Circadian clock control of tRNA synthetases in <i>Neurospora crassa</i>

Kathrina D. Castillo; Emily D. Chapa; Deborah Bell-Pedersen

doi:10.12688/f1000research.125351.1

Home Browse Circadian clock control of tRNA synthetases in Neurospora crassa

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Circadian clock control of tRNA synthetases in Neurospora crassa

[version 1; peer review: 2 approved with reservations]

Kathrina D. Castillo^1,2, Emily D. Chapa¹, Deborah Bell-Pedersen ^1,2

PUBLISHED 22 Dec 2022

Author details Author details

¹ Biology, Texas A&M University, College Station, TX, 77843, USA
² Center for Biological Clocks Research, Texas A&M University, College Station, TX, 77843, USA

Kathrina D. Castillo
Roles: Formal Analysis, Investigation, Validation, Writing – Original Draft Preparation, Writing – Review & Editing

Emily D. Chapa
Roles: Formal Analysis, Investigation, Validation, Visualization

Deborah Bell-Pedersen
Roles: Conceptualization, Funding Acquisition, Writing – Original Draft Preparation, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Cell & Molecular Biology gateway.

This article is included in the Circadian Clocks in Health and Disease collection.

Abstract

Background: In Neurospora crassa, the circadian clock controls rhythmic mRNA translation initiation through regulation of the eIF2α kinase CPC-3 (the homolog of yeast and mammalian GCN2). Active CPC-3 phosphorylates and inactivates eIF2α, leading to higher phosphorylated eIF2α (P-eIF2α) levels and reduced translation initiation during the subjective day. This daytime activation of CPC-3 is driven by its binding to uncharged tRNA, and uncharged tRNA levels peak during the day under control of the circadian clock. The daily rhythm in uncharged tRNA levels could arise from rhythmic amino acid levels or aminoacyl-tRNA synthetase (aaRSs) levels.
Methods: To determine if and how the clock potentially controls rhythms in aspartyl-tRNA synthetase (AspRS) and glutaminyl-tRNA synthetase (GlnRS), both observed to be rhythmic in circadian genomic datasets, transcriptional and translational fusions to luciferase were generated. These luciferase reporter fusions were examined in wild type (WT), clock mutant Δfrq, and clock-controlled transcription factor deletion strains.
Results: Translational and transcriptional fusions of AspRS and GlnRS to luciferase confirmed that their protein levels are clock-controlled with peak levels at night. Moreover, clock-controlled transcription factors NCU00275 and ADV-1 drive robust rhythmic protein expression of AspRS and GlnRS, respectively.
Conclusions: These data support a model whereby coordinate clock control of select aaRSs drives rhythms in uncharged tRNAs, leading to rhythmic CPC-3 activation, and rhythms in translation of specific mRNAs.

Keywords

Circadian clock, Neurospora cras, tRNA synthetases, translation control

Corresponding author: Deborah Bell-Pedersen

Competing interests: No competing interests were disclosed.

Grant information: This work was supported by the National Institute of General Medical Sciences (NIH/GM) R35 GM126966 to DBP, and the Arnold and Mabel Beckman Foundation Beckman Scholars Program to EDC.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2022 Castillo KD et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Castillo KD, Chapa ED and Bell-Pedersen D. Circadian clock control of tRNA synthetases in Neurospora crassa [version 1; peer review: 2 approved with reservations]. F1000Research 2022, 11:1556 (https://doi.org/10.12688/f1000research.125351.1) First published: 22 Dec 2022, 11:1556 (https://doi.org/10.12688/f1000research.125351.1) Latest published: 17 Aug 2023, 11:1556 (https://doi.org/10.12688/f1000research.125351.2)

Introduction

Aminoacyl-tRNA synthetases (aaRSs) play a fundamental role in mRNA translation by catalyzing the attachment of specific amino acids onto their cognate tRNAs. For accuracy, aaRSs employ chemical selectivity and proofreading capabilities (Rubio Gomez and Ibba, 2020, Roux and Topisirovic, 2012). Mounting evidence supports that aaRSs have functions beyond their role in charging tRNAs, including roles in immune signaling, cell cycle, nutrient metabolism and growth, and thus are linked to various human diseases (Pang et al., 2014, Nie et al., 2019, Park et al., 2008). Aminoacylation mechanisms are conserved across all kingdoms of life. While the regulation of aaRS expression in prokaryotes is well-described, less is known about their regulation in eukaryotes (Frugier and Giege, 2003). Several aaRSs were reported to have daily rhythms in abundance at the mRNA and/or protein levels in the filamentous fungus Neurospora crassa (Sancar et al., 2015, Hurley et al., 2018, Castillo et al., 2022), and mammalian cells (Pembroke et al., 2015, Barclay et al., 2012, Hughes et al., 2009, Miller et al., 2007, Vollmers et al., 2012, Eckel-Mahan and Sassone-Corsi, 2009, Geyfman et al., 2012, Yoshitane et al., 2014, Janich et al., 2015). These data suggested that the circadian clock imparts regulation on aars gene expression, which would impact rhythmic protein synthesis and clock-controlled cellular processes.

The circadian clock is an endogenous timekeeping mechanism that regulates diverse biological processes in many organisms, allowing them to anticipate and prepare for daily environmental cycles, and to organize cellular processes to the right time of day for improved fitness (Dunlap and Loros, 2017). Disruption of the circadian clock has profound effects on human physiology and behavior, and can lead to a wide range of diseases (Bass, 2017, Foster, 2020, Hernandez-Garcia et al., 2020). Depending on the organism and tissue type, the circadian clock regulates daily rhythms in mRNA and protein accumulation for up to 50% of the eukaryotic genome (Hurley et al., 2014, 2018, Zhang et al., 2014, Mauvoisin et al., 2014). Remarkably, most of the proteins that cycle in abundance under the control of the circadian clock are produced from mRNAs that are not clock-controlled (Reddy et al., 2006, Robles et al., 2014, Zhang et al., 2014, Hurley et al., 2018, Castillo et al., 2022). These data suggested a prominent role for clock regulation of post-transcriptional processes, including rhythmic mRNA translation.

The N. crassa circadian clock is composed of negative elements FREQUENCY (FRQ), FRQ-INTERACTING RNA HELICASE (FRH), and CASEIN KINASE 1 (CK1), and positive elements WHITE COLLAR-1 (WC-1) and WHITE COLLAR-2 (WC-2) (Baker et al., 2012, Dunlap and Loros, 2017). WC-1 and WC-2 heterodimerize to form the White Collar Complex (WCC) which binds to the promoters of frq and downstream clock-controlled genes (ccgs), including 24 transcription factors, to drive their rhythmic transcription (Froehlich et al., 2003, Smith et al., 2010). In addition, the N. crassa clock generates rhythms in the activities of the conserved eukaryotic translation initiation factor 2 (eIF2) and eukaryotic translation elongation factor 2 (e-EF2) (Caster et al., 2016, Karki et al., 2020, Ding et al., 2021). A central mechanism for translational control is the phosphorylation of eIF2α, as even partial phosphorylation is sufficient to inhibit protein synthesis (Baird and Wek, 2012). Furthermore, rhythms in activity of the N. crassa eIF2α kinase CPC-3, a homolog of the well-studied yeast and mammalian eIF2α kinase GCN2, are dependent on rhythmic uncharged tRNA^Val_, levels. The rhythm in uncharged tRNA^Val_, levels is driven, at least in part, by rhythms in valyl-tRNA synthetase (ValRS) levels (Karki et al., 2020). However, in addition to ValRS, several other aaRSs were found to be clock-controlled from genomic datasets (Sancar et al., 2015, Hurley et al., 2018, Castillo et al., 2022), suggesting that aaRSs may be coordinately regulated by the clock to control rhythmic translation.

In this study, we sought to independently validate clock control of two aaRSs and to determine the mechanisms of clock control of aaRS genes. Using aspartyl-tRNA synthetase (AspRS) and glutaminyl-tRNA synthetase (GlnRS) luciferase translational reporters, we confirmed that AspRS and GlnRS protein levels are rhythmic in WT cells with a peak in the subjective night, similar to the peak time of ValRS (Karki et al., 2020), and arrhythmic in clock mutant Δfrq cells. Furthermore, we identified clock-controlled transcription factors that bind to promoters of AspRS and GlnRS to mediate their rhythmic transcription. We found that AspRS::LUC and GlnRS::LUC are arrhythmic in the transcription factor knockouts, Δncu00275 and Δadv-1, respectively, supporting that the clock controls rhythms in AspRS and GlnRS through these transcription factors. Overall, these findings provide a basis for further studies investigating coordinate clock control of aaRSs and their roles in rhythmic mRNA translation.

Methods

N. crassa strains and growth conditions

Strains, key reagents, and oligonucleotide primers used in this study are listed in Table 1. N. crassa wild type 74-OR23-IV (FGSC 4200) was grown in Vogel’s minimal media with 2% glucose (V2G) (Davis and De Serres, 1970). All strains containing the hygromycin phosphotransferase (hph) construct conferring resistance to hygromycin B were maintained on V2G and supplemented with 200 μg/mL of hygromycin B (VWR). Strains containing the bar cassette conferring resistance to Basta were maintained on V2G lacking NH₄NO₃ and supplemented with 0.5% proline (Sigma-Aldrich) and 200 μg/mL of Basta (Liberty^TM, Bayer).

Table 1. Key resources table.

Reagent or resource	Source	Identifier
Plasmids
Plasmid pRMP57	Gooch et al., 2008	GenBank KC890770.1
Plasmid pBP15	Beasley et al., 2006	N/A
Chemicals, peptides, and recombinant proteins
Basta (Liberty^TM)	Bayer	Cat#280SL
Hygromycin	VWR	Cat#80055-268
Luciferin	Gold Biotechnology	Cat#LUNCA-300
Strains
Neurospora crassa wild type 74-OR23-IV mat a	FGSC	FGSC 4200; DBP 985
Δfrq::bar, mat A	Bennett et al., 2013	DBP 1228
Δncu00275::hph, mat a	FGSC	DBP 927
Δadv-1::hph, mat A	FGSC	DBP 917
Δclr-1::hph, mat a	FGSC	DBP 981
Δsah-1::hph, mat a	FGSC	DBP 990
Δvos-1::hph, mat a	FGSC	DBP 1970
WT, AspRS::LUC translational fusion	This paper	DBP 3999
WT, GlnRS::LUC translational fusion	This paper	DBP 3991
WT, GlnRS::LUC translational fusion	This paper	DBP 3992
Δfrq::bar, AspRS::LUC translational fusion	This paper	DBP 4000
Δfrq::bar, GlnRS::LUC translational fusion	This paper	DBP 3989
Δncu00275:hph, AspRS::LUC translational fusion	This paper	DBP 4142
Δclr-1::hph, AspRS::LUC translational fusion	This paper	DBP 4137
Δncu00275::hph, GlnRS::LUC translational fusion	This paper	DBP 4211
Δadv-1::hph, GlnRS::LUC translational fusion	This paper	DBP 4208
WT, Pasprs::luc transcriptional fusion	This paper	DBP 4280
WT, Pglnrs::luc transcriptional fusion	This paper	DBP 4283
Oligonucleotides
To generate AspRS::LUC asprsF1 5′ CAAAGCAACATGGCCGACAG 3′	This paper	N/A
To generate AspRS::LUC asprsR1 5′ TGGCGTCCTCAGGAAGCAACCTCTTGGGCG 3′	This paper	N/A
To generate AspRS::LUC asprsF25′ GTTGCTTCCTGAGGACGCCAAGAACATCAA 3′	This paper	N/A
To generate AspRS::LUC asprsR2 5′ ATGAAGTCACTTAATCAGACGGCGATCTTG 3′	This paper	N/A
To generate AspRS::LUC asprsF3 5′ GTCTGATTAAGTGACTTCATTGTCGGTGGG 3′	This paper	N/A
To generate AspRS::LUC asprsR3 5′ GATAACTGAAGGCTCGAAAT 3′	This paper	N/A
Validation of endogenous integration of AspRS::LUC asprsF4 5′ GCGATGGCATGCTGCCGACG 3′	This paper	N/A
Validation of endogenous integration of AspRS::LUC asprsR4 5′ GTCAGCTTGCTTCCCATAAG 3′	This paper	N/A
To generate GlnRS::LUC glnrsF1 5′ CAACTGCTACCTCCGATTCG 3′	This paper	N/A
To generate GlnRS::LUC glnrsR1 5′ TGGCGTCCTCGTTCTTCTCCTTATCCTCCT 3′	This paper	N/A
To generate GlnRS::LUC glnrsF2 5′ GGAGAAGAACGAGGACGCCAAGAACATCAA 3′	This paper	N/A
To generate GlnRS::LUC glnrsR2 5′ GGACAACTGCTTAATCAGACGGCGATCTTG 3′	This paper	N/A
To generate GlnRS::LUC glnrsF3 5′ GTCTGATTAAGCAGTTGTCCGCGAATTAAC 3′	This paper	N/A
To generate GlnRS::LUC glnrsR3 5′ TAGAGGTAGTACTGCCAGCG 3′	This paper	N/A
Validation of endogenous integration of GlnRS::LUC glnrsF4 5′ TGAAGTTTGGTGATGTCTCC 3′	This paper	N/A
Validation of endogenous integration of GlnRS::LUC glnrsR4 5′ TCCGAATAGTACTTCTGTGG 3′	This paper	N/A
To generate Pasprs::luc asprsF5 5′ ATCGGCGGCCGCACGGATTATACGATGCCCGC 3′	This paper	N/A
To generate Pasprs::luc asprsR5 5′ CGATACTAGTGTTGCTTTGTCGAATTCGAT 3′	This paper	N/A
To generate Pglnrs::luc glnrsF5 5′ ATCGGCGGCCGCGTATTGAAAATAGGTGGGGA 3′	This paper	N/A
To generate Pglnrs::luc glnrsR5 5′ CGATACTAGTGATGTGTCTGTGTGTGTGGT 3′	This paper	N/A
Software and algorithms
BioDare2 (beta version 2)	Zielinski et al., 2014	https://biodare2.ed.ac.uk/
Cosine Wave Analysis	Lamb et al., 2011	PRISM software package (GraphPad Software)
ECHO	De Los Santos et al., 2020	https://github.com/delosh653/ECHO
ggplot2 R package	Wickham, 2016	https://ggplot2.tidyverse.org
GraphPad Prism version 9.4.0		https://www.graphpad.com/
Serial Cloner version 2.6.1		http://serialbasics.free.fr/Serial_Cloner.html
Other
EnVision Xcite Multilabel Reader	PerkinElmer	Cat#2105-0010
NanoDrop^TM Microvolume Spectrophotometer	Thermo Scientific	Cat#ND-ONE-W

To assay rhythmic translation of aspartyl tRNA synthetase (AspRS) and glutaminyl tRNA synthetase (GlnRS), an aaRS::LUC translational fusion to luciferase was generated by 3-way fusion polymerase chain reaction (PCR). Primers RSF1 and RSR1 were used to make fragment 1, and primers RSF3 and RSR3 were used to make fragment 3, both using wild type (WT) genomic DNA as template. Primers RSF2 and RSR2 were used to make fragment 2 using pRMP57, a plasmid containing the N. crassa codon-optimized luciferase gene as template DNA (Gooch et al., 2008). The three PCR fragments with overlapping regions were stitched via fusion PCR using primers RSF1 and RSR3, and the resulting PCR product was co-transformed with the plasmid pBP15 containing hph (Beasley, 2006) into WT (FGSC2489). Primers were designed using Serial Cloner version 2.6.1 and the sequences are given in Table 1. Lyophilized PCR oligonucleotide primers were obtained from Integrated DNA Technologies (IDT) and resuspended in 1x Tris-EDTA, pH 8.0 buffer to make 100 μM primer stocks. The PCR reaction mix was as follows: total reaction mix = 50 μl, water = 37.5 μl, 5X High Fidelity (HF) buffer = 5 μl, dNTP mix = 1 μl (10 mM), primers = 2.5 μl each (10 μM), Phusion^® DNA polymerase = 0.5 μl (1.0 units/50 μl PCR), and template DNA = 1 μl (50 ng). Phusion^® High Fidelity DNA polymerase kit (Cat. No. M0530) and dNTP mix (Cat. No. 4030) were purchased from New England Biolabs (NEB) and Takara, respectively. The following annealing temperatures and extension times were applied: AspRS fragment 1 = 65°C, 1:30 min, fragment 2 = 72^oC, 1:30 min, fragment 3 = 59°C, 1:30 min, and fragments 1+2+3 = 59°C, 3 min; GlnRS fragment 1 = 63°C, 1:30 min, fragment 2 = 72°C, 1:30 min, fragment 3 = 64^oC, 30 s, and fragments 1+2+3 = 63°C, 3 min. PCR cycling was performed with a C1000 Touch Thermal Cycler (Bio-Rad) using the following program: 30 cycles of denaturation at 98°C for 10 s, annealing at varying temperatures for 30 s (as described above) and extension at 72°C for varying times (as described above).

Hygromycin-resistant transformants were screened for luciferase activity and homologous insertion into the aars gene (primers RSF4 and RSR4) using the same PCR conditions described above with annealing temperatures and extension times for AspRS = 62°C, 4 min, and GlnRS = 59°C, 4 min. To generate aaRS::LUC in different mutant strains, aaRS::LUC, WT were crossed with the knockouts on synthetic cross medium supplemented with 0.25% biotin (Westergaard, 1947, Davis, 1970). AspRS::LUC transformants were crossed with Δfrq::bar (DBP1228) to generate AspRS::LUC, WT (DBP3999), AspRS::LUC, Δfrq::bar (DBP4000). GlnRS::LUC transformants were crossed with Δfrq::bar (DBP1228) (Bennett et al., 2013) to generate GlnRS::LUC, WT (DBP3991 mat A and DBP3992 mat a), GlnRS::LUC, Δfrq::bar (DBP3989). DBP3999 was crossed with Δclr-1::hph (DBP981) and Δncu00275 (DBP927) to generate AspRS::LUC, Δclr-1::hph (DBP4137) and AspRS::LUC, Δncu00275::hph (DBP4142), respectively. DBP 3992 was crossed with Δadv-1::hph (DBP917) to generate GlnRS::LUC, Δadv-1::hph (DBP 4137). DBP 3991 was crossed with Δncu00275::hph (DBP927) to generate GlnRS::LUC, Δncu00275::hph (DBP 4211).

To generate transcriptional fusions to luc, promoter regions of asprs (primers asprsF5 and asprsR5 to generate the 1.8 kb fragment Pasprs), and glnrs (primers glnrsF5 and glnrsR5 to generate the 1.82 kb fragment Pglnrs) were amplified by PCR using the cycling conditions described above with annealing temperatures and extension times for fragments Pasprs and Pglnrs = 68^oC, 1:30 min. PCR products were digested with NotI and SpeI (NEB), and cloned into plasmid pRMP57 containing the codon-optimized luciferase gene. The resulting plasmids were linearized by PciI (NEB) digest, co-transformed with hyg^R pBP15 into WT (FGSC 4200) cells, and hygromycin-resistant transformants were screened for luciferase activity.

Luciferase assays

To examine bioluminescence rhythms arising from strains containing luciferase fusions, 1×10⁵ conidia were inoculated into 96 well microtiter plates containing 150 μl of 1X Vogel’s salts, 0.01% glucose, 0.03% arginine, 0.1 M quinic acid, 1.5% agar, and 25 μM firefly luciferin, pH 6. After inoculation of conidia (1×10⁵ conidia), the microtiter plate was incubated at 30°C in LL for 24 h and transferred to DD 25°C to obtain bioluminescence recordings using EnVision Xcite Multilabel Reader, with recordings taken every 90 min over 4–5 days. Raw reads were normalized to the mean to graph the data.

Statistical test for rhythmicity and analysis of circadian parameters

Rhythmic data from luciferase assays were fit to a sine wave or a line as previously described (Lamb et al., 2011). Nonlinear regression to fit the rhythmic data to a sine wave (fitting period, phase, and amplitude) and a line (fitting slope and intercept), as well as Akaike’s information criteria tests to compare the fit of each data set to the 2 equations, were carried out using the Prism software package version 9.4.0. The p-values reflect the probability that, for instance, the sine wave fits the data better than a straight line. Error bars in all graphs represent the standard error of the mean (SEM) from independent experiments. Raw and normalized luciferase activity reads were analyzed for period, phase, and amplitude values using BioDare version 2 (Zielinski et al., 2014). Heat maps were generated using the ggplot2 R package for genes with rhythmic RPF counts in WT, and sorted according to increasing peak phase of the oscillation (Wickham, 2016). RPF levels are standardized within each gene (row) (Z-scores).

Results

AspRS and GlnRS protein levels are clock-controlled

N. crassa circadian ribosome profiling (ribo-seq) data revealed rhythms in ribosome occupancy for 17 of 36 aaRS using the Extended Circadian Harmonic Oscillator (ECHO) rhythmicity detection tool (De Los Santos et al., 2020, Castillo et al., 2022). Genes with an adjusted p-value of < 0.05, and with circadian harmonic, damped, or forced oscillation types were considered rhythmic. A heat map of the phase-sorted fitted ribosome protected footprint (RPF) values obtained using ECHO showed robust rhythmic ribosome occupancy for 17 aaRSs in WT cells, with peak ribosome occupancy primarily during the late subjective day (DD40-44). As expected for circadian clock control, the rhythms were abolished in the clock mutant Δfrq cells (Figure 1A). Circadian rhythms in ValRS protein levels were previously validated using a luciferase (LUC) translational reporter. ValRS::LUC levels peaked in the subjective night (Karki et al., 2020), lagging the observed peak in ribosome occupancy (Figure 1A).

Figure 1. The circadian clock controls amino acid tRNA synthetase (aaRS) translational rhythms.

A) Heat maps of the peak phase of aaRS mRNAs with rhythmic ribosome footprint reads (RFP) counts in WT, and arrhythmic RFP counts in Δfrq cells (N = 17) from samples grown in DD and harvested at the indicated times (Hrs). Genes are sorted by the peak phase in WT. Cyt (cytoplasmic), mt (mitochondrial) B-C. Plots show the normalized fitted RFP reads in WT (black line, ECHO p-value ≤ 0.05) and Δfrq (gray line, ECHO p-value > 0.05 for aspartyl tRNA synthetase (AspRS) and p-value = 0.04 for glutaminyl tRNA synthetase (GlnRS), but with a short 16 h period) cells for B) AspRS and C) GlnRS. Luciferase (LUC) activity from D) AspRS::LUC and E) GlnRS::LUC translational fusions in WT (black line) and Δfrq (gray line) cells. The average bioluminescence signal is plotted (AspRS::LUC, mean ± SEM, n=12 and GlnRS::LUC, mean ± SEM, n=24). Raw reads were normalized to the mean to plot the data. AspRS::LUC and GlnRS::LUC in WT cells were rhythmic as indicated by a better fit to a sine wave (dotted black line, p-value < 0.001). AspRS::LUC and GlnRS::LUC in Δfrq were arrhythmic as indicated by a better fit of the data to a line (dotted gray line p-value > 0.05). The bar at the bottom of the heat maps and graphs represents subjective day (gray) and subjective night (black) in this and all subsequent figures. Data from Bell-Pedersen (2022).

In higher eukaryotes, 9 aaRSs form a multisynthetase complex (MSC) that is proposed to aid translation by providing a channel through which tRNAs can pass to reach bound aaRSs (Hyeon et al., 2019). Interestingly, 5 of the 9 aaRSs in the complex (AspRS, GlnRS, GluRS, LeuRS, and MetRS) are clock-controlled based on our ribosome profiling datasets (Figure 1A), and we focused on validating circadian clock control of AspRS and GlnRS (Figure 1B & C). AspRS and GlnRS luciferase translational reporter fusions were generated (AspRS::LUC and GlnRS::LUC) and assayed for rhythmic luciferase levels from cells grown in constant darkness (DD) over 4 days. Bioluminescence rhythms were observed for both AspRS::LUC and GlnRS::LUC, with peak levels during the early subjective night (e.g. DD 48) and a period of 22.6 ± 0.5 h and 23.5 ± 0.6 h, respectively. Similar to ValRS::LUC, the peak in AspRS::LUC and GlnRS::LUC levels occurred a few hours after the peak in ribosome occupancy (Figure 1B-E). The AspRS::LUC and GlnRS::LUC rhythms were abolished in Δfrq cells, supporting that AspRS and GlnRS protein levels are clock-controlled (Figures 1D & E, Table 2).

Table 2. Calculated periods and phases for AspRS::LUC, GlnRS::LUC (data from Figure 1), Pasprs::luc and Pglnrs::luc in WT cells (data from Figure 2) and AspRS::LUC or GlnRS::LUC in transcription factor knockout cells (data from Figure 3).

Strain	Period	Phase
AspRS::LUC, WT	22.9±0.7	4.4±2.9
AspRS::LUC, Δclr-1	22.7±0.7	4.9±2.6
AspRS::LUC, Δncu00275	arrhythmic	arrhythmic
Pasprs::luc, WT	22.2±0.6	3.4±1.7
GlnRS::LUC, WT	22.2±0.3	4.3±1.4
GlnRS::LUC, Δncu00275	23.4±0.6	4.8±2.2
GlnRS::LUC, Δadv-1	arrhythmic	arrhythmic
Pglnrs::luc, WT	22.0±0.5	3.8±1.7

Clock-controlled transcription factors drive rhythms in AspRS and GlnRS expression

In addition to rhythms in protein levels, several N. crassa aaRS mRNAs were reported in genome-wide studies to be clock-controlled (Hurley et al., 2014, 2018, Sancar et al., 2015, Castillo et al., 2022). Of these aaRSs, asprs and glnrs exhibited rhythms in mRNA levels in WT cells, with mRNA levels peaking in the subjective early evening (DD40-44) (Figure 2A & B). In support of these genomic data, asprs (Pasprs::luc) and glnrs (Pglnrs::luc) promoter luc fusions were rhythmic in DD peaking during the subjective night (Figure 2C & D), with no significant period and phase differences between the mRNA and protein levels (Table 2).

Figure 2. asprs and glnrs mRNA are clock-controlled.

A-B. Plots show the mRNA fragments per kilobase of exon per million mapped fragments (FPKM) levels in WT (black line, ECHO p-value < 0.05) and Δfrq (gray line, ECHO p-value > 0.05) cells for A) asprs and B) glnrs. C-D. Plots show the luciferase activity from C) Pasprs::luc transcriptional (black line) and D) Pglnrs::luc transcriptional (black line) fusions in WT cells grown in DD and recorded every 90 min over 4 d (Hrs DD). The average bioluminescence signal is plotted (mean ± SEM, n=12). Luciferase activities are rhythmic as indicated by a better fit to a sine wave (dotted black line, p-value < 0.0001). Data from Bell-Pedersen (2022).

Although the levels fluctuated over time, the rhythms were abolished in Δfrq cells as shown by the ECHO-generated fitted values for normalized mRNA levels by FPKM (fragments per kilobase of exon per million mapped reads) (Figure 2A & B) (Castillo et al., 2022). Together, these data support that rhythmic AspRS and GlnRS protein levels arise, at least in part, from cycling mRNA levels.

To determine if clock-controlled rhythms in AspRS and GlnRS protein levels require clock-controlled transcription factors and rhythmic transcription, we examined AspRS::LUC and GlnRS::LUC rhythms in cells deleted for transcription factors that are direct targets of the WCC, and bind to downstream ccgs to regulate their rhythmic expression (Smith et al., 2010, Dekhang et al., 2017, Munoz-Guzman et al., 2021). We found, for example, that AspRS::LUC was rhythmic in WT and Δclr-1 (NCU07705) cells with a similar period and phase (Figure 3A, Table 2), but arrhythmic in Δncu00275 cells (Figure 3B). Also, AspRS::LUC levels were lower in Δncu00275 compared to WT cells (Figure 3C), suggesting that NCU00275 directly, or indirectly, activates asprs transcription. GlnRS::LUC was rhythmic in WT and Δncu00275 cells with no significant differences in period or phase between WT and transcription factor knockout cells (Figure 4A and Table 2). Previous ChIP-seq of the clock-controlled transcription factor ADV-1 (NCU07392) showed that ADV-1 binds to the promoter of glnrs (Dekhang et al., 2017). GlnRS::LUC levels in Δadv-1 cells became arrhythmic after 2 days in DD (Figure 4B). Examination of the raw bioluminescence signals showed that GlnRS::LUC levels were higher in Δadv-1 than in WT cells (Figure 4C), suggesting that ADV-1 negatively regulates glnrs transcription. Furthermore, the progressive dampening of GlnRS::LUC levels in Δadv-1 significantly reduced the amplitude of oscillation, leading to arrhythmicity (Figure 4D). Taken together, these data support that specific clock-controlled transcription factors contribute to circadian rhythms in the expression of aaRSs.

Figure 3. Transcription factor NCU00275 is required for robust rhythmic expression and AspRS protein levels.

Luciferase activity from AspRS::LUC translational fusions in WT (black line) and transcription factor knockouts A) Δclr-1 (blue line) and B) Δncu00275 (blue line). Raw reads were normalized to the mean to plot the data. The average bioluminescence signal is plotted (mean ± SEM, n=12). Luciferase activities are rhythmic as indicated by a better fit to a sine wave (dotted black line, p-value < 0.0001) or arrhythmic as indicated by a better fit of the data to a line (dotted blue line, p-value > 0.0001). C) Raw bioluminescence signals from AspRS::LUC translational fusions in WT (black line) and transcription factor knockout Δncu00275 (blue line).

Figure 4. Transcription factor ADV-1 is required for robust rhythmic expression of GlnRS protein levels.

Luciferase activities from GlnRS::LUC translational fusions in WT (black line) and transcription factor knockouts A) Δncu00275 (blue line) and B) Δadv-1 (blue line). The average bioluminescence signal is plotted (mean±SEM, n=12). Luciferase activities are rhythmic as indicated by a better fit to a sine wave (dotted black line, p-value<0.0001) or arrhythmic as indicated by a better fit of the data to a line (dotted blue line, p-value>0.0001). C) Raw bioluminescence signals from GlnRS::LUC translational fusions in WT (black line) and transcription factor knockout Δadv-1 (blue line). The average bioluminescence signal is plotted (mean±SEM, n=12). D) Mean amplitude (mean±SEM, n=12; **** p-value < 0.0001) of GlnRS::LUC bioluminescence traces in WT (black bar) and Δadv-1 (blue bar) cells. P-values were calculated by an unpaired t-test.

All underlying data can be found in the Underlying data section (Bell-Pedersen, 2022, Castillo & Bell-Pedersen, 2022).

Discussion

aaRSs play a central role in translation and translation fidelity, yet the regulation of aaRS gene expression in eukaryotes is understudied. Genome-wide datasets revealed that several eukaryotic aaRSs are clock-regulated at the level of mRNA and protein (Sancar et al., 2015, Hurley et al., 2018, Castillo et al., 2022, Barclay et al., 2012, Pembroke et al., 2015, Hughes et al., 2009, Miller et al., 2007, Vollmers et al., 2012, Eckel-Mahan and Sassone-Corsi, 2009, Geyfman et al., 2012, Yoshitane et al., 2014, Janich et al., 2015). We previously showed that the levels of ValRS cycle under control of the circadian clock with peak levels during the subjective night (Karki et al., 2020). Here, we validated that asprs and glnrs mRNA and protein levels are also clock-controlled with a similar night-time peak in protein levels. The bulk of rhythmic protein accumulation occurs at night in N. crassa (Hurley et al., 2018) supporting that the night-time peak in RS protein levels serve to coordinately increase protein synthesis at night.

We observed that AspRS and GlnRS protein rhythms are dependent on the circadian clock through the activities of clock-controlled transcription factors. AspRS is arrhythmic in Δncu00275. NCU00275 is annotated as a hypothetical protein, but its homologs in other fungi suggest that it belongs to a C3HC4-type RING finger proteins involved in transcription, signal transduction, ubiquitination, and recombination (Basenko et al., 2018, Krishna et al., 2003). GlnRS rhythms were less robust in Δadv-1. ADV-1 has a role in connecting the circadian clock and light signaling pathways to developmental processes (Dekhang et al., 2017). Interestingly, AspRS and GlnRS are two aaRSs that were shown in Saccharomyces cerevisiae and humans, respectively, to bind specifically to their own mRNAs, providing another potential layer of regulation to their gene expression (Frugier and Giege, 2003).

Charging tRNAs with the correct amino acid is the first step in translation, and therefore the levels and function of aaRSs are critical to translation fidelity (Yu et al., 2021, Hausmann and Ibba, 2008). Mistakes in translation are generally considered detrimental; however, during stress, mistranslation may be beneficial by increasing the levels of altered proteins that can perform new functions to aid the response (Pan, 2013, Ribas de Pouplana et al., 2014). In eukaryotes, some aaRSs form the MSC (Bandyopadhyay and Deutscher, 1971, Lee et al., 2004, Kerjan et al., 1994), with varying composition dependent on the organism. In S. cerevisiae, the MSC is comprised of MetRS, GluRS and the scaffold protein Arc1 (Galani et al., 2001). The MSC in mammals has 9 aaRSs, including 5 of the 9 aaRSs (AspRS, GlnRS, GluRS, LeuRS, and MetRS) that are rhythmic in ribo-seq data sets, and 3 scaffold proteins, AIMP1-3. The MSC helps the function of its components; for example, the K_m for binding of tRNA^Met to MetRS in the yeast MSC is about 100-fold lower compared to the K_m for binding of tRNA^Met to MetRS alone (Simos et al., 1998). MSC components are also involved in cell signaling, stress responses, metabolite sensing, and controlling gene expression by binding to specific RNA and DNA sites, supporting the idea that a key role of the MSC is to support alternative functions of aaRSs (Cui et al., 2021, Pang et al., 2014, Rubio Gomez and Ibba, 2020). Furthermore, aaRSs, either alone or in the MSC complex, participate in a wide variety of processes outside of their classical role in tRNA charging, including transcription regulation, splicing, and metabolism (Rubio Gomez and Ibba, 2020), and abnormal expression, localization, and molecular interactions of aaRSs are associated with a variety of human diseases, including cancer (Zhou et al., 2020). This widespread impact of aaRSs on host biology raises the intriguing idea that daily rhythms in the levels of aaRSs represent a missing factor linking the clock to a wide range of rhythmic biological processes that are critical to health, underscoring the need to better understand the mechanisms underlying their circadian regulation.

Data availability

Underlying data

Gene Expression Omnibus: Ribosome profiling and RNA-seq data used in Figures 1 and 2. Accession number GSE181566; https://identifiers.org/geo:GSE181566 (Bell-Pedersen, 2022).

Figshare: Circadian Clock Control of tRNA synthetases in Neurospora crassa.

https://doi.org/10.6084/m9.figshare.c.6209830.v2 (Castillo & Bell-Pedersen, 2022).

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Acknowledgements

We thank the Fungal Genetics Stock Center for providing strains.

References

Baird TD, Wek RC: Eukaryotic initiation factor 2 phosphorylation and translational control in metabolism. Adv. Nutr. 2012; 3: 307–321. PubMed Abstract | Publisher Full Text
Baker CL, Loros JJ, Dunlap JC: The circadian clock of Neurospora crassa. FEMS Microbiol. Rev. 2012; 36: 95–110. PubMed Abstract | Publisher Full Text
Bandyopadhyay AK, Deutscher MP: Complex of aminoacyl-transfer RNA synthetases. J. Mol. Biol. 1971; 60: 113–122. Publisher Full Text
Barclay JL, Husse J, Bode B, et al.: Circadian desynchrony promotes metabolic disruption in a mouse model of shiftwork. PLoS One. 2012; 7: e37150. PubMed Abstract | Publisher Full Text
Basenko EY, Pulman JA, Shanmugasundram A, et al.: FungiDB: An integrated bioinformatic resource for fungi and oomycetes. J. Fungi (Basel). 2018; 4.
Bass JT: The circadian clock system's influence in health and disease. Genome Med. 2017; 9: 94. PubMed Abstract | Publisher Full Text
Beasley AK, Lamb TM, Versaw W, et al.: A ras-1^bd Mauriceville strain for mapping mutations in Oak Ridge ras-1^bd strains. Fungal Genet. Rep. 2006; 53.
Bell-Pedersen D: Circadian Clock-Controlled Translation of Specific mRNAs in Neurospora crassa Requires Rhythmic eIF2α Activity and P-body Sequestration. Gene Expression Omnibus. [Dataset]2022. GSE181566.Reference Source
Bennett LD, Beremand P, Thomas TL, et al.: Circadian activation of the mitogen-activated protein kinase MAK-1 facilitates rhythms in clock-controlled genes in Neurospora crassa. Eukaryot. Cell. 2013; 12: 59–69. PubMed Abstract | Publisher Full Text
Caster SZ, Castillo K, Sachs MS, et al.: Circadian clock regulation of mRNA translation through eukaryotic elongation factor eEF-2. Proc. Natl. Acad. Sci. U. S. A. 2016; 113: 9605–9610. PubMed Abstract | Publisher Full Text
Castillo K, Bell-Pedersen D:Circadian Clock Control of tRNA synthetases in Neurospora crassa. figshare. Collection. [Dataset].2022. Publisher Full Text
Castillo KD, Wu C, Ding Z, et al.: Circadian clock-controlled translation of specific Neurospora crassa mRNAs requires rhythmic eIF2α activity and P-bodies. SSRN.2022.Reference Source
Cui H, Kapur M, Diedrich JK, et al.: Regulation of ex-translational activities is the primary function of the multi-tRNA synthetase complex. Nucleic Acids Res. 2021; 49: 3603–3616. PubMed Abstract | Publisher Full Text
Davis RH, De Serres FJ: Genetic and microbiological research techniques for Neurospora crassa. Meth. Enzymol. 1970; 17: 79–143. Publisher Full Text
De Los Santos H, Collins EJ, Mann C, et al.: ECHO: an application for detection and analysis of oscillators identifies metabolic regulation on genome-wide circadian output. Bioinformatics. 2020; 36: 773–781. PubMed Abstract | Publisher Full Text
Dekhang R, Wu C, Smith KM, et al.: The Neurospora transcription factor ADV-1 transduces light signals and temporal information to control rhythmic expression of genes involved in cell fusion. G3 (Bethesda). 2017; 7: 129–142. PubMed Abstract | Publisher Full Text
Ding Z, Lamb TM, Boukhris A, et al.: Circadian clock control of translation initiation factor eIF2α activity requires eIF2γ-Dependent Recruitment of Rhythmic PPP-1 Phosphatase in Neurospora crassa. MBio. 2021; 12. PubMed Abstract | Publisher Full Text
Dunlap JC, Loros JJ: Making time: conservation of biological clocks from fungi to animals. Microbiol. Spectr. 2017; 5. PubMed Abstract | Publisher Full Text
Eckel-Mahan K, Sassone-Corsi P: Metabolism control by the circadian clock and vice versa. Nat. Struct. Mol. Biol. 2009; 16: 462–467. PubMed Abstract | Publisher Full Text
Foster RG: Sleep, circadian rhythms and health. Interface Focus. 2020; 10: 20190098. PubMed Abstract | Publisher Full Text
Froehlich AC, Loros JJ, Dunlap JC: Rhythmic binding of a WHITE COLLAR-containing complex to the frequency promoter is inhibited by FREQUENCY. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 5914–5919. PubMed Abstract | Publisher Full Text
Frugier M, Giege R: Yeast aspartyl-tRNA synthetase binds specifically its own mRNA. J. Mol. Biol. 2003; 331: 375–383. PubMed Abstract | Publisher Full Text
Galani K, Grosshans H, Deinert K, et al.: The intracellular location of two aminoacyl-tRNA synthetases depends on complex formation with Arc1p. EMBO J. 2001; 20: 6889–6898. PubMed Abstract | Publisher Full Text
Geyfman M, Kumar V, Liu Q, et al.: Brain and muscle Arnt-like protein-1 (BMAL1) controls circadian cell proliferation and susceptibility to UVB-induced DNA damage in the epidermis. Proc. Natl. Acad. Sci. U. S. A. 2012; 109: 11758–11763. PubMed Abstract | Publisher Full Text
Gooch VD, Mehra A, Larrondo LF, et al.: Fully codon-optimized luciferase uncovers novel temperature characteristics of the Neurospora clock. Eukaryot. Cell. 2008; 7: 28–37. PubMed Abstract | Publisher Full Text
Hausmann CD, Ibba M: Aminoacyl-tRNA synthetase complexes: molecular multitasking revealed. FEMS Microbiol. Rev. 2008; 32: 705–721. PubMed Abstract | Publisher Full Text
Hernandez-Garcia J, Navas-Carrillo D, Orenes-Pinero E: Alterations of circadian rhythms and their impact on obesity, metabolic syndrome and cardiovascular diseases. Crit. Rev. Food Sci. Nutr. 2020; 60: 1038–1047. PubMed Abstract | Publisher Full Text
Hughes ME, Ditacchio L, Hayes KR, et al.: Harmonics of circadian gene transcription in mammals. PLoS Genet. 2009; 5: e1000442. PubMed Abstract | Publisher Full Text
Hurley JM, Dasgupta A, Emerson JM, et al.: Analysis of clock-regulated genes in Neurospora reveals widespread posttranscriptional control of metabolic potential. Proc. Natl. Acad. Sci. U. S. A. 2014; 111: 16995–17002. PubMed Abstract | Publisher Full Text
Hurley JM, Jankowski MS, De Los Santos H, et al.: Circadian Proteomic Analysis Uncovers Mechanisms of Post-Transcriptional Regulation in Metabolic Pathways. Cell Syst. 2018; 7(613-626): e5.
Hyeon DY, Kim JH, Ahn TJ, et al.: Evolution of the multi-tRNA synthetase complex and its role in cancer. J. Biol. Chem. 2019; 294: 5340–5351. PubMed Abstract | Publisher Full Text
Janich P, Arpat AB, Castelo-Szekely V, et al.: Ribosome profiling reveals the rhythmic liver translatome and circadian clock regulation by upstream open reading frames. Genome Res. 2015; 25: 1848–1859. PubMed Abstract | Publisher Full Text
Karki S, Castillo K, Ding Z, et al.: Circadian clock control of eIF2α phosphorylation is necessary for rhythmic translation initiation. Proc. Natl. Acad. Sci. U. S. A. 2020; 117: 10935–10945. PubMed Abstract | Publisher Full Text
Kerjan P, Cerini C, Semeriva M, et al.: The multienzyme complex containing nine aminoacyl-tRNA synthetases is ubiquitous from Drosophila to mammals. Biochim. Biophys. Acta. 1994; 1199: 293–297. PubMed Abstract | Publisher Full Text
Krishna SS, Majumdar I, Grishin NV: Structural classification of zinc fingers: survey and summary. Nucleic Acids Res. 2003; 31: 532–550. PubMed Abstract | Publisher Full Text | Free Full Text
Lamb TM, Goldsmith CS, Bennett L, et al.: Direct transcriptional control of a p38 MAPK pathway by the circadian clock in Neurospora crassa. PLoS One. 2011; 6: e27149. PubMed Abstract | Publisher Full Text
Lee SW, Cho BH, Park SG, et al.: Aminoacyl-tRNA synthetase complexes: beyond translation. J. Cell Sci. 2004; 117: 3725–3734. PubMed Abstract | Publisher Full Text
Mauvoisin D, Wang J, Jouffe C, et al.: Circadian clock-dependent and -independent rhythmic proteomes implement distinct diurnal functions in mouse liver. Proc. Natl. Acad. Sci. U. S. A. 2014; 111: 167–172. PubMed Abstract | Publisher Full Text
Miller BH, Mcdearmon EL, Panda S, et al.: Circadian and CLOCK-controlled regulation of the mouse transcriptome and cell proliferation. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 3342–3347. PubMed Abstract | Publisher Full Text
Munoz-Guzman F, Caballero V, Larrondo LF: A global search for novel transcription factors impacting the Neurospora crassa circadian clock. G3 (Bethesda). 2021; 11. Publisher Full Text
Nie A, Sun B, Fu Z, et al.: Roles of aminoacyl-tRNA synthetases in immune regulation and immune diseases. Cell Death Dis. 2019; 10: 901. PubMed Abstract | Publisher Full Text
Pan T: Adaptive translation as a mechanism of stress response and adaptation. Annu. Rev. Genet. 2013; 47: 121–137. PubMed Abstract | Publisher Full Text
Pang YL, Poruri K, Martinis SA: tRNA synthetase: tRNA aminoacylation and beyond. Wiley Interdiscip. Rev. RNA. 2014; 5: 461–480. PubMed Abstract | Publisher Full Text
Park SG, Schimmel P, Kim S: Aminoacyl tRNA synthetases and their connections to disease. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 11043–11049. PubMed Abstract | Publisher Full Text
Pembroke WG, Babbs A, Davies KE, et al.: Temporal transcriptomics suggest that twin-peaking genes reset the clock. elife. 2015; 4. PubMed Abstract | Publisher Full Text
Reddy AB, Karp NA, Maywood ES, et al.: Circadian orchestration of the hepatic proteome. Curr. Biol. 2006; 16: 1107–1115. Publisher Full Text
Ribas De Pouplana L, Santos MA, Zhu JH, et al.: Protein mistranslation: friend or foe? Trends Biochem. Sci. 2014; 39: 355–362. Publisher Full Text
Robles MS, Cox J, Mann M: In-vivo quantitative proteomics reveals a key contribution of post-transcriptional mechanisms to the circadian regulation of liver metabolism. PLoS Genet. 2014; 10: e1004047. PubMed Abstract | Publisher Full Text
Roux PP, Topisirovic I: Regulation of mRNA translation by signaling pathways. Cold Spring Harb. Perspect. Biol. 2012; 4.
Rubio Gomez MA, Ibba M: Aminoacyl-tRNA synthetases. RNA. 2020; 26: 910–936. PubMed Abstract | Publisher Full Text
Sancar C, Sancar G, Ha N, et al.: Dawn- and dusk-phased circadian transcription rhythms coordinate anabolic and catabolic functions in Neurospora. BMC Biol. 2015; 13: 17. PubMed Abstract | Publisher Full Text
Simos G, Sauer A, Fasiolo F, et al.: A conserved domain within Arc1p delivers tRNA to aminoacyl-tRNA synthetases. Mol. Cell. 1998; 1: 235–242. PubMed Abstract | Publisher Full Text
Smith KM, Sancar G, Dekhang R, et al.: Transcription factors in light and circadian clock signaling networks revealed by genomewide mapping of direct targets for Neurospora white collar complex. Eukaryot. Cell. 2010; 9: 1549–1556. Publisher Full Text
Vollmers C, Schmitz RJ, Nathanson J, et al.: Circadian oscillations of protein-coding and regulatory RNAs in a highly dynamic mammalian liver epigenome. Cell Metab. 2012; 16: 833–845. PubMed Abstract | Publisher Full Text
Westergaard M, Mitchell H: Neurospora V. A synthetic medium favoring sexual reproduction. Am. J. Bot. 1947; 34: 573–577. Publisher Full Text
Wickham Hggplot2: Elegant graphics for data analysis.2016.Reference Source
Yoshitane H, Ozaki H, Terajima H, et al.: CLOCK-controlled polyphonic regulation of circadian rhythms through canonical and noncanonical E-boxes. Mol Cell Biol. 2014; 34: 1776–1787. PubMed Abstract | Publisher Full Text
Yu YC, Han JM, Kim S: Aminoacyl-tRNA synthetases and amino acid signaling. Biochim. Biophys. Acta, Mol. Cell Res. 2021; 1868: 118889. PubMed Abstract | Publisher Full Text
Zhang R, Lahens NF, Ballance HI, et al.: A circadian gene expression atlas in mammals: implications for biology and medicine. Proc. Natl. Acad. Sci. U. S. A. 2014; 111: 16219–16224. PubMed Abstract | Publisher Full Text
Zhou Z, Sun B, Nie A, et al.: Roles of aminoacyl-tRNA synthetases in cancer. Front. Cell Dev. Biol. 2020; 8: 599765. PubMed Abstract | Publisher Full Text
Zielinski T, Moore AM, Troup E, et al.: Strengths and limitations of period estimation methods for circadian data. PLoS One. 2014; 9: e96462. PubMed Abstract | Publisher Full Text

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 22 Dec 2022

Author details Author details

¹ Biology, Texas A&M University, College Station, TX, 77843, USA
² Center for Biological Clocks Research, Texas A&M University, College Station, TX, 77843, USA

Kathrina D. Castillo
Roles: Formal Analysis, Investigation, Validation, Writing – Original Draft Preparation, Writing – Review & Editing

Emily D. Chapa
Roles: Formal Analysis, Investigation, Validation, Visualization

Deborah Bell-Pedersen
Roles: Conceptualization, Funding Acquisition, Writing – Original Draft Preparation, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

This work was supported by the National Institute of General Medical Sciences (NIH/GM) R35 GM126966 to DBP, and the Arnold and Mabel Beckman Foundation Beckman Scholars Program to EDC.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (2)

version 2

Revised

Published: 17 Aug 2023, 11:1556

https://doi.org/10.12688/f1000research.125351.2

version 1

Published: 22 Dec 2022, 11:1556

https://doi.org/10.12688/f1000research.125351.1

© 2022 Castillo KD et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Castillo KD, Chapa ED and Bell-Pedersen D. Circadian clock control of tRNA synthetases in Neurospora crassa [version 1; peer review: 2 approved with reservations]. F1000Research 2022, 11:1556 (https://doi.org/10.12688/f1000research.125351.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 22 Dec 2022

Views

Reviewer Report 14 Mar 2023

Luis F. Larrondo, Millennium Science Initiative, Millennium Institute for Integrative Biology (iBio), Santiago, Chile

Approved with Reservations

https://doi.org/10.5256/f1000research.137649.r160525

The work by Castillo et al., provides new information on how the circadian clocks impact cellular proteostasis, particularly how several tRNA synthases are rhythmically expressed. The observations contained in the MS provide a mechanistic perspective on the prior events leading to rhythmic translation via eIF2a.

Overall the MS is nicely written and easy to follow. There are some minor points that could by further clarified.

“While the regulation of aaRS expression in prokaryotes is well-described, less is known about their regulation in eukaryotes (Frugier and Giege, 2003)”.

Since this is a 20-year old ref, please provide additional references that exemplify that up to this date there is a knowledge gap in eukaryotes.
Table 2 legend fails to mention that it also compiles data extracted from Fig. 4.
In Fig 2. It appears that both tRNA synthase genes show some residual rhythm in the delta frq strain. Moreover, when one goes to the heatmap on Fig1, one may have a similar “impression”. Could the authors further discuss this and, particularly, comment if the rhythmicity indexes obtained with the software yielded borderline rhythmicity?
“We found, for example, that AspRS::LUC was rhythmic in WT and Δclr-1 (NCU07705) cells”.

It is unclear why the authors decided to examine these two particular KOs (NCU07705 and NCU00275) in AspRS expression. Was the choice guided by bioinformatic analyses or literature curation? The same applies to the GlnRS.
“Furthermore, the progressive dampening of GlnRS::LUC levels in Δadv-1 significantly reduced the amplitude of oscillation, leading to arrhythmicity (Figure 4D).”

While I agree that the absence of adv-1 has an impact on GlnRS expression, I am not so convinced that the end result is arrhythmic gene expression.

Eye-examination of Fig 4c reveals a distinct oscillatory pattern. I would even predict that if the rhythmicity analysis is limited to the first 72 or 96 h, the software will confirm circadian rhythms. Moreover, if one were to cross such strain with a frq7 allele, my prediction is that the expression of GlnRS in the absence of adv-1 will look indistinctively circadian (particularly aided by the overall higher amplitude of rhythms in frq7) and with a longer period.
“ GlnRS rhythms were less robust in Δadv-1”

In the discussion, the authors are less categoric about the effect of adv-1 and don’t talk about arrhythmicity, while in table 2(and Fig 4) they use the latter concept.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Circadian rhythms, Neurospora genetics and gene expression

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 29 Nov 2023

Deborah Bell-Pedersen, Center for Biological Clocks Research, Texas A&M University, College Station, 77843, USA

29 Nov 2023

Author Response

We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels ... Continue reading We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

“While the regulation of aaRS expression in prokaryotes is well-described, less is known about their regulation in eukaryotes (Frugier and Giege, 2003)”.

Since this is a 20-year old ref, please provide additional references that exemplify that up to this date there is a knowledge gap in eukaryotes.

We included a more recent study demonstrating coordinate regulation of cytoplasmic aaRS gene transcription by amino acid starvation (Shan et al, 2016).

Table 2 legend fails to mention that it also compiles data extracted from Fig. 4.

Thank you, this was corrected.

In Fig 2. It appears that both tRNA synthase genes show some residual rhythm in the delta frqstrain. Moreover, when one goes to the heatmap on Fig1, one may have a similar “impression”. Could the authors further discuss this and, particularly, comment if the rhythmicity indexes obtained with the software yielded borderline rhythmicity?

We now include data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

“We found, for example, that AspRS::LUC was rhythmic in WT and Δclr-1 (NCU07705) cells”.

It is unclear why the authors decided to examine these two particular KOs (NCU07705 and NCU00275) in AspRS expression. Was the choice guided by bioinformatic analyses or literature curation? The same applies to the GlnRS.

We now include the background on why these particular TFs were chosen for study

“Furthermore, the progressive dampening of GlnRS::LUC levels in Δadv-1 significantly reduced the amplitude of oscillation, leading to arrhythmicity (Figure 4D).”

While I agree that the absence of adv-1 has an impact on GlnRS expression, I am not so convinced that the end result is arrhythmic gene expression.

Eye-examination of Fig 4c reveals a distinct oscillatory pattern. I would even predict that if the rhythmicity analysis is limited to the first 72 or 96 h, the software will confirm circadian rhythms. Moreover, if one were to cross such strain with a frq7 allele, my prediction is that the expression of GlnRS in the absence of adv-1 will look indistinctively circadian (particularly aided by the overall higher amplitude of rhythms in frq7) and with a longer period.

“ GlnRS rhythms were less robust in Δadv-1”

In the discussion, the authors are less categoric about the effect of adv-1 and don’t talk about arrhythmicity, while in table 2(and Fig 4) they use the latter concept.

We reanalyzed the data in Figure 4C, as suggested by the reviewer, from DD12 to DD96, and found that the data fit to a sine wave with a period of 22.5 h, but with a low amplitude compared to WT. This information is now included in Table 2 and in the text.
We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

“While the regulation of aaRS expression in prokaryotes is well-described, less is known about their regulation in eukaryotes (Frugier and Giege, 2003)”.

Since this is a 20-year old ref, please provide additional references that exemplify that up to this date there is a knowledge gap in eukaryotes.

We included a more recent study demonstrating coordinate regulation of cytoplasmic aaRS gene transcription by amino acid starvation (Shan et al, 2016).

Table 2 legend fails to mention that it also compiles data extracted from Fig. 4.

Thank you, this was corrected.

In Fig 2. It appears that both tRNA synthase genes show some residual rhythm in the delta frqstrain. Moreover, when one goes to the heatmap on Fig1, one may have a similar “impression”. Could the authors further discuss this and, particularly, comment if the rhythmicity indexes obtained with the software yielded borderline rhythmicity?

We now include data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

“We found, for example, that AspRS::LUC was rhythmic in WT and Δclr-1 (NCU07705) cells”.

It is unclear why the authors decided to examine these two particular KOs (NCU07705 and NCU00275) in AspRS expression. Was the choice guided by bioinformatic analyses or literature curation? The same applies to the GlnRS.

We now include the background on why these particular TFs were chosen for study

“Furthermore, the progressive dampening of GlnRS::LUC levels in Δadv-1 significantly reduced the amplitude of oscillation, leading to arrhythmicity (Figure 4D).”

While I agree that the absence of adv-1 has an impact on GlnRS expression, I am not so convinced that the end result is arrhythmic gene expression.

Eye-examination of Fig 4c reveals a distinct oscillatory pattern. I would even predict that if the rhythmicity analysis is limited to the first 72 or 96 h, the software will confirm circadian rhythms. Moreover, if one were to cross such strain with a frq7 allele, my prediction is that the expression of GlnRS in the absence of adv-1 will look indistinctively circadian (particularly aided by the overall higher amplitude of rhythms in frq7) and with a longer period.

“ GlnRS rhythms were less robust in Δadv-1”

In the discussion, the authors are less categoric about the effect of adv-1 and don’t talk about arrhythmicity, while in table 2(and Fig 4) they use the latter concept.

We reanalyzed the data in Figure 4C, as suggested by the reviewer, from DD12 to DD96, and found that the data fit to a sine wave with a period of 22.5 h, but with a low amplitude compared to WT. This information is now included in Table 2 and in the text.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 29 Nov 2023

Deborah Bell-Pedersen, Center for Biological Clocks Research, Texas A&M University, College Station, 77843, USA

29 Nov 2023

Author Response

We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels ... Continue reading We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

“While the regulation of aaRS expression in prokaryotes is well-described, less is known about their regulation in eukaryotes (Frugier and Giege, 2003)”.

Since this is a 20-year old ref, please provide additional references that exemplify that up to this date there is a knowledge gap in eukaryotes.

We included a more recent study demonstrating coordinate regulation of cytoplasmic aaRS gene transcription by amino acid starvation (Shan et al, 2016).

Table 2 legend fails to mention that it also compiles data extracted from Fig. 4.

Thank you, this was corrected.

In Fig 2. It appears that both tRNA synthase genes show some residual rhythm in the delta frqstrain. Moreover, when one goes to the heatmap on Fig1, one may have a similar “impression”. Could the authors further discuss this and, particularly, comment if the rhythmicity indexes obtained with the software yielded borderline rhythmicity?

We now include data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

“We found, for example, that AspRS::LUC was rhythmic in WT and Δclr-1 (NCU07705) cells”.

It is unclear why the authors decided to examine these two particular KOs (NCU07705 and NCU00275) in AspRS expression. Was the choice guided by bioinformatic analyses or literature curation? The same applies to the GlnRS.

We now include the background on why these particular TFs were chosen for study

“Furthermore, the progressive dampening of GlnRS::LUC levels in Δadv-1 significantly reduced the amplitude of oscillation, leading to arrhythmicity (Figure 4D).”

While I agree that the absence of adv-1 has an impact on GlnRS expression, I am not so convinced that the end result is arrhythmic gene expression.

Eye-examination of Fig 4c reveals a distinct oscillatory pattern. I would even predict that if the rhythmicity analysis is limited to the first 72 or 96 h, the software will confirm circadian rhythms. Moreover, if one were to cross such strain with a frq7 allele, my prediction is that the expression of GlnRS in the absence of adv-1 will look indistinctively circadian (particularly aided by the overall higher amplitude of rhythms in frq7) and with a longer period.

“ GlnRS rhythms were less robust in Δadv-1”

In the discussion, the authors are less categoric about the effect of adv-1 and don’t talk about arrhythmicity, while in table 2(and Fig 4) they use the latter concept.

We reanalyzed the data in Figure 4C, as suggested by the reviewer, from DD12 to DD96, and found that the data fit to a sine wave with a period of 22.5 h, but with a low amplitude compared to WT. This information is now included in Table 2 and in the text.
We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

“While the regulation of aaRS expression in prokaryotes is well-described, less is known about their regulation in eukaryotes (Frugier and Giege, 2003)”.

Since this is a 20-year old ref, please provide additional references that exemplify that up to this date there is a knowledge gap in eukaryotes.

We included a more recent study demonstrating coordinate regulation of cytoplasmic aaRS gene transcription by amino acid starvation (Shan et al, 2016).

Table 2 legend fails to mention that it also compiles data extracted from Fig. 4.

Thank you, this was corrected.

In Fig 2. It appears that both tRNA synthase genes show some residual rhythm in the delta frqstrain. Moreover, when one goes to the heatmap on Fig1, one may have a similar “impression”. Could the authors further discuss this and, particularly, comment if the rhythmicity indexes obtained with the software yielded borderline rhythmicity?

We now include data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

“We found, for example, that AspRS::LUC was rhythmic in WT and Δclr-1 (NCU07705) cells”.

It is unclear why the authors decided to examine these two particular KOs (NCU07705 and NCU00275) in AspRS expression. Was the choice guided by bioinformatic analyses or literature curation? The same applies to the GlnRS.

We now include the background on why these particular TFs were chosen for study

“Furthermore, the progressive dampening of GlnRS::LUC levels in Δadv-1 significantly reduced the amplitude of oscillation, leading to arrhythmicity (Figure 4D).”

While I agree that the absence of adv-1 has an impact on GlnRS expression, I am not so convinced that the end result is arrhythmic gene expression.

Eye-examination of Fig 4c reveals a distinct oscillatory pattern. I would even predict that if the rhythmicity analysis is limited to the first 72 or 96 h, the software will confirm circadian rhythms. Moreover, if one were to cross such strain with a frq7 allele, my prediction is that the expression of GlnRS in the absence of adv-1 will look indistinctively circadian (particularly aided by the overall higher amplitude of rhythms in frq7) and with a longer period.

“ GlnRS rhythms were less robust in Δadv-1”

In the discussion, the authors are less categoric about the effect of adv-1 and don’t talk about arrhythmicity, while in table 2(and Fig 4) they use the latter concept.

We reanalyzed the data in Figure 4C, as suggested by the reviewer, from DD12 to DD96, and found that the data fit to a sine wave with a period of 22.5 h, but with a low amplitude compared to WT. This information is now included in Table 2 and in the text.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Views

Reviewer Report 17 Jan 2023

Ruifeng Cao, Department of Neuroscience and Cell Biology, Rutgers University New Brunswick, Piscataway, New Jersey, USA

Approved with Reservations

https://doi.org/10.5256/f1000research.137649.r159010

In the manuscript, Castillo et al. report circadian regulation of aminoacyl-tRNA synthetases (aaRS) in Neurospora crassa. The study started with genome-wide translational profiling around two circadian cycles and found 17 of 26 aaRS exhibited circadian rhythmicity in ribosomal occupancy. Next, they focused on two of the 17 rhythmic aaRS, AspRS and GlnRS. They found that their protein and mRNA levels were regulated by the circadian clock, and by clock-controlled transcription factors, e.g., NCU00275 and ADV-1. They conclude that select aaRS drive rhythms in uncharged tRNAs, which in turn leads to rhythmic CPC-3 activation and mRNA translation. Overall, this is an elegant study that nicely follows up with their previous work, and most results are compelling. The new findings will advance our understanding of translational control mechanisms by aaRS in the circadian clock. I have some moderate to minor comments to help improve the manuscript.

In Fig.1A, it would be informative and comprehensive if the heatmaps of the 19 aaRS that did not exhibit circadian rhythms in ribosome occupancy are also shown in the figure or in a supplementary figure.
In Fig.1 legend, RFP should be RPF (ribosome-protected fragments or footprints).
The Ribo-Seq experiment and data analysis were not described in Methods. What are the numbers of biological replicates for WT and Δfrq groups, respectively? N=17 is for which group? Are those 17 samples pooled or processed separately for Ribo-Seq? What are the sample sizes in Figs.1B, 1C, 2A, and 2B?
In all figures, the lengths of the bars indicating circadian day and night are slightly shorter than 24h. Are these determined based on the period data in Tab.2?
Related to Figs. 2C and D, do Pasprs::luc and Pglnrs::luc exhibit rhythms in Δfrq cells? It would be interesting to see these data since the data in A and B show weak (although not statistically significant) rhythms in asprs and glnrs mRNA levels in Δfrq cells.
For audiences who are not familiar with the Neurospora clock, it would be helpful if more background information can be given regarding why the mutants Δclr-1 and Δncu00275 were selected in the current study. Please also discuss potential mechanisms for why AspRS::LUC was repressed and arrhythmic in Δncu00275 cells but the rhythms of GlnRS::LUC were barely affected. Are there any data indicating ncu00275 directly regulates asprs transcription?

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: circadian rhythm, translational control, neuroscience

CITE

Report a concern

Author Response 29 Nov 2023

Deborah Bell-Pedersen, Center for Biological Clocks Research, Texas A&M University, College Station, 77843, USA

29 Nov 2023

Author Response

We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels ... Continue reading We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

In Fig.1A, it would be informative and comprehensive if the heatmaps of the 19 aaRS that did not exhibit circadian rhythms in ribosome occupancy are also shown in the figure or in a supplementary figure.

We now include this data in Figure 1A.

In Fig.1 legend, RFP should be RPF (ribosome-protected fragments or footprints).

Corrected, thank you for catching this.

The Ribo-Seq experiment and data analysis were not described in Methods. What are the numbers of biological replicates for WT and Δfrq groups, respectively? N=17 is for which group? Are those 17 samples pooled or processed separately for Ribo-Seq? What are the sample sizes in Figs.1B, 1C, 2A, and 2B?

The Ribo-seq data were previously published and we reference the paper, but now also provide a very brief description of the datasets in the Materials and Methods. In the legend to Figure 1A, N=17 was to indicate that 17 tRNA synthetases were rhythmic. This was confusing and now removed from the figure legend. We include that the Ribo-seq datasets were n=2 in the legend.

In all figures, the lengths of the bars indicating circadian day and night are slightly shorter than 24h. Are these determined based on the period data in Tab.2?

Yes, the day night bars reflect subjective day and night based on the free running period in Table 2.

Related to Figs. 2C and D, do Pasprs::luc and Pglnrs::luc exhibit rhythms in Δfrq cells? It would be interesting to see these data since the data in A and B show weak (although not statistically significant) rhythms in asprs and glnrs mRNA levels in Δfrq cells.

We now include this data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

For audiences who are not familiar with the Neurospora clock, it would be helpful if more background information can be given regarding why the mutants Δclr-1 and Δncu00275 were selected in the current study. Please also discuss potential mechanisms for why AspRS::LUC was repressed and arrhythmic in Δncu00275 cells but the rhythms of GlnRS::LUC were barely affected. Are there any data indicating ncu00275 directly regulates asprs transcription?

We now include the background on why these particular TFs were chosen for study and discuss that although the RS’s peak in the same phase, this is regulated by different clock-controlled transcription factors.
We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

In Fig.1A, it would be informative and comprehensive if the heatmaps of the 19 aaRS that did not exhibit circadian rhythms in ribosome occupancy are also shown in the figure or in a supplementary figure.

We now include this data in Figure 1A.

In Fig.1 legend, RFP should be RPF (ribosome-protected fragments or footprints).

Corrected, thank you for catching this.

The Ribo-Seq experiment and data analysis were not described in Methods. What are the numbers of biological replicates for WT and Δfrq groups, respectively? N=17 is for which group? Are those 17 samples pooled or processed separately for Ribo-Seq? What are the sample sizes in Figs.1B, 1C, 2A, and 2B?

The Ribo-seq data were previously published and we reference the paper, but now also provide a very brief description of the datasets in the Materials and Methods. In the legend to Figure 1A, N=17 was to indicate that 17 tRNA synthetases were rhythmic. This was confusing and now removed from the figure legend. We include that the Ribo-seq datasets were n=2 in the legend.

In all figures, the lengths of the bars indicating circadian day and night are slightly shorter than 24h. Are these determined based on the period data in Tab.2?

Yes, the day night bars reflect subjective day and night based on the free running period in Table 2.

Related to Figs. 2C and D, do Pasprs::luc and Pglnrs::luc exhibit rhythms in Δfrq cells? It would be interesting to see these data since the data in A and B show weak (although not statistically significant) rhythms in asprs and glnrs mRNA levels in Δfrq cells.

We now include this data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

For audiences who are not familiar with the Neurospora clock, it would be helpful if more background information can be given regarding why the mutants Δclr-1 and Δncu00275 were selected in the current study. Please also discuss potential mechanisms for why AspRS::LUC was repressed and arrhythmic in Δncu00275 cells but the rhythms of GlnRS::LUC were barely affected. Are there any data indicating ncu00275 directly regulates asprs transcription?

We now include the background on why these particular TFs were chosen for study and discuss that although the RS’s peak in the same phase, this is regulated by different clock-controlled transcription factors.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 29 Nov 2023

Deborah Bell-Pedersen, Center for Biological Clocks Research, Texas A&M University, College Station, 77843, USA

29 Nov 2023

Author Response

We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels ... Continue reading We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

In Fig.1A, it would be informative and comprehensive if the heatmaps of the 19 aaRS that did not exhibit circadian rhythms in ribosome occupancy are also shown in the figure or in a supplementary figure.

We now include this data in Figure 1A.

In Fig.1 legend, RFP should be RPF (ribosome-protected fragments or footprints).

Corrected, thank you for catching this.

The Ribo-Seq experiment and data analysis were not described in Methods. What are the numbers of biological replicates for WT and Δfrq groups, respectively? N=17 is for which group? Are those 17 samples pooled or processed separately for Ribo-Seq? What are the sample sizes in Figs.1B, 1C, 2A, and 2B?

The Ribo-seq data were previously published and we reference the paper, but now also provide a very brief description of the datasets in the Materials and Methods. In the legend to Figure 1A, N=17 was to indicate that 17 tRNA synthetases were rhythmic. This was confusing and now removed from the figure legend. We include that the Ribo-seq datasets were n=2 in the legend.

In all figures, the lengths of the bars indicating circadian day and night are slightly shorter than 24h. Are these determined based on the period data in Tab.2?

Yes, the day night bars reflect subjective day and night based on the free running period in Table 2.

Related to Figs. 2C and D, do Pasprs::luc and Pglnrs::luc exhibit rhythms in Δfrq cells? It would be interesting to see these data since the data in A and B show weak (although not statistically significant) rhythms in asprs and glnrs mRNA levels in Δfrq cells.

We now include this data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

For audiences who are not familiar with the Neurospora clock, it would be helpful if more background information can be given regarding why the mutants Δclr-1 and Δncu00275 were selected in the current study. Please also discuss potential mechanisms for why AspRS::LUC was repressed and arrhythmic in Δncu00275 cells but the rhythms of GlnRS::LUC were barely affected. Are there any data indicating ncu00275 directly regulates asprs transcription?

We now include the background on why these particular TFs were chosen for study and discuss that although the RS’s peak in the same phase, this is regulated by different clock-controlled transcription factors.
We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

In Fig.1A, it would be informative and comprehensive if the heatmaps of the 19 aaRS that did not exhibit circadian rhythms in ribosome occupancy are also shown in the figure or in a supplementary figure.

We now include this data in Figure 1A.

In Fig.1 legend, RFP should be RPF (ribosome-protected fragments or footprints).

Corrected, thank you for catching this.

The Ribo-Seq experiment and data analysis were not described in Methods. What are the numbers of biological replicates for WT and Δfrq groups, respectively? N=17 is for which group? Are those 17 samples pooled or processed separately for Ribo-Seq? What are the sample sizes in Figs.1B, 1C, 2A, and 2B?

The Ribo-seq data were previously published and we reference the paper, but now also provide a very brief description of the datasets in the Materials and Methods. In the legend to Figure 1A, N=17 was to indicate that 17 tRNA synthetases were rhythmic. This was confusing and now removed from the figure legend. We include that the Ribo-seq datasets were n=2 in the legend.

In all figures, the lengths of the bars indicating circadian day and night are slightly shorter than 24h. Are these determined based on the period data in Tab.2?

Yes, the day night bars reflect subjective day and night based on the free running period in Table 2.

Related to Figs. 2C and D, do Pasprs::luc and Pglnrs::luc exhibit rhythms in Δfrq cells? It would be interesting to see these data since the data in A and B show weak (although not statistically significant) rhythms in asprs and glnrs mRNA levels in Δfrq cells.

We now include this data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

For audiences who are not familiar with the Neurospora clock, it would be helpful if more background information can be given regarding why the mutants Δclr-1 and Δncu00275 were selected in the current study. Please also discuss potential mechanisms for why AspRS::LUC was repressed and arrhythmic in Δncu00275 cells but the rhythms of GlnRS::LUC were barely affected. Are there any data indicating ncu00275 directly regulates asprs transcription?

We now include the background on why these particular TFs were chosen for study and discuss that although the RS’s peak in the same phase, this is regulated by different clock-controlled transcription factors.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 22 Dec 2022

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 2 (revision) 17 Aug 23	read	read
Version 1 22 Dec 22	read	read

Ruifeng Cao, Rutgers University New Brunswick, Piscataway, USA
Luis F. Larrondo, Millennium Institute for Integrative Biology (iBio), Santiago, Chile

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

17 Views

13 Oct 2023 | for Version 2

Luis F. Larrondo, Millennium Science Initiative, Millennium Institute for Integrative Biology (iBio), Santiago, Chile

17 Views Cite this report Responses(0)

Approved

This reviewer appreciates the efforts made by the authors to address the prior points.

It is surprising to see that the Class III aaRS show rhythms in Dfrq, which are overall just like WT (not amplitude nor phase appear to be affected).
Hopefully the authors will tackle some of those aaRS in future studies.

One minor comment:

Figure 2L (black line, ECHO p-value < 0.05) and Δfrq (gray line, ECHO p-value > 0.05).

Could the authors indicate the p value for Dfrq, as visual inspection of the data shows a “:hint” of rhythmicity and therefore it would be informative to know if p value is 0.06 or 0.6 for example)

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Circadian clocks Neurospora biology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

15 Views

24 Aug 2023 | for Version 2

Ruifeng Cao, Department of Neuroscience and Cell Biology, Rutgers University New Brunswick, Piscataway, New Jersey, USA

15 Views Cite this report Responses(0)

Approved

All my comments were satisfactorily addressed.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

circadian rhythm, translational control, neuroscience

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

40 Views

14 Mar 2023 | for Version 1

Luis F. Larrondo, Millennium Science Initiative, Millennium Institute for Integrative Biology (iBio), Santiago, Chile

40 Views Cite this report Responses(1)

Approved With Reservations

“While the regulation of aaRS expression in prokaryotes is well-described, less is known about their regulation in eukaryotes (Frugier and Giege, 2003)”.

Since this is a 20-year old ref, please provide additional references that exemplify that up to this date there is a knowledge gap in eukaryotes.
Table 2 legend fails to mention that it also compiles data extracted from Fig. 4.
In Fig 2. It appears that both tRNA synthase genes show some residual rhythm in the delta frq strain. Moreover, when one goes to the heatmap on Fig1, one may have a similar “impression”. Could the authors further discuss this and, particularly, comment if the rhythmicity indexes obtained with the software yielded borderline rhythmicity?
“We found, for example, that AspRS::LUC was rhythmic in WT and Δclr-1 (NCU07705) cells”.

It is unclear why the authors decided to examine these two particular KOs (NCU07705 and NCU00275) in AspRS expression. Was the choice guided by bioinformatic analyses or literature curation? The same applies to the GlnRS.
“Furthermore, the progressive dampening of GlnRS::LUC levels in Δadv-1 significantly reduced the amplitude of oscillation, leading to arrhythmicity (Figure 4D).”

While I agree that the absence of adv-1 has an impact on GlnRS expression, I am not so convinced that the end result is arrhythmic gene expression.

Eye-examination of Fig 4c reveals a distinct oscillatory pattern. I would even predict that if the rhythmicity analysis is limited to the first 72 or 96 h, the software will confirm circadian rhythms. Moreover, if one were to cross such strain with a frq7 allele, my prediction is that the expression of GlnRS in the absence of adv-1 will look indistinctively circadian (particularly aided by the overall higher amplitude of rhythms in frq7) and with a longer period.
“ GlnRS rhythms were less robust in Δadv-1”

In the discussion, the authors are less categoric about the effect of adv-1 and don’t talk about arrhythmicity, while in table 2(and Fig 4) they use the latter concept.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Circadian rhythms, Neurospora genetics and gene expression

Respond to this report

Responses (1)

Author Response

29 Nov 2023

Deborah Bell-Pedersen, Center for Biological Clocks Research, Texas A&M University, College Station, 77843, USA

We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

“While the regulation of aaRS expression in prokaryotes is well-described, less is known about their regulation in eukaryotes (Frugier and Giege, 2003)”.

Since this is a 20-year old ref, please provide additional references that exemplify that up to this date there is a knowledge gap in eukaryotes.

We included a more recent study demonstrating coordinate regulation of cytoplasmic aaRS gene transcription by amino acid starvation (Shan et al, 2016).

Table 2 legend fails to mention that it also compiles data extracted from Fig. 4.

Thank you, this was corrected.

In Fig 2. It appears that both tRNA synthase genes show some residual rhythm in the delta frqstrain. Moreover, when one goes to the heatmap on Fig1, one may have a similar “impression”. Could the authors further discuss this and, particularly, comment if the rhythmicity indexes obtained with the software yielded borderline rhythmicity?

We now include data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

“We found, for example, that AspRS::LUC was rhythmic in WT and Δclr-1 (NCU07705) cells”.

It is unclear why the authors decided to examine these two particular KOs (NCU07705 and NCU00275) in AspRS expression. Was the choice guided by bioinformatic analyses or literature curation? The same applies to the GlnRS.

We now include the background on why these particular TFs were chosen for study

“Furthermore, the progressive dampening of GlnRS::LUC levels in Δadv-1 significantly reduced the amplitude of oscillation, leading to arrhythmicity (Figure 4D).”

While I agree that the absence of adv-1 has an impact on GlnRS expression, I am not so convinced that the end result is arrhythmic gene expression.

Eye-examination of Fig 4c reveals a distinct oscillatory pattern. I would even predict that if the rhythmicity analysis is limited to the first 72 or 96 h, the software will confirm circadian rhythms. Moreover, if one were to cross such strain with a frq7 allele, my prediction is that the expression of GlnRS in the absence of adv-1 will look indistinctively circadian (particularly aided by the overall higher amplitude of rhythms in frq7) and with a longer period.

“ GlnRS rhythms were less robust in Δadv-1”

In the discussion, the authors are less categoric about the effect of adv-1 and don’t talk about arrhythmicity, while in table 2(and Fig 4) they use the latter concept.

We reanalyzed the data in Figure 4C, as suggested by the reviewer, from DD12 to DD96, and found that the data fit to a sine wave with a period of 22.5 h, but with a low amplitude compared to WT. This information is now included in Table 2 and in the text.

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

30 Views

17 Jan 2023 | for Version 1

Ruifeng Cao, Department of Neuroscience and Cell Biology, Rutgers University New Brunswick, Piscataway, New Jersey, USA

30 Views Cite this report Responses(1)

Approved With Reservations

In Fig.1A, it would be informative and comprehensive if the heatmaps of the 19 aaRS that did not exhibit circadian rhythms in ribosome occupancy are also shown in the figure or in a supplementary figure.
In Fig.1 legend, RFP should be RPF (ribosome-protected fragments or footprints).
The Ribo-Seq experiment and data analysis were not described in Methods. What are the numbers of biological replicates for WT and Δfrq groups, respectively? N=17 is for which group? Are those 17 samples pooled or processed separately for Ribo-Seq? What are the sample sizes in Figs.1B, 1C, 2A, and 2B?
In all figures, the lengths of the bars indicating circadian day and night are slightly shorter than 24h. Are these determined based on the period data in Tab.2?
Related to Figs. 2C and D, do Pasprs::luc and Pglnrs::luc exhibit rhythms in Δfrq cells? It would be interesting to see these data since the data in A and B show weak (although not statistically significant) rhythms in asprs and glnrs mRNA levels in Δfrq cells.
For audiences who are not familiar with the Neurospora clock, it would be helpful if more background information can be given regarding why the mutants Δclr-1 and Δncu00275 were selected in the current study. Please also discuss potential mechanisms for why AspRS::LUC was repressed and arrhythmic in Δncu00275 cells but the rhythms of GlnRS::LUC were barely affected. Are there any data indicating ncu00275 directly regulates asprs transcription?

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

circadian rhythm, translational control, neuroscience

Respond to this report

Responses (1)

Author Response

29 Nov 2023

Deborah Bell-Pedersen, Center for Biological Clocks Research, Texas A&M University, College Station, 77843, USA

We thank the reviewers for their comments and suggestions. We have made all of the recommended changes in the manuscript, including new experiments showing that the clock controls the levels of asprs and glnrs RNA levels, as described below under each point in bold.

In Fig.1A, it would be informative and comprehensive if the heatmaps of the 19 aaRS that did not exhibit circadian rhythms in ribosome occupancy are also shown in the figure or in a supplementary figure.

We now include this data in Figure 1A.

In Fig.1 legend, RFP should be RPF (ribosome-protected fragments or footprints).

Corrected, thank you for catching this.

The Ribo-Seq experiment and data analysis were not described in Methods. What are the numbers of biological replicates for WT and Δfrq groups, respectively? N=17 is for which group? Are those 17 samples pooled or processed separately for Ribo-Seq? What are the sample sizes in Figs.1B, 1C, 2A, and 2B?

The Ribo-seq data were previously published and we reference the paper, but now also provide a very brief description of the datasets in the Materials and Methods. In the legend to Figure 1A, N=17 was to indicate that 17 tRNA synthetases were rhythmic. This was confusing and now removed from the figure legend. We include that the Ribo-seq datasets were n=2 in the legend.

In all figures, the lengths of the bars indicating circadian day and night are slightly shorter than 24h. Are these determined based on the period data in Tab.2?

Yes, the day night bars reflect subjective day and night based on the free running period in Table 2.

Related to Figs. 2C and D, do Pasprs::luc and Pglnrs::luc exhibit rhythms in Δfrq cells? It would be interesting to see these data since the data in A and B show weak (although not statistically significant) rhythms in asprs and glnrs mRNA levels in Δfrq cells.

We now include this data in Figure 2D and E, showing that both Pasprs::luc and Pglnrs::luc are arrhythmic in Δfrq cells.

For audiences who are not familiar with the Neurospora clock, it would be helpful if more background information can be given regarding why the mutants Δclr-1 and Δncu00275 were selected in the current study. Please also discuss potential mechanisms for why AspRS::LUC was repressed and arrhythmic in Δncu00275 cells but the rhythms of GlnRS::LUC were barely affected. Are there any data indicating ncu00275 directly regulates asprs transcription?

We now include the background on why these particular TFs were chosen for study and discuss that although the RS’s peak in the same phase, this is regulated by different clock-controlled transcription factors.

View more View less

Competing Interests

No competing interests were disclosed.

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] Baird TD, Wek RC: Eukaryotic initiation factor 2 phosphorylation and translational control in metabolism. Adv. Nutr. 2012; 3: 307–321. PubMed Abstract | Publisher Full Text

[2] Baker CL, Loros JJ, Dunlap JC: The circadian clock of Neurospora crassa. FEMS Microbiol. Rev. 2012; 36: 95–110. PubMed Abstract | Publisher Full Text

[3] Bandyopadhyay AK, Deutscher MP: Complex of aminoacyl-transfer RNA synthetases. J. Mol. Biol. 1971; 60: 113–122. Publisher Full Text

[4] Barclay JL, Husse J, Bode B, et al.: Circadian desynchrony promotes metabolic disruption in a mouse model of shiftwork. PLoS One. 2012; 7: e37150. PubMed Abstract | Publisher Full Text

[5] Basenko EY, Pulman JA, Shanmugasundram A, et al.: FungiDB: An integrated bioinformatic resource for fungi and oomycetes. J. Fungi (Basel). 2018; 4.

[6] Bass JT: The circadian clock system's influence in health and disease. Genome Med. 2017; 9: 94. PubMed Abstract | Publisher Full Text

[7] Beasley AK, Lamb TM, Versaw W, et al.: A ras-1^bd Mauriceville strain for mapping mutations in Oak Ridge ras-1^bd strains. Fungal Genet. Rep. 2006; 53.

[8] Bell-Pedersen D: Circadian Clock-Controlled Translation of Specific mRNAs in Neurospora crassa Requires Rhythmic eIF2α Activity and P-body Sequestration. Gene Expression Omnibus. [Dataset]2022. GSE181566.Reference Source

[9] Bennett LD, Beremand P, Thomas TL, et al.: Circadian activation of the mitogen-activated protein kinase MAK-1 facilitates rhythms in clock-controlled genes in Neurospora crassa. Eukaryot. Cell. 2013; 12: 59–69. PubMed Abstract | Publisher Full Text

[10] Caster SZ, Castillo K, Sachs MS, et al.: Circadian clock regulation of mRNA translation through eukaryotic elongation factor eEF-2. Proc. Natl. Acad. Sci. U. S. A. 2016; 113: 9605–9610. PubMed Abstract | Publisher Full Text

[11] Castillo K, Bell-Pedersen D:Circadian Clock Control of tRNA synthetases in Neurospora crassa. figshare. Collection. [Dataset].2022. Publisher Full Text

[12] Castillo KD, Wu C, Ding Z, et al.: Circadian clock-controlled translation of specific Neurospora crassa mRNAs requires rhythmic eIF2α activity and P-bodies. SSRN.2022.Reference Source

[13] Cui H, Kapur M, Diedrich JK, et al.: Regulation of ex-translational activities is the primary function of the multi-tRNA synthetase complex. Nucleic Acids Res. 2021; 49: 3603–3616. PubMed Abstract | Publisher Full Text

[14] Davis RH, De Serres FJ: Genetic and microbiological research techniques for Neurospora crassa. Meth. Enzymol. 1970; 17: 79–143. Publisher Full Text

[15] De Los Santos H, Collins EJ, Mann C, et al.: ECHO: an application for detection and analysis of oscillators identifies metabolic regulation on genome-wide circadian output. Bioinformatics. 2020; 36: 773–781. PubMed Abstract | Publisher Full Text

[16] Dekhang R, Wu C, Smith KM, et al.: The Neurospora transcription factor ADV-1 transduces light signals and temporal information to control rhythmic expression of genes involved in cell fusion. G3 (Bethesda). 2017; 7: 129–142. PubMed Abstract | Publisher Full Text

[17] Ding Z, Lamb TM, Boukhris A, et al.: Circadian clock control of translation initiation factor eIF2α activity requires eIF2γ-Dependent Recruitment of Rhythmic PPP-1 Phosphatase in Neurospora crassa. MBio. 2021; 12. PubMed Abstract | Publisher Full Text

[18] Dunlap JC, Loros JJ: Making time: conservation of biological clocks from fungi to animals. Microbiol. Spectr. 2017; 5. PubMed Abstract | Publisher Full Text

[19] Eckel-Mahan K, Sassone-Corsi P: Metabolism control by the circadian clock and vice versa. Nat. Struct. Mol. Biol. 2009; 16: 462–467. PubMed Abstract | Publisher Full Text

[20] Foster RG: Sleep, circadian rhythms and health. Interface Focus. 2020; 10: 20190098. PubMed Abstract | Publisher Full Text

[21] Froehlich AC, Loros JJ, Dunlap JC: Rhythmic binding of a WHITE COLLAR-containing complex to the frequency promoter is inhibited by FREQUENCY. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 5914–5919. PubMed Abstract | Publisher Full Text

[22] Frugier M, Giege R: Yeast aspartyl-tRNA synthetase binds specifically its own mRNA. J. Mol. Biol. 2003; 331: 375–383. PubMed Abstract | Publisher Full Text

[23] Galani K, Grosshans H, Deinert K, et al.: The intracellular location of two aminoacyl-tRNA synthetases depends on complex formation with Arc1p. EMBO J. 2001; 20: 6889–6898. PubMed Abstract | Publisher Full Text

[24] Geyfman M, Kumar V, Liu Q, et al.: Brain and muscle Arnt-like protein-1 (BMAL1) controls circadian cell proliferation and susceptibility to UVB-induced DNA damage in the epidermis. Proc. Natl. Acad. Sci. U. S. A. 2012; 109: 11758–11763. PubMed Abstract | Publisher Full Text

[25] Gooch VD, Mehra A, Larrondo LF, et al.: Fully codon-optimized luciferase uncovers novel temperature characteristics of the Neurospora clock. Eukaryot. Cell. 2008; 7: 28–37. PubMed Abstract | Publisher Full Text

[26] Hausmann CD, Ibba M: Aminoacyl-tRNA synthetase complexes: molecular multitasking revealed. FEMS Microbiol. Rev. 2008; 32: 705–721. PubMed Abstract | Publisher Full Text

[27] Hernandez-Garcia J, Navas-Carrillo D, Orenes-Pinero E: Alterations of circadian rhythms and their impact on obesity, metabolic syndrome and cardiovascular diseases. Crit. Rev. Food Sci. Nutr. 2020; 60: 1038–1047. PubMed Abstract | Publisher Full Text

[28] Hughes ME, Ditacchio L, Hayes KR, et al.: Harmonics of circadian gene transcription in mammals. PLoS Genet. 2009; 5: e1000442. PubMed Abstract | Publisher Full Text

[29] Hurley JM, Dasgupta A, Emerson JM, et al.: Analysis of clock-regulated genes in Neurospora reveals widespread posttranscriptional control of metabolic potential. Proc. Natl. Acad. Sci. U. S. A. 2014; 111: 16995–17002. PubMed Abstract | Publisher Full Text

[30] Hurley JM, Jankowski MS, De Los Santos H, et al.: Circadian Proteomic Analysis Uncovers Mechanisms of Post-Transcriptional Regulation in Metabolic Pathways. Cell Syst. 2018; 7(613-626): e5.

[31] Hyeon DY, Kim JH, Ahn TJ, et al.: Evolution of the multi-tRNA synthetase complex and its role in cancer. J. Biol. Chem. 2019; 294: 5340–5351. PubMed Abstract | Publisher Full Text

[32] Janich P, Arpat AB, Castelo-Szekely V, et al.: Ribosome profiling reveals the rhythmic liver translatome and circadian clock regulation by upstream open reading frames. Genome Res. 2015; 25: 1848–1859. PubMed Abstract | Publisher Full Text

[33] Karki S, Castillo K, Ding Z, et al.: Circadian clock control of eIF2α phosphorylation is necessary for rhythmic translation initiation. Proc. Natl. Acad. Sci. U. S. A. 2020; 117: 10935–10945. PubMed Abstract | Publisher Full Text

[34] Kerjan P, Cerini C, Semeriva M, et al.: The multienzyme complex containing nine aminoacyl-tRNA synthetases is ubiquitous from Drosophila to mammals. Biochim. Biophys. Acta. 1994; 1199: 293–297. PubMed Abstract | Publisher Full Text

[35] Krishna SS, Majumdar I, Grishin NV: Structural classification of zinc fingers: survey and summary. Nucleic Acids Res. 2003; 31: 532–550. PubMed Abstract | Publisher Full Text | Free Full Text

[36] Lamb TM, Goldsmith CS, Bennett L, et al.: Direct transcriptional control of a p38 MAPK pathway by the circadian clock in Neurospora crassa. PLoS One. 2011; 6: e27149. PubMed Abstract | Publisher Full Text

[37] Lee SW, Cho BH, Park SG, et al.: Aminoacyl-tRNA synthetase complexes: beyond translation. J. Cell Sci. 2004; 117: 3725–3734. PubMed Abstract | Publisher Full Text

[38] Mauvoisin D, Wang J, Jouffe C, et al.: Circadian clock-dependent and -independent rhythmic proteomes implement distinct diurnal functions in mouse liver. Proc. Natl. Acad. Sci. U. S. A. 2014; 111: 167–172. PubMed Abstract | Publisher Full Text

[39] Miller BH, Mcdearmon EL, Panda S, et al.: Circadian and CLOCK-controlled regulation of the mouse transcriptome and cell proliferation. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 3342–3347. PubMed Abstract | Publisher Full Text

[40] Munoz-Guzman F, Caballero V, Larrondo LF: A global search for novel transcription factors impacting the Neurospora crassa circadian clock. G3 (Bethesda). 2021; 11. Publisher Full Text

[41] Nie A, Sun B, Fu Z, et al.: Roles of aminoacyl-tRNA synthetases in immune regulation and immune diseases. Cell Death Dis. 2019; 10: 901. PubMed Abstract | Publisher Full Text

[42] Pan T: Adaptive translation as a mechanism of stress response and adaptation. Annu. Rev. Genet. 2013; 47: 121–137. PubMed Abstract | Publisher Full Text

[43] Pang YL, Poruri K, Martinis SA: tRNA synthetase: tRNA aminoacylation and beyond. Wiley Interdiscip. Rev. RNA. 2014; 5: 461–480. PubMed Abstract | Publisher Full Text

[44] Park SG, Schimmel P, Kim S: Aminoacyl tRNA synthetases and their connections to disease. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 11043–11049. PubMed Abstract | Publisher Full Text

[45] Pembroke WG, Babbs A, Davies KE, et al.: Temporal transcriptomics suggest that twin-peaking genes reset the clock. elife. 2015; 4. PubMed Abstract | Publisher Full Text

[46] Reddy AB, Karp NA, Maywood ES, et al.: Circadian orchestration of the hepatic proteome. Curr. Biol. 2006; 16: 1107–1115. Publisher Full Text

[47] Ribas De Pouplana L, Santos MA, Zhu JH, et al.: Protein mistranslation: friend or foe? Trends Biochem. Sci. 2014; 39: 355–362. Publisher Full Text

[48] Robles MS, Cox J, Mann M: In-vivo quantitative proteomics reveals a key contribution of post-transcriptional mechanisms to the circadian regulation of liver metabolism. PLoS Genet. 2014; 10: e1004047. PubMed Abstract | Publisher Full Text

[49] Roux PP, Topisirovic I: Regulation of mRNA translation by signaling pathways. Cold Spring Harb. Perspect. Biol. 2012; 4.

[50] Rubio Gomez MA, Ibba M: Aminoacyl-tRNA synthetases. RNA. 2020; 26: 910–936. PubMed Abstract | Publisher Full Text

[51] Sancar C, Sancar G, Ha N, et al.: Dawn- and dusk-phased circadian transcription rhythms coordinate anabolic and catabolic functions in Neurospora. BMC Biol. 2015; 13: 17. PubMed Abstract | Publisher Full Text

[52] Simos G, Sauer A, Fasiolo F, et al.: A conserved domain within Arc1p delivers tRNA to aminoacyl-tRNA synthetases. Mol. Cell. 1998; 1: 235–242. PubMed Abstract | Publisher Full Text

[53] Smith KM, Sancar G, Dekhang R, et al.: Transcription factors in light and circadian clock signaling networks revealed by genomewide mapping of direct targets for Neurospora white collar complex. Eukaryot. Cell. 2010; 9: 1549–1556. Publisher Full Text

[54] Vollmers C, Schmitz RJ, Nathanson J, et al.: Circadian oscillations of protein-coding and regulatory RNAs in a highly dynamic mammalian liver epigenome. Cell Metab. 2012; 16: 833–845. PubMed Abstract | Publisher Full Text

[55] Westergaard M, Mitchell H: Neurospora V. A synthetic medium favoring sexual reproduction. Am. J. Bot. 1947; 34: 573–577. Publisher Full Text

[56] Wickham Hggplot2: Elegant graphics for data analysis.2016.Reference Source

[57] Yoshitane H, Ozaki H, Terajima H, et al.: CLOCK-controlled polyphonic regulation of circadian rhythms through canonical and noncanonical E-boxes. Mol Cell Biol. 2014; 34: 1776–1787. PubMed Abstract | Publisher Full Text

[58] Yu YC, Han JM, Kim S: Aminoacyl-tRNA synthetases and amino acid signaling. Biochim. Biophys. Acta, Mol. Cell Res. 2021; 1868: 118889. PubMed Abstract | Publisher Full Text

[59] Zhang R, Lahens NF, Ballance HI, et al.: A circadian gene expression atlas in mammals: implications for biology and medicine. Proc. Natl. Acad. Sci. U. S. A. 2014; 111: 16219–16224. PubMed Abstract | Publisher Full Text

[60] Zhou Z, Sun B, Nie A, et al.: Roles of aminoacyl-tRNA synthetases in cancer. Front. Cell Dev. Biol. 2020; 8: 599765. PubMed Abstract | Publisher Full Text

[61] Zielinski T, Moore AM, Troup E, et al.: Strengths and limitations of period estimation methods for circadian data. PLoS One. 2014; 9: e96462. PubMed Abstract | Publisher Full Text

Circadian clock control of tRNA synthetases in Neurospora crassa

Abstract

Keywords

Introduction

Methods

N. crassa strains and growth conditions

Table 1. Key resources table.

Luciferase assays

Statistical test for rhythmicity and analysis of circadian parameters

Results

AspRS and GlnRS protein levels are clock-controlled

Figure 1. The circadian clock controls amino acid tRNA synthetase (aaRS) translational rhythms.

Table 2. Calculated periods and phases for AspRS::LUC, GlnRS::LUC (data from Figure 1), Pasprs::luc and Pglnrs::luc in WT cells (data from Figure 2) and AspRS::LUC or GlnRS::LUC in transcription factor knockout cells (data from Figure 3).

Clock-controlled transcription factors drive rhythms in AspRS and GlnRS expression

Figure 2. asprs and glnrs mRNA are clock-controlled.

Figure 3. Transcription factor NCU00275 is required for robust rhythmic expression and AspRS protein levels.

Figure 4. Transcription factor ADV-1 is required for robust rhythmic expression of GlnRS protein levels.

Discussion

Data availability

Underlying data

Acknowledgements

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated