confirmed that BM-MSC/leukaemia 2D co-culture platform generated drug dose response data that was largely comparable with drug response observed in vivo in PDX-mouse models (Fig 4.a). Furthermore, we reveal that when leukaemia cells are co-cultured with 3D BM-MSC-spheroids they show greater reduced sensitivity, compared to the 2D co-culture arm, against dexamethasone, ABT-199 and the combination in a sample subgroup that exhibited reduced in vivo efficacy (previously unpublished data existing in the lab from earlier studies). This reveals the ability of our 3D co-culture model in being able to screen off false-positive hits derived from 2D models, consequently minimising in vitro to in vivo attrition rates. We further confirm that when co-cultured with 3D MSC spheres, ALL cells expectedly in 3D-MSC spheroid-co-cultures, however, fail to increase in cell counts on day five, in the dexamethasone treatment arm (Fig.4.b). Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
2. There are a number of potential technical limitations of the co-culture approach that are not acknowledged: i) the requirement for access to a source of MSCs which are not readily available to most labs; ii) certain drugs (notably cytotoxic chemotherapy) are likely to have direct toxicity to the MSCs themselves; iii) the lack of a vascular component to this system might result in artificially high levels of physical protection from drug exposure by the 3D niche (i.e. potential for false negatives).
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for five days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
We address remaining of points i), ii) and iii) in an additional “Study Limitations” section.
Study Limitations
Here we use primary human MSC, which indeed may be difficult to source, and which may lead to donor variability. Using induced pluripotent stem cell (iPSC) derived MSC to co-culture patient-derived leukaemia¹⁴ may be an attractive alternative, and would furthermore enable assay standardisation, thereby improving data reproducibility. Moreover, although we show that MSC showed no adverse effect to dexamethasone and ABT-199 treatment, many anti-cancer treatments notably cytotoxic chemotherapy may cause direct toxicity to the MSC. However, this further emphasises the need to include key microenvironment cell types when conducting anti-cancer drug testing, especially given cancer treatments influence interactions between leukaemia and their surrounding niche, with many cytotoxic treatments affecting both leukaemia and bone marrow cells in patients. Furthermore, we acknowledge that an ideal representation of 3D biomimetic human cell-based model would include capturing both mesenchymal and vascular bone marrow components within an immune-responsive context.
3. The potential costs and animal savings presented are feasible, but likely at the upper end of the spectrum and will differ between institutions. For example, the time to generate a novel PDX is indeed many months, but once established PDX models in ALL engraft much more quickly and reproducibly and established PDX material is readily available. In vivo toxicity testing is not needed for established drugs being re-purposed; conversely novel chemical agents will still need some in vivo toxicity data prior to regulatory approval for first-in-human studies.
Response
Indeed, the time taken to generate a novel PDX sample can span between months to a year, and this time is shortened when PDX samples are serially transplanted in subsequent mouse models. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully, before any drug response testing can begin.
We agree that in vivo toxicity is not needed for drugs being re-purposed, unless these involve testing of new combinatorial regimens, and furthermore note recent announcement by the U.S. Food and Drug Administration (FDA) that new drugs would not be mandated to be tested in animals prior to first-in-human trials.
We have reflected this in the manuscript within Discussion via the following additional text
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor points:
In the introduction it would be helpful to specify the precise leukaemia being studied and at which age. In particular, relapse rates in adult B-ALL are much higher than those presented, which are indicative of the paediatric setting.
Response:
We have addressed this both in the abstract and in the introduction via the following text:
Abstract:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro approach to co-culture patient-derived leukaemia cells with 3D mesenchymal stroma cell spheroids, MSC-spheroids.
Introduction:
Acute lymphoblastic leukaemia (ALL) management in children is hindered by two chief obstacles: 1. Treatment toxicity^1,2 2. 15-20% of patients go into relapse, when the disease can be treatment resistant³.
In the 2D co-culture methods, please provide a reference on how to process MSCs and specify the final volume of media per well used to plate the leukaemia cells.
This has been provided as below:
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study⁹. MSC were used between passages ranging from p2 – p5. MSC were seeded on Matrigel coated 48 well plates at 1x104 cells/0.5mL/cm2 in their respective media (MSC media, Table 1). After 24 hours, the media was aspirated, and the cells rinsed with 1mL SFEM. Leukaemia cells were then plated onto the MSC layers, at a density of 0.25x105 cells/1 mL per well, suspended in SFEM media.
For the response data presented in figures 1 and 4, please clarify in the legend or methods the nature of the readouts and timepoints used.
Figure 1, now Figure 4. Readouts have been clarified in legend as follows:
“In vitro data readout includes viable cell counts; in vivo data (right hand graphs) is shown as bioluminescence imaging from luciferase expressing PDX cells in total flux(p/s). Total flux is a surrogate of blast number in vivo.”
Figure 4, now Figure 3. Readouts have been clarified in legend as follows:
Figure 3. 3D MSC-spheroids show confer higher proliferation and improved survival onto patient-derived ALL. Growth kinetics, measured via viable cell counts of ALL samples (a,d) L49120, (b,e) MS40 and (c,f) L707D across a 5 day period, with and without low dose dexamethasone (10nM) pressure, as co-cultures with 3D MSC spheres versus 2D MSC-co-culture. L49120, MS40 and L707D refer to three different patient samples, i.e., 3 biological repeats. (d,e,f) Dexamethasone treatment, data shown for 5nM treatment, is less effective in a 3D microenvironment. N= 3. g. Flow cytometry data, representative plots, showing propidium iodide, PI, positive ALL cells (sample L707) following five days of 10nM dexamethasone treatment. The column graph shows % ALL cells stained positive for PI. N = 2
Competing Interests: No competing interests were disclosed. Close
Report a concern

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 09 Nov 2022

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 2 (revision) 06 Nov 23	read	read
Version 1 09 Nov 22	read	read

Simon E. Richardson, Wellcome - MRC Cambridge Stem Cell Institute, Cambridge, UK
Helen Wheadon, University of Glasgow, Glasgow, UK

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

46 Views

23 Nov 2023 | for Version 2

Helen Wheadon, Paul O'Gorman Leukaemia Research Centre, School of Cancer Sciences, University of Glasgow, Glasgow, UK

46 Views Cite this report Responses(0)

Approved

The authors have addressed all the comments and included the additional data requested.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Stem cells, leukaemia modelling, signalling, pre-clinical drug testing.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

16 Views

20 Nov 2023 | for Version 2

Simon E. Richardson, Wellcome - MRC Cambridge Stem Cell Institute, Cambridge, UK

16 Views Cite this report Responses(0)

Approved

Many thanks for accommodating my recommendations.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Leukaemia biology, disease modelling, stem cells, epigenetics, preclinical drug testing.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

45 Views

31 Jan 2023 | for Version 1

Helen Wheadon, Paul O'Gorman Leukaemia Research Centre, School of Cancer Sciences, University of Glasgow, Glasgow, UK

45 Views Cite this report Responses(1)

Approved With Reservations

The MSC are characterised by gene expression, it would be good to include flow cytometry data; CD90⁺105⁺73⁺34^-45^- are key markers demonstrating stemness. The culture conditions using FCS can also lead to changes in the MSCs so it would be good to include passage number. Figure 3 live/dead staining of the spheroids especially for the size used in the drug treatment assays in Figure 4 would be important to include.
Data showing that dexamethasone and ABT199 do not detrimentally affect the MSC monoculture and MSC spheroids would also be important to include.
Figure 4 looks at proliferation, apoptosis assays would be good to include to show whether cell death was occurring.
Data showing similar results in ALL patient samples known to fail to engraft in vivo would strengthen the rationale for adopting the 3D system.
Although the potential costs and animal savings presented are feasible, the system is quite simplistic and is more likely to be incorporated as an additional test rather than be adopted as a replacement. It would be more attractive if the time frame could be extended and more details on the application for high throughput screening development was discussed. Also, in vivo toxicity testing of novel compounds will still be required in order for regulatory approval for any Phase 1 clinical trial in humans to be progressed.

Need to define at the start that you are talking about ALL as it reads like a general overview which means some of the % incidence rates etc. are not correct. It would be good to mention what type of ALL as well, is it B-ALL, T-ALL, childhood, adult?
Paragraph 3 page 3: Most research groups would use primary patient samples in vitro prior to moving to in vivo models. This should be included.
Paragraph 2 Page 4: Remove blasts and replace with LSCs also include disease type chronic myeloid leukaemia.
Page 11 ‘such spheroid biobanks’: do they actually exist? Or are you planning on constructing a biobank?
‘MSC spheroids provide superior protection to leukaemia cells against dexamethasone treatment. are appropriate in modelling treatment resistance which remains a major clinical challenge in cancer management’.
Is this statement correct, not really looking at resistance, just reduced sensitivity to the drugs at that dose when in 3D rather than 2D culture. Need to amend and extend to include how you would look at resistance i.e. relapsed patients and the potential to interrogate resistance mechanisms.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Stem cells, leukaemia modelling, signalling, pre-clinical drug testing.

Respond to this report

Responses (1)

Author Response

28 Nov 2023

Deepali Pal, Wolfson Childhood Cancer Research Centre, Translational and Clinical Research Institute, Newcastle University, UK, Newcastle upon Tyne, NE1 7RU, UK

The manuscript by Wilson et al. provides a convincing argument for the requirement of additional in vitro models to improve drug testing in acute lymphocytic leukaemia (ALL) and reduce the reliance on Xenograft mouse models. Preliminary data is presented supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid/primary ALL co-cultures for the use in preclinical testing of drugs. Proof of principle data is provided showing that simple 2D co-culture on MSCs gives a similar range of drug responses to dexamethasone and the BCL2 mimetic drug ABT199 as observed in in vivo studies for 2 primary ALL patient samples. The authors then show optimisation data using Aggrewell plates, demonstrating uniform spheroid formation and a corresponding increase in spheroid diameter when cell seeding density is increased. The final figure then compares primary ALL cell proliferation in 2D and 3D culture and drug responses to dexamethasone. Using 3 independent patient samples they show that MSC spheroids support cell proliferation over a 5 day time frame and provide protection to dexamethasone. These are important observations and support the introduction of a more physiologically relevant humanised system for drug screening prior to conducting in vivo studies. Another potential advantage would be if the authors had data demonstrating that the system supports patients' samples which do not engraft, as there is a high engraftment failure rate in Xenograft models with not all patient samples being successful. This could potentially lead to more robust data on patient’s responses. Given patient heterogeneity mouse models may be biasing certain traits/genetics due to the engraftment limitations observed.
Overall, the system if adopted by other researchers could potentially reduce animal numbers and suffering, reduce the cost and select the most promising drugs for additional testing. It would therefore have impact on replacement and reduction of mouse experiments.
However, there are some limitations in the results shown that would be strengthened by additional experiments:
The MSC are characterised by gene expression, it would be good to include flow cytometry data; CD90+105+73+34-45- are key markers demonstrating stemness. The culture conditions using FCS can also lead to changes in the MSCs so it would be good to include passage number. Figure 3 live/dead staining of the spheroids especially for the size used in the drug treatment assays in Figure 4 would be important to include.
Response:
Additional data addressing these points have been added in Figure 2. We include flow cytometry data showing MSC in 3D spheroid format express CD105, CD90 and CD73. We include additional data showing the expression of casein Calcein (live cell dye) and Hoechst-33342 (live and dead cell dye) in MSC spheroids at a diameter of 100 µM, spheroid size used in subsequent experiments.
MSC passage number used was between p2 and p5, this has been clarified within Methods
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study9. MSC were used between passages ranging from p2 – p5. Data showing that dexamethasone and ABT199 do not detrimentally affect the MSC monoculture and MSC spheroids would also be important to include.
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for seven days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
Figure 4 looks at proliferation, apoptosis assays would be good to include to show whether cell death was occurring.
Response
We provide additional data showing propidium iodide, PI staining in ALL cells following treatment with dexamethasone.
We include following text within Results, Patient-derived leukaemia cells co-cultured with 3D MSC spheres show superior proliferation and enhanced treatment resistance.
“We find that ALL cells show greater reduction in sensitivity to dexamethasone when co-cultured with 3D BM-MSC (Fig.3.d-f). This could be owing to potentially improved functional cell-cell contacts and physiologically relevant cell polarity being achieved in a 3D format. This might have caused increased 3D versus 2D MSC-conferred ALL proliferation and/or improved ALL survival. However, reduced sensitivity could also be due to altered drug availability within 3D spheroids. These data highlight the advantage of 3D organoid-based co-culture systems over routine 2D cultures in two respects: 1. Achieving higher ALL cell cycling which is essential for the action or testing of majority of anti-cancer treatments 2. Obtaining reduced drug sensitivity, possibly owing to improved treatment resistance– a major current day clinical challenge in cancer management. We further investigate the ability of MSC-spheroids to reduce ALL cell death and find that when treated with a higher dose of dexamethasone, that is, at 10nM, then both 2D and 3D MSC-spheroids support survival of leukaemia cells (Fig.3.g.). We now progress to reveal proof-of-confidence-in-application data, justifying the suitability of our platform in conduction combinatorial drug testing.”
Data showing similar results in ALL patient samples known to fail to engraft in vivo would strengthen the rationale for adopting the 3D system.
Response
Unfortunately, we do not have ALL samples that fail to engraft. Nevertheless, we have previously shown the ability of the 2D MSC co-culture system to culture primary AML samples from t(8;21)-positive patients, which would not successfully engraft into mouse models available at the time. Given our finding that 3D-MSC-spheres provide superior support in in vitro proliferation of leukaemia cells, this study strengthens the rationale for adopting in vitro MSC-based co-culture systems.
Text entered in Discussion:
“Patient samples do not always engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system successfully cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8 which did not engraft any mouse model available at the time.”
Although the potential costs and animal savings presented are feasible, the system is quite simplistic and is more likely to be incorporated as an additional test rather than be adopted as a replacement. It would be more attractive if the time frame could be extended and more details on the application for high throughput screening development was discussed. Also, in vivo toxicity testing of novel compounds will still be required in order for regulatory approval for any Phase 1 clinical trial in humans to be progressed.
Response
We have aimed to successfully address these points in the discussion, via the additional text:
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor corrections:
Research highlights - blasts would only be appropriate for certain types of leukaemia, either need to define it’s ALL specifically or change to stem/progenitor.
Scientific benefit:
A 3D spheroid-based approach with improved clinical relevance for ex vivo co-culture of primary patient leukaemia samples for further investigation into leukaemia biology such as stem/progenitor cell-niche interactions, stem/progenitor cell proliferation and treatment resistance.
3Rs benefit:
To replace moderate severity animal (mice) procedures in leukaemia research and early pre-clinical drug testing.
Current applications:
Exploration of leukaemia biology such as stem/progenitor cell proliferation, stem/progenitor cell -niche interactions, niche-impacted treatment resistance and obtain drug response data.
Response
We have replaced “blasts” with “stem/progenitor” as appropriate.
Introduction:
Need to define at the start that you are talking about ALL as it reads like a general overview which means some of the % incidence rates etc. are not correct. It would be good to mention what type of ALL as well, is it B-ALL, T-ALL, childhood, adult?
Response
This has been clarified as below:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro platform to establish co-cultures of patient-derived leukaemia cells with 3D bone marrow mesenchyme spheroids, BM-MSC-spheroids.
Paragraph 3 page 3: Most research groups would use primary patient samples in vitro prior to moving to in vivo models. This should be included.
Response
This has been included as below:
Although several research groups would likely use primary patient for in vitro studies before moving into in vivo models, in vivo models are regarded as gold standard preclinical models, and are used as key models to expand primary samples as vital research resources.
Paragraph 2 Page 4: Remove blasts and replace with LSCs also include disease type chronic myeloid leukaemia.
Response
We apologise for using “blasts”, all of these have been replaced with “leukaemia cell” or “ALL”. Disease type chronic myeloid leukaemia has been added to the following sentence
Cell lines retain cytogenic characteristics of acute lymphoblastic leukaemia (ALL), and other diseases like chronic myeloid leukaemia, but being derived from patients with relapsed disease these samples do not represent the molecular complexity of disease at presentation14,15.
Page 11 ‘such spheroid biobanks’: do they actually exist? Or are you planning on constructing a biobank?
Response
We apologise for the ambiguity and have now re-worded the section below:
Following further extensive validation, such 3D-based preclinical models would furthermore have the potential to be embedded within clinical trials and healthcare systems for the purposes of detecting responders as well as to aid risk stratification.
‘MSC spheroids provide superior protection to leukaemia cells against dexamethasone treatment. are appropriate in modelling treatment resistance which remains a major clinical challenge in cancer management’.
Is this statement correct, not really looking at resistance, just reduced sensitivity to the drugs at that dose when in 3D rather than 2D culture. Need to amend and extend to include how you would look at resistance i.e. relapsed patients and the potential to interrogate resistance mechanisms.
Response
This statement has now been clarified:
This means that compared to 2D MSC cultures, MSC spheroid-based models, might be promising to study the biology of leukaemia cells from relapsed disease, consequently helping interrogate treatment resistance mechanisms, a major clinical challenge in cancer management.

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

49 Views

19 Dec 2022 | for Version 1

Simon E. Richardson, Wellcome - MRC Cambridge Stem Cell Institute, Cambridge, UK

49 Views Cite this report Responses(1)

Approved With Reservations

Whilst this work demonstrates the feasibility of the approach, it is not possible from the data presented to conclude that 3D systems perform better than either 2D co-culture or PDX systems. Specifically, the data presented uses a small number of patient samples (n=2 or 3) and drugs (Dexamethasone ± ABT199). The three systems are not directly compared and no example of an in vitro drug hit that proves “false-positive” when tested in vivo is tested in parallel 2D/3D co-culture.
There are a number of potential technical limitations of the co-culture approach that are not acknowledged: i) the requirement for access to a source of MSCs which are not readily available to most labs; ii) certain drugs (notably cytotoxic chemotherapy) are likely to have direct toxicity to the MSCs themselves; iii) the lack of a vascular component to this system might result in artificially high levels of physical protection from drug exposure by the 3D niche (i.e. potential for false negatives).
The potential costs and animal savings presented are feasible, but likely at the upper end of the spectrum and will differ between institutions. For example, the time to generate a novel PDX is indeed many months, but once established PDX models in ALL engraft much more quickly and reproducibly and established PDX material is readily available. In vivo toxicity testing is not needed for established drugs being re-purposed; conversely novel chemical agents will still need some in vivo toxicity data prior to regulatory approval for first-in-human studies.

Minor points:

In the introduction it would be helpful to specify the precise leukaemia being studied and at which age. In particular, relapse rates in adult B-ALL are much higher than those presented, which are indicative of the paediatric setting.
In the 2D co-culture methods, please provide a reference on how to process MSCs and specify the final volume of media per well used to plate the leukaemia cells.
For the response data presented in figures 1 and 4, please clarify in the legend or methods the nature of the readouts and timepoints used.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Leukaemia biology, disease modelling, stem cells, epigenetics, preclinical drug testing.

Respond to this report

Responses (1)

Author Response

28 Nov 2023

Deepali Pal, Wolfson Childhood Cancer Research Centre, Translational and Clinical Research Institute, Newcastle University, UK, Newcastle upon Tyne, NE1 7RU, UK

This manuscript by Wilson et al provides a rationale, methodological details and pilot data supporting the use of 3D human mesenchymal stroma cell (MSC) spheroid co-cultures in the preclinical testing of drugs for acute leukaemia. The authors provide a detailed rationale for the potential benefits of this system, including: i) reduction in animal use/suffering; ii) reduced costs; and iii) the ability to model the protective impact of bone marrow micro-environmental influences in abrogating drug efficacy in vitro, reducing the number “false positive” drug hits taken forward to in vivo model systems. The authors provide data showing the equivalence of 2D in vitro drug sensitivity with PDX models (n=2) and compare 2D vs 3D co-culture of human leukaemias (n=3) in proliferation and dexamethasone sensitivity assays, showing consistently enhanced proliferation and reduced dexamethasone sensitivity in the 3D system. They also present methodological data on the establishment of MSC spheroids as well as modelling on the potential reduction in animal use and costs based on local experience.
Overall, the rationale to develop more physiologically relevant in vitro co-culture systems is a very worthwhile endeavour with clear potential benefits for animal welfare, costs and in streamlining drug development. It also has the potential advantage of being used in the study of leukaemias that do not engraft in current immunosuppressed mouse models.
In my opinion the work has three major limitations that would benefit from either additional data or acknowledgement in the discussion.

Whilst this work demonstrates the feasibility of the approach, it is not possible from the data presented to conclude that 3D systems perform better than either 2D co-culture or PDX systems. Specifically, the data presented uses a small number of patient samples (n=2 or 3) and drugs (Dexamethasone ± ABT199). The three systems are not directly compared and no example of an in vitro drug hit that proves “false-positive” when tested in vivo is tested in parallel 2D/3D co-culture.

Response:
We provide additional data comparing 2D co-culture and in vivo data with 3D sphere co-culture data. We find that patient-derived leukaemia cells show reduced sensitivity in 3D co-culture settings compared to 2D co-cultures, potentially indicating the superior ability of 3D models to screen out 2D “false-positive” hits. Furthermore, we show that patient-derived leukaemia cells from a leukaemia cytogenetic subgroup, subgroup A, showing high sensitivity to dex-ABT-199 combination in vivo, shows high combination sensitivity in 3D in vitro co-cultures. Similarly, we show that patient-derived leukaemia cells from the subgroup B shows reduced sensitivity to dex-ABT-199 combination both in vivo and in vitro, in 2D and 3D co-culture settings.
We add the following text within the main manuscript:
Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity
Improved in vivo predictivity is a key requisite for ex vivo animal replacement models, if these platforms are to effectively replace mouse experiments. We confirmed that BM-MSC/leukaemia 2D co-culture platform generated drug dose response data that was largely comparable with drug response observed in vivo in PDX-mouse models (Fig 4.a). Furthermore, we reveal that when leukaemia cells are co-cultured with 3D BM-MSC-spheroids they show greater reduced sensitivity, compared to the 2D co-culture arm, against dexamethasone, ABT-199 and the combination in a sample subgroup that exhibited reduced in vivo efficacy (previously unpublished data existing in the lab from earlier studies). This reveals the ability of our 3D co-culture model in being able to screen off false-positive hits derived from 2D models, consequently minimising in vitro to in vivo attrition rates. We further confirm that when co-cultured with 3D MSC spheres, ALL cells expectedly in 3D-MSC spheroid-co-cultures, however, fail to increase in cell counts on day five, in the dexamethasone treatment arm (Fig.4.b). Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
2. There are a number of potential technical limitations of the co-culture approach that are not acknowledged: i) the requirement for access to a source of MSCs which are not readily available to most labs; ii) certain drugs (notably cytotoxic chemotherapy) are likely to have direct toxicity to the MSCs themselves; iii) the lack of a vascular component to this system might result in artificially high levels of physical protection from drug exposure by the 3D niche (i.e. potential for false negatives).
Response:
We provide additional data and show that neither dexamethasone, nor ABT-199 have any effect on survival of MSC when treated for five days within a 3D sphere format.
We include the following text within Results, Co-cultures of 3D MSC with patient-derived leukaemia cells how high in vivo predictivity:
Moreover, we show that neither dexamethasone, nor ABT-199, a molecularly targeted therapy against BCL-2 positive blood cancers, have any effect on survival of MSC, when treated for five days within a 3D sphere format (Figure 4.c).
We address remaining of points i), ii) and iii) in an additional “Study Limitations” section.
Study Limitations
Here we use primary human MSC, which indeed may be difficult to source, and which may lead to donor variability. Using induced pluripotent stem cell (iPSC) derived MSC to co-culture patient-derived leukaemia¹⁴ may be an attractive alternative, and would furthermore enable assay standardisation, thereby improving data reproducibility. Moreover, although we show that MSC showed no adverse effect to dexamethasone and ABT-199 treatment, many anti-cancer treatments notably cytotoxic chemotherapy may cause direct toxicity to the MSC. However, this further emphasises the need to include key microenvironment cell types when conducting anti-cancer drug testing, especially given cancer treatments influence interactions between leukaemia and their surrounding niche, with many cytotoxic treatments affecting both leukaemia and bone marrow cells in patients. Furthermore, we acknowledge that an ideal representation of 3D biomimetic human cell-based model would include capturing both mesenchymal and vascular bone marrow components within an immune-responsive context.
3. The potential costs and animal savings presented are feasible, but likely at the upper end of the spectrum and will differ between institutions. For example, the time to generate a novel PDX is indeed many months, but once established PDX models in ALL engraft much more quickly and reproducibly and established PDX material is readily available. In vivo toxicity testing is not needed for established drugs being re-purposed; conversely novel chemical agents will still need some in vivo toxicity data prior to regulatory approval for first-in-human studies.
Response
Indeed, the time taken to generate a novel PDX sample can span between months to a year, and this time is shortened when PDX samples are serially transplanted in subsequent mouse models. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully, before any drug response testing can begin.
We agree that in vivo toxicity is not needed for drugs being re-purposed, unless these involve testing of new combinatorial regimens, and furthermore note recent announcement by the U.S. Food and Drug Administration (FDA) that new drugs would not be mandated to be tested in animals prior to first-in-human trials.
We have reflected this in the manuscript within Discussion via the following additional text
Not all leukaemia samples engraft in mice. We have shown, in a previous study, that the 2D MSC co-culture system cultured acute myeloid leukaemia (AML) cells from t(8;21)-positive samples8, which failed to engraft any mouse model available at the time. Samples that do engraft form successful xenograft models, yielding PDX samples in 3-6 months at which point drug testing can be started which takes another 3-4 weeks. Indeed, although the time taken to generate a novel PDX sample can span between months to a year, this time is often shortened when cells from established PDX samples are serially transplanted in subsequent mouse models, to aid generation of PDX lines. Nevertheless, some samples, particularly those belonging to good risk groups, such as high hyperdiploid samples, still require between 6 months – 1 year to engraft successfully before any drug response testing can begin. Moreover although in vivo toxicity assays are not needed for drugs being re-purposed, indicating this to be an area where animal-replacement technologies may perhaps not be relevant, animal testing has been required prior to regulatory approval being given for first-in-human studies. Furthermore, toxicity studies which use animal models are indicated when testing new combinatorial treatment regimens comprising repurposed drugs. This is because tolerability of drug combinations is distinct from that of component single drugs. Nevertheless, the U.S. Food and Drug Administration (FDA) has recently announced that new drugs would not be mandated to be tested in animals prior to first-in-human trials, and an FDA-wide program is furthermore prioritising development of human-relevant methods, with high in vivo predictivity, to replace, reduce and refine animal models in drug testing. This further corroborates the timeliness of prioritising development of transformative human cell-based, non-animal technologies towards preclinical drug testing. Most specifically, a key advantage of our prototype approach would be in medium-high throughput screening of single and combinatorial compounds, particularly as pre-in vivo screens, to prevent “false positive” 2D in vitro hits, such as that observed in Figure 4, from progressing towards in vivo drug efficacy testing.
Minor points:
In the introduction it would be helpful to specify the precise leukaemia being studied and at which age. In particular, relapse rates in adult B-ALL are much higher than those presented, which are indicative of the paediatric setting.
Response:
We have addressed this both in the abstract and in the introduction via the following text:
Abstract:
Using childhood acute lymphoblastic leukaemia (ALL) as a proof-of-concept paradigm, here we develop an in vitro approach to co-culture patient-derived leukaemia cells with 3D mesenchymal stroma cell spheroids, MSC-spheroids.
Introduction:
Acute lymphoblastic leukaemia (ALL) management in children is hindered by two chief obstacles: 1. Treatment toxicity^1,2 2. 15-20% of patients go into relapse, when the disease can be treatment resistant³.
In the 2D co-culture methods, please provide a reference on how to process MSCs and specify the final volume of media per well used to plate the leukaemia cells.
This has been provided as below:
2D Niche-Blast co-culture
Patient derived ALL samples were cultured on 2D monolayers of MSC cells using a protocol published in an earlier study⁹. MSC were used between passages ranging from p2 – p5. MSC were seeded on Matrigel coated 48 well plates at 1x104 cells/0.5mL/cm2 in their respective media (MSC media, Table 1). After 24 hours, the media was aspirated, and the cells rinsed with 1mL SFEM. Leukaemia cells were then plated onto the MSC layers, at a density of 0.25x105 cells/1 mL per well, suspended in SFEM media.
For the response data presented in figures 1 and 4, please clarify in the legend or methods the nature of the readouts and timepoints used.
Figure 1, now Figure 4. Readouts have been clarified in legend as follows:
“In vitro data readout includes viable cell counts; in vivo data (right hand graphs) is shown as bioluminescence imaging from luciferase expressing PDX cells in total flux(p/s). Total flux is a surrogate of blast number in vivo.”
Figure 4, now Figure 3. Readouts have been clarified in legend as follows:
Figure 3. 3D MSC-spheroids show confer higher proliferation and improved survival onto patient-derived ALL. Growth kinetics, measured via viable cell counts of ALL samples (a,d) L49120, (b,e) MS40 and (c,f) L707D across a 5 day period, with and without low dose dexamethasone (10nM) pressure, as co-cultures with 3D MSC spheres versus 2D MSC-co-culture. L49120, MS40 and L707D refer to three different patient samples, i.e., 3 biological repeats. (d,e,f) Dexamethasone treatment, data shown for 5nM treatment, is less effective in a 3D microenvironment. N= 3. g. Flow cytometry data, representative plots, showing propidium iodide, PI, positive ALL cells (sample L707) following five days of 10nM dexamethasone treatment. The column graph shows % ALL cells stained positive for PI. N = 2

View more View less

Competing Interests

No competing interests were disclosed.

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. O'Connor D, et al.: Infection-related mortality in children with acute lymphoblastic leukemia: an analysis of infectious deaths on UKALL2003. Blood. 2014; 124: 1056–1061. PubMed Abstract | Publisher Full Text

[2] 2. Roberts KG: Genetics and prognosis of ALL in children vs adults. Hematology Am Soc Hematol Educ Program. 2018; 2018: 137–145. PubMed Abstract | Publisher Full Text

[3] 3. Locatelli F, Schrappe M, Bernardo ME, et al.: How I treat relapsed childhood acute lymphoblastic leukemia. Blood. 2012; 120: 2807–2816. Publisher Full Text

[4] 4. Seyhan AA: Lost in translation: the valley of death across preclinical and clinical divide – identification of problems and overcoming obstacles. Transl Med Commun. 2019; 4: 18. Publisher Full Text

[5] 5. Moreno L, Pearson AD: How can attrition rates be reduced in cancer drug discovery? Expert Opin Drug Discov. 2013; 8: 363–368. PubMed Abstract | Publisher Full Text

[6] 6. Hutchinson L, Kirk R: High drug attrition rates--where are we going wrong? Nat Rev Clin Oncol. 2011; 8: 189–190. PubMed Abstract | Publisher Full Text

[7] 7. Bomken S, et al.: Lentiviral marking of patient-derived acute lymphoblastic leukaemic cells allows in vivo tracking of disease progression. Leukemia. 2013; 27: 718–721. PubMed Abstract | Publisher Full Text

[8] 8. Martinez-Soria N, et al.: The Oncogenic Transcription Factor RUNX1/ETO Corrupts Cell Cycle Regulation to Drive Leukemic Transformation. Cancer Cell. 2018; 34: 626–642.e8. PubMed Abstract | Publisher Full Text

[9] 9. Pal D, et al.: Long-term in vitro maintenance of clonal abundance and leukaemia-initiating potential in acute lymphoblastic leukaemia. Leukemia. 2016; 30: 1691–1700. PubMed Abstract | Publisher Full Text

[10] 10. Matheson EC, et al.: Glucocorticoids and selumetinib are highly synergistic in RAS pathway-mutated childhood acute lymphoblastic leukemia through upregulation of BIM. Haematologica. 2019; 104: 1804–1811. PubMed Abstract | Publisher Full Text

[11] 11. Thomas HD, et al.: Preclinical selection of a novel poly (ADP-ribose) polymerase inhibitor for clinical trial. Mol Cancer Ther. 2007; 6: 945–956. PubMed Abstract | Publisher Full Text

[12] 12. Munck JM, et al.: Chemosensitization of cancer cells by KU-0060648, a dual inhibitor of DNA-PK and PI-3K. Mol Cancer Ther. 2012; 11: 1789–1798.

[13] 13. Scherr M, et al.: Differential expression of miR-17~92 identifies BCL2 as a therapeutic target in BCR-ABL-positive B-lineage acute lymphoblastic leukemia. Leukemia. 2014; 28: 554–565.

[14] 14. Pal D, et al.: hiPSC-derived bone marrow milieu identifies a clinically actionable driver of niche-mediated treatment resistance in leukemia. Cell Rep Med. 2022; 3: 100717. Publisher Full Text

[15] 15. Pal D, Heidenreich O, Vormoor J: Dormancy stems the tide of chemotherapy. Cancer cell. 2016; 30: 825–826. PubMed Abstract | Publisher Full Text

[16] 16. Baryawno N, et al.: A Cellular Taxonomy of the Bone Marrow Stroma in Homeostasis and Leukemia. Cell. 2019; 177: 1915–1932.e16. PubMed Abstract | Publisher Full Text

[17] 17. Duan CW, et al.: Leukemia propagating cells rebuild an evolving niche in response to therapy. Cancer Cell. 2014; 25: 778–793. Publisher Full Text

[18] 18. Ebinger S, et al.: Characterization of Rare, Dormant, and Therapy-Resistant Cells in Acute Lymphoblastic Leukemia. Cancer Cell. 2016; 30: 849–862. PubMed Abstract | Publisher Full Text

[19] 19. Agarwal P, et al.: Mesenchymal Niche-Specific Expression of Cxcl12 Controls Quiescence of Treatment-Resistant Leukemia Stem Cells. Cell Stem Cell. 2019; 24: 769–784.e6. PubMed Abstract | Publisher Full Text

[20] 20. Skardal A, Shupe T, Atala A: Organoid-on-a-chip and body-on-a-chip systems for drug screening and disease modeling. Drug Discov Today. 2016; 21: 1399–1411. PubMed Abstract | Publisher Full Text

[21] 21. Drost J, Clevers H: Organoids in cancer research. Nat Rev Cancer. 2018; 18: 407–418. Publisher Full Text

[22] 22. Garreta E, et al.: Fine tuning the extracellular environment accelerates the derivation of kidney organoids from human pluripotent stem cells. Nat Mater. 2019; 18: 397–405. Publisher Full Text

[23] 23. Shih YR, et al.: In vivo engineering of bone tissues with hematopoietic functions and mixed chimerism. Proc Natl Acad Sci U S A. 2017; 114: 5419–5424. PubMed Abstract | Publisher Full Text

[24] 24. Pal D, Wilson A, Blair H, et al.:A human mesenchymal spheroid prototype to replace moderate severity animal procedures in leukaemia drug testing. [Dataset]. Mendeley Data. 2022; V1. Publisher Full Text

A human mesenchymal spheroid prototype to replace moderate severity animal procedures in leukaemia drug testing

Abstract

Keywords

Research highlights

Introduction

Methods

Materials

2D Niche-Blast co-culture

Table 1. Materials used.

3D culture of BM-MSC

3D BM-Blast co-culture

Dexamethasone 3D drug assay

Extraction of mRNA

cDNA synthesis

Table 2. cDNA master mix constituents.

qRT-PCR

Table 3. qRT-PCR mix constituents.

Costings analysis of in vivo versus in vitro models

Data analysis

Results

Development and validation of BM-MSC spheres

Figure 1. 2D in vitro platform delivers drug response data with high in vivo predictability to minimise in vitro to in vivo drug attrition rates.

Figure 2. Comparison of existing in vivo preclinical leukaemia models with newly developed ex vivo animal replacement organoid models.

Figure 3. Advancing the 2D ex vivo platform to develop 3D spheroid models.

Patient-derived leukaemia cells co-cultured with MSC show superior proliferation and enhanced treatment resistance

Figure 4. Co-culture of patient derived leukaemia samples on both 2D and 3D MSC +/- treatment pressure.

Figure 5. A comparative costs analysis between 3D ex vivo and in vivo preclinical models show an approximate 30% costs benefit and consequently increased financial sustainability when using ex vivo organoid models.

Discussion

Data availability

Acknowledgements

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated

Keep up to date with the NC3Rs

Thank you!