ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan

[version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]
PUBLISHED 23 Oct 2024
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Introduction

Diarrhea is a significant health problem in the Third World. Identification of the pathogen that causes diarrhea is vital for measures to prevent and control this disease. There are also very few reports of diarrhea in Sudan. Our study aimed to determine the Prevalence of specific protozoan pathogens (Entamoeba histolytica, Cryptosporidium parvum., and Giardia spp) in children in Khartoum, Sudan.

Methods

We conducted a cross-sectional survey among children under five years of age hospitalized with acute diarrhea between April and December 2014. Diarrheal stool samples were collected, and E. histolytica, C. parvum, and Giardia spp were examined using multiplex real-time PCR.

Results

Four hundred and thirty-seven children with acute diarrhea were included in this study; the higher prevalence of diarrhea was in the age ≤ 2 years old (403, 92.2%), >2–≤4 years (32, 7.3%), and >4–<5 years (2, 0.5%). The male-to-female ratio in this study was 1:1.7. Infection with intestinal parasite was found in 155 (35.5%) cases, and co-infection was detected in 16 (3.7%) cases. Giardia spp (18.8%) and C. parvum (15.8%) were the most frequently identified parasites, followed by E. histolytica (0.9). The parasite infection rate was highest and lowest in the under 2-year-old group 143 (35.5%) and the 2–4-year-old group 12 (37.5%). The infection rate was higher in boys 104 (37.7%) than in girls 51 (31.7%). The number of positive cases was higher in the rainy season (August to December) 143 (37.4%), corresponding with that in the dry Season (April to June) 12 (21.8%).

Discussion

Our present study demonstrated the high prevalence of Giardia spp and C. parvum in children with diarrhea in the Khartoum region and the usefulness of the multiplex real-time method in disclosing pathogenic protozoal agents. Our result highlighted the necessity of developing intervention measurement and control strategies to deal with childhood parasitic diarrhea in this region.

Keywords

Diarrhea, Detection, Parasitic, Protozoan, Pathogens, Childhood

Revised Amendments from Version 3

We applied all comments by reviewers in this new version; 

We made corrections in the whole article, including the Table and Figure. 
We changed the percentage according to categories in all Tables.
We changed the Figure as per the reviewer's comments.
We revised all typographical and grammar errors.

See the authors' detailed response to the review by Sonia Boughattas
See the authors' detailed response to the review by Francisco Ponce-Gordo
See the authors' detailed response to the review by Monira Sarmin
See the authors' detailed response to the review by Jean Bernard Lekana-Douki

Introduction

Diarrhea is defined as passing soft, loose, or watery feces three times or more in 24 hours; it is usually a result of the consumption of pathogen-contaminated water or food.1 Diarrhea remains the leading cause of death and illness in children in third-world countries.24 Around 1.7 billion cases of childhood diarrhea are reported each year, and diarrhea is estimated to have killed more than 500,000 children under the age of 5 worldwide in 2019.1,5 Where diarrhea is considered the third most common cause for young children to visit health centers, some of the underlying conditions found in the community of most developing countries, including malnutrition and poor hygiene, may increase the risk of experiencing diarrheal disease.6 In developed countries, the availability of modern technologies and suitable water supply has led to a decline in global death due to diarrhea; however, despite the substantial effort to supply modern technology and management practices, diarrhea in Africa is still unacceptably ranked as the second cause of death among young children.710 Despite the high morbidity of childhood diarrhea in Sudan, the knowledge of the parasitic causative agents is scant. Parasitic protozoans that infect the intestinal tract in developing countries include Cryptosporidium spp. Giardia spp. and Entamoeba histolytica, respectively, are the agents that cause cryptosporidiosis, giardiasis, and amoebiasis, which are considered prime for diarrheal diseases in children under five years old.11 The limited specificity and sensitivity of the microscopic method commonly used in most Sudan laboratories decreased the parasitic infection detection rate. As a result, there is little information about the precise incidence of diarrhea and causative protozoan agents.

This study aimed to explore the incidence of some protozoan organisms (Cryptosporidium parvum, Giardia spp., and Entamoeba histolytica) that produce acute diarrheal illness among young children using molecular techniques.

Methods

Ethical considerations

The study was approved by the ethical committee of the Sudan Academy of Sciences (Approval number 2367), and written permission was obtained from the registered child’s parents or guardian.

Design, area, and period of study

This cross-sectional study was co-conducted at the Central Laboratory, Ministry of Higher Education and Research, Sudan, and the National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, China (CDC), Beijing, China, during two different Seasons (the hot, dry Season from April to June (Summer), and the rainy season from August to December (Autumn) in the year 2014 at Khartoum teaching hospitals.

Participants (inclusion and exclusion criteria)

A total of 437 fecal samples (one per patient) were collected from children admitted to hospitals who had been clinically diagnosed with acute diarrhea from 1 to 4 days before the sample collection, were less than five years old.

Sample collection and storage

The stool sample was collected in a dry, clean plastic container. The specimens were kept at −20°C till tested in early 2015; frozen samples were sent via dry ice to the Center for Disease Control and Prevention in Beijing, China.

Data collection

Patient data, including age, sex, and Season, were collected through a structured questionnaire.

Nucleic acid extraction

Per the manufacturer’s instructions, parasite DNA was extracted from 200 μL of 10% fecal suspension prepared in phosphate buffer saline using QIAamp® Fast DNA Stool Mini Kit (Qiagen, Hilden, Germany). The extracts were eluted in 60 μL of DNase-free water, immediately aliquoted in 20 μL, and kept at −80°C.

PCR amplification and parasite detection

Primers and probes of multiplex real-time PCR

Three primer pairs and three probes were used for the simultaneous detection of E. histolytica, C. parvum, and Giardia spp.11 Table 1 shows the oligonucleotide sequence of the primers, probes, and target genes.

Table 1. The nucleotide primers and probes for multiplex real-time PCR were used in this study.

OrganismTarget geneaPrimer sequence (5′-3′)bProbe (5′-3′)
E. histolyticaSSU rRNAF: ATTGTCGTGGCATCCTAACTCA
R: GCGGACGGCTCATTATAACA
VIC-TCATTGAATGAATTGGCCATTT 11
Giardia spp.SSU rRNAF: GACGGCTCAGGACAACGGTT
R: TTGCCAGCGGTGTCCG
FAM-CCCGCGGCGGTCCCTGCTAG 11
C. parvumCrF CrRF: CGCTTCTCTAGCCTTTCATGA
R: CTTCACGTGTGTTTGCCAAT
Texas Red-CCAATCACAGAATCA 11
TCAGAATCGACTGGTATC 11

a SSU rRNA, small subunit ribosomal RNA.

b F, forward; R, reverse.

Multiplex real-time PCR

Real-time PCR was performed with a Multiplex PCR kit (Qiagen, Hilden, Germany) in a 20 μL volume containing 6.25 pmol of each E. histolytica-specific primers, 6.25 pmol of each Giardia spp.-specific primers, 25 pmol of each C. parvum-specific primers, 1.75 pmol of E. histolytica-specific VIC-TaqMan probe, 2.5 pmol of G. lamblia-specific FAM-TaqMan probe, 8.75 pmol of C. parvum-specific Texas Red-TaqMan probe. Amplification consisted of 15 min at 95°C, 40 cycles of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C. The iCycler real-time detection system (Bio-Rad) performed amplification, detection, and data analysis.

Statistical analysis

The Chi-square test assessed differences in proportions. P values <0.05 were considered statistically significant.

Result

Demographic data on the population

A total of 437 children admitted to hospitals had been clinically diagnosed with acute diarrhea, Comprising 276 boys and 161 girls. The participants were aged ≤2 years (403, 92.2%), >2–≤4 years (32, 7.3%), and >4–˂5 years (2, 0.5%). A total of 382 samples were gathered during the rainy season (autumn), in contrast to 55 samples collected during the dry season (summer).

Prevalence of parasitic infections

Protozoal were diagnosed in 155/437 (35.5%) cases, among which the highest prevalence was Giardia spp. (82/437, 18.8%), followed by C. parvum (69/437, 15.8%) and E. histolytica (4/437, 0.9%). None were detected in 282 (64.5%) diarrheal cases (Diagram 1).

4c187e07-7acb-45b1-96a9-aa3c04deb9fd_figure1.gif

Diagram 1. Overview of protozoal parasite infections.

Distribution of parasitic infections by age, sex, and seasonality

The highest rate of parasitic infection was seen in the ≤2 years group 143(35.5%) and much lower in the >2–≤4 years old group 12(37.5%) (Table 2). In contrast, the protozoal parasite was not detected in the age group of >4–˂5 years. Among children with parasitic infections, 104(37.7%) were male, while 51(31.7%) were female (Table 3). The incidence of protozoan parasitic infection was higher in the rainy Season (August to December) than in the dry Season (April to June) (143(37.4%) and 12(21.8%), respectively) (Table 4).

Table 2. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the age.

PositiveAge in yearsP-value
N0-2*2-4*4-5*
Giardia spp.82 (18.8%)75 (18.6%)7 (21.9%)0 (0%)0.715
C. parvum69 (15.8%)64 (15%)5 (15.6%)0 (0%)0.828
E. histolytica4 (0.9%)4 (1.09%).0 (0%)0 (0%)0.843
Total155 (35.5%)143 (35.5%)12 (37.5%)0%

* The percentages were calculated from the total of each category.

Table 3. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the sex.

PositiveSexP-value
Number of patients M*F*
Giardia spp.82 (18.8%)62 (22.5%)20 (12.4%)0.010
C. parvum69 (15.8%)41 (14.9%)28 (17.4%)0.483
E. histolytica4 (0.9%)1 (0.4%)3 (1.9%)0.112
Total155 (35.5%)104 (37.7%)51 (31.7%)

* The percentage in males and females were calculated from the total of each category.

Table 4. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the Seasons.

PositiveSeasonP-value
NAutumn*Summer*
Giardia spp.82 (18.8%)74 (19.4%)8 (14.4%)0.391
C. parvum69 (15.8%)65 (17.0%)4 (7.3%)0.064
E. histolytica4 (0.9%)4 (1.0%)0 (0%)0.446
Total155 (35.5%)*143 (37.4%)12 (21.8%)

* The percentages in Autumn and Summer were calculated from the total of each category.

Parasitic single and co-infections

Infection with single parasite was found in 139 cases (31.8%). In contrast, parasite co-infection was detected in 16 patients (3.7%), which involved E. histolytica and Giardia spp. in two cases and Giardia spp. and C. parvum in 14 cases (Table 5).

Table 5. Frequency of samples with co-infections.

PathogenNo. of co-infections (%)
Giardia spp. and C. parvum14 (3.2%)
E. histolytica and Giardia spp.2 (0.5%)
Total16 (3.7%)

Statistical analysis

The occurrence of Giardia in male children was higher and statistically significant than in females (P < 0.01); besides that, all results of other protozoa were statistically not significant, and the comparisons between these variables were not relevant (Tables 2, 3, 4).

Discussion

Gastrointestinal protozoan parasites still pose common health problems, mainly in children under five years worldwide. Rapid and accurate identification of protozoan parasites is a big challenge in many developing countries. The real-time multiplex PCR technique used herein, which provides concurrent detection of all protozoal parasites, is an exceedingly powerful laboratory system, enabling rapid, sensitive, precise, and inexpensive parasite detection.

The present study aimed to determine the prevalence of certain protozoan parasites linked with acute gastroenteritis in stool samples from children under five years old using a multiplex real-time PCR assay developed in a previous study.11

The most significant samples were from the age group ≤2 years, followed by >2–≤4 years and >4–˂5 years. The result of our study indicates the highest Prevalence of protozoal diarrhea was detected in the age group of ≤2 years followed by >2–≤4 years and no protozoan pathogen was found in the age group of >4–˂5 years; however, these results could be explained by the fact that most of our samples were collected from the age group ≤2 years in which the decline of the maternal immunity with an age risk factor of diarrhea infection.12,13 The highest positivity was detected in the samples of boys less than two years old. The reason that the number of children with diarrhea (boys of ≤2 years) admitted to hospitals is not apparent, and more research is needed to determine whether this is the pattern of childhood diarrhea in Sudan. The contaminated hands and bad hygiene may contribute to the transmission of food-borne infection in these children, which was in agreement with the investigation in Nepal, where the highest Prevalence of parasitic diarrhea was found in the age group of fewer than two years.14 However,our result differed from another study by Saeed et al. in Khartoum15 in which the major group of infections was >4–˂5 years old, and this may again be due to statistical bias since most of the samples were collected from the age group of ≤2 years; This should be investigated in future studies by using larger sample size in different season.

The result revealed a higher prevalence (35.5%) of protozoan capable of causing diarrhea in children compared with other studies conducted in Khartoum state (16%).15 and other developing countries, including Nepal and Ethiopia (0.7% and 15.6%, respectively).14,16 In comparison, the incidence was lower than that in Tanzania and South Africa (55.6% and 68%, respectively)17,18 and close to that reported in the Gaza Strip (39%).19 Our study is the first to demonstrate a high Prevalence of Cryptosporidium parvum (15.8%) in Sudan. The diagnosis of Cryptosporidium used to depend on the Ziehl−Neelsen stain, and it was neglected mainly by our laboratories until we used a sensitive molecular assay that increased the detection rate of these agents.

The most prevalent protozoan detected in the present investigation was Giardia spp., with a prevalence of 18.8%, higher than in the study conducted in Khartoum State (15.8%).15 Its Prevalence was followed by C. parvum (15.8%) and E. histolytica (0.9%). This result was consistent with previous findings in developing countries, including India, Gaza, and Nigeria.12,19,20 The sex distribution among the Giardia spp.-positive samples was 14.2% in males and 4.6% in females (P<0.01), indicating a statistically significant difference among the sex group that supports the statement of Khwam H.12,21 Single protozoan infections was found in 139 cases (89.7%) cases; co-infection was found in 16 cases (10.3%). The study of co-infection on clinical severity was not studied in these patients. However, it has been reported that no significant variation was reported in the clinical symptoms of patients with co-infections compared with those with single infections.22 Our study showed that the incidence of a protozoan parasite is higher in autumn (wet) than in summer (dry), under the study conducted in Khartoum state.15 It should be noted in the present study that no protozoan pathogen was detected in stool samples, which were likely due to infections with other pathogens like viruses and bacteria and also may be due to noninfectious reasons like hypersensitivity to certain food ingredients and weaning diarrhea that result from the inability of an underdeveloped child intestine to metabolize the food. Poor hygiene and sanitation and lack of proper toilets may facilitate these infections.15

Conclusion

The current investigation provided information about the commonly known protozoan pathogens that cause diarrhea in children in of Khartoum state, Sudan.

These findings are valuable in developing measures to improve the health condition of the young. Furthermore, this study calls for establishing sensitive and specific molecular methods, such as multiplex PCR, for detecting the protozoan pathogen in a clinical setting, which is essential.

Authors contributions

Mosab, Isam, and Xuejun designed the experiment; Mosab and Hong performed the lab experiment; Azza analyzed the data; Mosab, Khalid, and Abdel collected the samples; and Mosab Hong and Abdel wrote the article.

Comments on this article Comments (0)

Version 4
VERSION 4 PUBLISHED 29 Nov 2022
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Adam M, Shen H, Enan KA et al. Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.12688/f1000research.123652.4)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 4
VERSION 4
PUBLISHED 23 Oct 2024
Revised
Views
6
Cite
Reviewer Report 04 Nov 2024
Lawrence R. Schiller, Baylor Scott & White Health, Dallas, Texas, USA 
Approved
VIEWS 6
This observational study has limited generalizability ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
R. Schiller L. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.173182.r334246)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 3
VERSION 3
PUBLISHED 14 Jun 2024
Revised
Views
13
Cite
Reviewer Report 09 Sep 2024
Francisco Ponce-Gordo, Complutense University of Madrid, Madrid, Spain 
Not Approved
VIEWS 13
The authors have improved the article, however there are some points that should be corrected. The new consideration as "not approved" is based on the errors in the calculation of the percentage values for statistical analyses.
1. Presentation. There ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Ponce-Gordo F. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.167575.r291316)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 23 Oct 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    23 Oct 2024
    Author Response
    We appreciate the insightful feedback provided, which has significantly enhanced the quality of our manuscript. In this revised version, we have incorporated your comments and suggestions. The key modifications include:
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 23 Oct 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    23 Oct 2024
    Author Response
    We appreciate the insightful feedback provided, which has significantly enhanced the quality of our manuscript. In this revised version, we have incorporated your comments and suggestions. The key modifications include:
    ... Continue reading
Views
9
Cite
Reviewer Report 14 Aug 2024
Monira Sarmin, International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh 
Approved
VIEWS 9
The authors did the necessary revision. This version is ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Sarmin M. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.167575.r291313)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
6
Cite
Reviewer Report 02 Jul 2024
Lawrence R. Schiller, Baylor Scott & White Health, Dallas, Texas, USA 
Not Approved
VIEWS 6
This paper reviews data collected 10 years ago. The patient sample was a convenience sample--patients admitted to hospital with acute diarrhea. This sample may not reflect prevalence of protozoal diarrhea in the larger population in Sudan. It only reflects the ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
R. Schiller L. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.167575.r291317)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 2
VERSION 2
PUBLISHED 28 Feb 2024
Revised
Views
32
Cite
Reviewer Report 06 Jun 2024
Sonia Boughattas, Qatar University, Doha, Doha, Qatar 
Approved with Reservations
VIEWS 32
This work is of interest in the field with clear workflow and understandable impact.
However, several points need to be taken in consideration
-Language editing is required especially for the abstract and introduction parts
-G. lamblia name ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Boughattas S. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.161677.r271108)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 20 Jun 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    20 Jun 2024
    Author Response
    Thanks for the valuable comments. That will surely increase the quality of our manuscript, so for now, I have submitted version 3, which is being processed with a typesetter and ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 20 Jun 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    20 Jun 2024
    Author Response
    Thanks for the valuable comments. That will surely increase the quality of our manuscript, so for now, I have submitted version 3, which is being processed with a typesetter and ... Continue reading
Views
12
Cite
Reviewer Report 10 May 2024
Lawrence R. Schiller, Baylor Scott & White Health, Dallas, Texas, USA 
Not Approved
VIEWS 12
This paper reviews data collected 10 years ago. The patient sample was a convenience sample--patients admitted to hospital with acute diarrhea. This sample may not reflect prevalence of protozoal diarrhea in the larger population in Sudan. It only reflects the ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
R. Schiller L. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.161677.r271112)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
12
Cite
Reviewer Report 07 May 2024
Monira Sarmin, International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh 
Approved with Reservations
VIEWS 12
The manuscript needs a few corrections.

The following things should be addressed before finalization.
1.Abstract: Results section needs revision:       
1st line- 437 acute children were included, what does acute children mean?

2.The ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Sarmin M. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.161677.r251189)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 14 Jun 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    14 Jun 2024
    Author Response
    I appreciate your efforts and comments that sure will increase the quality of my manuscript 
    we corrected the points you mentioned in your review
    - we change gender to sex ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 14 Jun 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    14 Jun 2024
    Author Response
    I appreciate your efforts and comments that sure will increase the quality of my manuscript 
    we corrected the points you mentioned in your review
    - we change gender to sex ... Continue reading
Views
25
Cite
Reviewer Report 10 Apr 2024
Francisco Ponce-Gordo, Complutense University of Madrid, Madrid, Spain 
Approved with Reservations
VIEWS 25
General comments
Please correct the names of parasite species throughout the text. For the amoeba, it should be Entamoeba (not Entameobia). While the name Giardia lamblia is commonly used in medical literature, it is a synonym of either Giardia ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Ponce-Gordo F. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.161677.r255630)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 20 Jun 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    20 Jun 2024
    Author Response
    Thanks for the valuable comment, which raised the quality of the article. I revised your comment throughout the article as follows. 
    We made revisions throughout the text with a valuable ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 20 Jun 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    20 Jun 2024
    Author Response
    Thanks for the valuable comment, which raised the quality of the article. I revised your comment throughout the article as follows. 
    We made revisions throughout the text with a valuable ... Continue reading
Version 1
VERSION 1
PUBLISHED 29 Nov 2022
Views
31
Cite
Reviewer Report 01 Aug 2023
Jean Bernard Lekana-Douki, University of Health Sciences, Owendo, Gabon;  Université Des Sciences de La Santé, Libreville, Gabon 
Approved with Reservations
VIEWS 31
The article titled ‘Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan” by Mosab Adam et al. described the identification of three main intestinal protozoan parasite (Cyptosprodium parvum, Giardia lamblia and Entamoeba histolytica) in Sudan. While ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Lekana-Douki JB. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.135782.r179577)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 22 Mar 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    22 Mar 2024
    Author Response
    Thanks for these informative comments. I found it precise and increased the quality of our manuscript. 
    We took all reviewer comments, made corrections throughout the paper, and updated this version.
    ... Continue reading
  • Author Response 20 Jun 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    20 Jun 2024
    Author Response
    Thanks for your valuable comments 
    I corrected that point you mentioned as I changed gender to sex, then rewrote the sentence  in a clear way and corrected the sentence in ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 22 Mar 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    22 Mar 2024
    Author Response
    Thanks for these informative comments. I found it precise and increased the quality of our manuscript. 
    We took all reviewer comments, made corrections throughout the paper, and updated this version.
    ... Continue reading
  • Author Response 20 Jun 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    20 Jun 2024
    Author Response
    Thanks for your valuable comments 
    I corrected that point you mentioned as I changed gender to sex, then rewrote the sentence  in a clear way and corrected the sentence in ... Continue reading
Views
40
Cite
Reviewer Report 26 Jul 2023
Monira Sarmin, International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh 
Approved with Reservations
VIEWS 40
This is an important study,

Write up needs a lot of improvement. Introduction is well written. However other sections need care especially the discussion, results were repeated many a times.

I am adding my ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Sarmin M. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.135782.r179572)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 22 Mar 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    22 Mar 2024
    Author Response
    Thanks for these informative comments ts really raise up our manuscript 
    We took all reviewer comments, made corrections throughout the paper, and updated this version.
    1. rewrote the abstract section ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 22 Mar 2024
    Mosab Adam, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
    22 Mar 2024
    Author Response
    Thanks for these informative comments ts really raise up our manuscript 
    We took all reviewer comments, made corrections throughout the paper, and updated this version.
    1. rewrote the abstract section ... Continue reading
Views
34
Cite
Reviewer Report 15 Feb 2023
Luther A Bartelt, Division of Infectious Diseases, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA 
Renay Ngobeni, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA 
Not Approved
VIEWS 34
The investigators report on the findings of 3 protozoans in children under 5 that were hospitalized for acute diarrhea. It is always helpful to have surveillance data for difficult to detect pathogens using molecular methods from a wide range of ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Bartelt LA and Ngobeni R. Reviewer Report For: Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan [version 4; peer review: 2 approved, 2 approved with reservations, 2 not approved]. F1000Research 2024, 11:1401 (https://doi.org/10.5256/f1000research.135782.r160656)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 4
VERSION 4 PUBLISHED 29 Nov 2022
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.