ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Data Note
Revised

Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence

[version 2; peer review: 2 approved]
PUBLISHED 24 Nov 2022
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the YCharOS (Antibody Characterization through Open Science) gateway.

This article is included in the Cell & Molecular Biology gateway.

Abstract

TBK1 is a serine-threonine protein kinase that has been linked to a number of diseases including amyotrophic lateral sclerosis and frontotemporal dementia. Reproducible research on TBK1 has been hampered by the lack of well characterized antibodies. In this study, we characterized 11 commercial antibodies for TBK1 for use in immunoblot, immunofluorescence and immunoprecipitation, using an isogeneic knock-out cell line as a control. We identify antibodies that appear specific for all three applications but invite the readers to interpret the present findings based on their own scientific expertise and use this report as a guide to select the most appropriate antibody for their specific needs.

Keywords

TBK1, Uniprot# Q9UHD2, antibody characterization, antibody validation, Western blot, immunoblot, immunoprecipitation, immunofluorescence

Revised Amendments from Version 1

We have clarified how we selected antibody concentration for WB and IF and have added the corresponding RRID link for each antibody to Table 2.

See the authors' detailed response to the review by Simon L. Goodman
See the authors' detailed response to the review by Nicolas Charlet

Introduction

The lack of robust characterization for research antibodies contributes to the reproducibility crisis.1 Given that there are more than five million antibodies on the commercial market (CiteAb.com), we hypothesize that with appropriate characterization criteria and testing, we should be able to identify high performing antibodies for many if not most proteins in the human genome.2

TBK1 regulates autophagy through phosphorylation of Optineurin3 and the C9ORF72/SMCR8 complex.4 Of note, mutations in both Optineurin5 and the C9ORF72/SMCR8 complex6,7 cause monogenic forms of amyotrophic lateral sclerosis and frontotemporal dementia. Moreover, TBK1 also phosphorylates LC3C, GABARAP-L28 and AKT19 promoting autophagy.

The endogenous localization of TBK1 under the basal state and during autophagy remains to be determined. Moreover, TBK1 protein interactomes have been determined using overexpression systems, with the exception of one study.10 TBK1 antibodies are key to address these unknowns.

To explore the availability of high-quality antibodies for human proteins, we devised an antibody characterization strategy in which we use wild-type (WT) and isogenic knockout (KO) control cells to perform head-to-head comparisons of all available commercial antibodies in immunoblot (Western blot), immunoprecipitation and immunofluorescence applications.11 Here, we apply this approach to TBK1 and identify specific antibodies for all tested applications, enabling biochemical and cellular assessment of TBK1.

Validation and discussion

To identify a cell line that expresses adequate levels of TBK1 protein to provide sufficient signal to noise, we examined the DepMap public proteomic database (depmap.org, RRID:SCR_017655). U2OS was selected as the expression of TBK1 protein level is in the average range of cancer cells analyzed,12 is easily amenable to CRISPR-Cas9 and is a rather flat cell line ideal for immunofluorescence studies. U2OS was modified with CRISPR/Cas9 to knockout the corresponding TBK1 gene (Table 1).13

Table 1. Summary of the cell lines used.

InstitutionRRID (Cellosaurus)Cell linegenotype
Montreal Neurological InstituteCVCL_0042U2OSWT
Montreal Neurological InstituteCVCL_A6LQU2OSTBK1 KO

Extracts from wild-type and TBK1 KO cells were prepared and used to probe 11 commercial antibodies from 6 companies (Table 2) by immunoblot (Western blot) and immunoprecipitation. The profile of each of the antibodies is shown in Figures 1, 2 and 3.

Table 2. Summary of the Serine/threonine-protein kinase TBK1antibodies tested.

CompanyCatalog numberLot numberRRID (Antibody Registry)ClonalityClone IDHostConcentration (μg/μl)Vendors recommended applications
Bio-TechneNB100-56705B-1AB_838420monoclonal108A429mouse1.00Wb, IF
Proteintech28397-1-AP00076443AB_2881132polyclonal-rabbit0.43Wb
Proteintech67211-1-Ig10013180AB_2882504monoclonal2D7B1mouse1.00Wb, IF
Thermo Fisher ScientificPA5-17478VL3152289AAB_10981817polyclonal-rabbitnot providedWb, IF, IP
Thermo Fisher Scientific7031542274494AB_2848223recombinant-mono12H60L39rabbit0.50Wb, IF
Abcamab12116GR3334526-1AB_298856monoclonal108A429mouse1.00Wb
Abcamab40676GR3275777-2AB_776632recombinant-monoEP611Yrabbit1.48Wb, IF
Abcamab109735GR3263881-3AB_10863562recombinant-monoEPR2867(2)-19rabbit0.50Wb, IP
GeneTexGTX11305743481AB_11174793polyclonal-rabbit0.70Wb, IF
Cell Signaling Technology380661AB_2827657recombinant-monoE8I3Grabbitnot providedWb, IP, IF
Cell Signaling Technology3504-AB_2255663recombinant-monoD1B4rabbitnot providedWb, IP
1177fde7-a844-4df9-a6ff-bd0ec736861e_figure1.gif

Figure 1. Serine/threonine-protein kinase TBK1 antibody screening by immunoblot.

Lysates of U2OS (WT and TBK1 KO) were prepared and 50 μg of protein were processed for immunoblot with the indicated TBK1 antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier, except for antibodies 28397-1-AP, PA5-17478, 703154, ab40676, and ab109735, which were titrated at 1/10000 because the signal was too strong following the supplier’s recommendations. Antibody dilution used: NB100-56705 at 1/500; 28397-1-AP at 1/10000; 67211-1-Ig at 1/1000; PA5-17478 at 1/10000; 703154 at 1/10000; ab12116 at 1/600; ab40676 at 1/10000; ab109735 at 1/10000; GTX113057 at 1/2000, 38066 at 1/1000, 3504 at 1/1000. Predicted band size: ~83 kDa.

1177fde7-a844-4df9-a6ff-bd0ec736861e_figure2.gif

Figure 2. Serine/thronine-protein kinase TBK1 screening by immunoprecipitation.

U2OS lysates were prepared and IP was performed using 1.0 μg of the indicated TBK1 antibodies pre-coupled to either protein G or protein A Sepharose beads. Samples were washed and processed for immunoblot with the indicated TBK1 antibody. For immunoblot, ab40676, ab12116 and 67211-1-Ig were used. The Ponceau stained transfers of each blot are shown for similar reasons as in Figure 1. SM=10% starting material; UB=10% unbound fraction; IP=immunoprecipitate.

1177fde7-a844-4df9-a6ff-bd0ec736861e_figure3.gif

Figure 3. Serine/threonine-protein kinase TBK1 antibody screening by immunofluorescence.

U2OS WT and TBK1 KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated TBK1 antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody including DAPI. Acquisition of the blue (nucleus-DAPI), green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of the merged blue and red (grayscale) channels are shown. WT and KO cells are outlined with yellow and magenta dashed line, respectively. Antibodies were tested at 1.0 μg/ml. When the concentration was not indicated by the supplier, we tested the antibodies at 1/500 or 1/1000. At this concentration, the signal from each antibody was in the range of detection of the microscope used. Antibody dilution used: NB100-56705 at 1/1000; 28397-1-AP at 1/500; 67211-1-Ig at 1/1000; PA5-17478 at 1/1000; 703154 at 1/500; ab12116 at 1/1000; ab40676 at 1/1500; ab109735 at 1/500; GTX113057 at 1/700, 38066 at 1/500, 3504 at 1/500. Bars = 10 μm.

Antibodies were screened by immunofluorescence using a mosaic strategy.11 WT cells were labelled with a green fluorescent dye, where as the KO cells were labelled with a far-red fluorescent dye. A third channel was used to image the primary antibodies. Plating WT and KO cells together and imaging both cell type in the same field of view reduces imaging and analysis biases.

In conclusion, we have screened TBK1 commercial antibodies by immunoblot, immunoprecipitation and immunofluorescence. The data provided can be used as a guide to purchase the most appropriate antibody for a researcher's needs.

Methods

Antibodies

All TBK1 antibodies are listed in Table 2. Peroxidase-conjugated goat anti-mouse and anti-rabbit antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-mouse and anti-rabbit secondary antibodies are from Thermo Fisher Scientific (cat. number A21424 and A21429).

CRISPR/Cas9 genome editing

Cell lines used are listed in Table 1. U2OS TBK1 KO clone was generated using an open-access protocol13 with an inducible Cas9 U2OS line.11 Two guide RNAs (purchased at Synthego) were used to introduce a STOP codon in the TBK1 gene (sequence guide 1: UUUGAACAUCCACUGGACGA, sequence guide 2: CAAAUUAUUUGCUAUUGAAG).

Cell culture

Cells were cultured in DMEM high-glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065, 100 IU penicillin and 100 μg/ml streptomycin (Wisent cat. number 450201).

Antibody screening by immunoblot

Immunoblots were performed as described in our standard operating procedure.14 Lysates were sonicated briefly and incubated 30 min on ice. Lysates were spun at ~110,000×g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and immunoblot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.

Immunoblots were performed with large 5-16% gradient polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau staining which is scanned at 300 dpi using a regular flatbed scanner to show together with individual immunoblot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated O/N at 4°C with 5% bovine serum albumin in TBS with 0.1% Tween 20 (TBST). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes are incubated with ECL from Pierce (cat. number 32106) prior to detection with HyBlot CL autoradiography films from Denville (cat. number 1159T41).

Antibody screening by immunoprecipitation

Immunoprecipitation was performed as described in our standard operating procedure.15 Antibody-bead conjugates were prepared by adding 1.0 μg of antibody to 500 ul of PBS with 0.01% triton X-100 in a microcentrifuge tube, together with 30 μl of protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) Sepharose beads. Tubes were rocked O/N at 4°C followed by several washes to remove unbound antibodies.

U2OS WT were collected in HEPES buffer (20 mM HEPES, 100 mM sodium chloride, 1 mM EDTA, 1% Triton X-100, pH 7.4) supplemented with protease inhibitor. Lysates are rocked 30 min at 4°C and spun at 110,000×g for 15 min at 4°C. One ml aliquots at 1.0 mg/ml of lysate were incubated with an antibody-bead conjugate for ~2 hrs at 4°C. Following centrifugation, the unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of HEPES lysis buffer and processed for SDS-PAGE and immunoblot on a 5-16% acrylamide gel.

Antibody screening by immunofluorescence

Immunofluorescence was performed as described in our standard operating procedure.16 U2OS WT and TBK1 KO were labelled with a green and a deep red fluorescence dye, respectively. The fluorescent dyes used are from Thermo Fisher Scientific (cat. number C2925 and C34565). WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator. Cells were fixed in 4% PFA (in PBS) for 15 min at room temperature and then washed 3 times with PBS. Cells were permeabilized in PBS with 0,1% Triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary TBK1 antibodies O/N at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/ml for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).

Imaging was performed using a Zeiss LSM 880 laser scanning confocal microscope equipped with a Plan-Apo 40× oil objective (NA = 1.40). Resulting images were cropped and adjusted for brightness and contrast using the Zen navigation software (Zeiss, Zen blue 3.4.91.00000). All cell images represent a single focal plane. Figures were assembled with Adobe Illustrator (version 26.3.1).

Data availability

Underlying data

Zenodo: Antibody Characterization Report for Serine/threonine-protein kinase TBK1, https://doi.org/10.5281/zenodo.6402968.17

Zenodo: Dataset for the TBK1 antibody screening study, https://doi.org/10.5281/zenodo.6914815.18

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 24 Aug 2022
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Alshafie W, Fotouhi M, Shlaifer I et al. Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved]. F1000Research 2022, 11:977 (https://doi.org/10.12688/f1000research.124632.2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 24 Nov 2022
Revised
Views
21
Cite
Reviewer Report 25 Nov 2022
Nicolas Charlet, Institut de Genetique et de Biologie Moleculaire et Cellulaire (IGBMC), INSERM , CNRS, Université of Strasbourg, Illkirch, France 
Approved
VIEWS 21
The authors adequatey ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Charlet N. Reviewer Report For: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved]. F1000Research 2022, 11:977 (https://doi.org/10.5256/f1000research.141225.r156538)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 24 Aug 2022
Views
57
Cite
Reviewer Report 09 Nov 2022
Simon L. Goodman, The University of Turku, Turku, Finland 
Approved
VIEWS 57
The researchers examine a set of 11 commercially available antibodies marketed as recognizing TBK1, a protein linked to several human neurological conditions, for reactivity in Western blot, immunoprecipitation, and fixed cell Immunofluorescence. 

The specificity of the antibodies ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Goodman SL. Reviewer Report For: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved]. F1000Research 2022, 11:977 (https://doi.org/10.5256/f1000research.136844.r154820)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 24 Nov 2022
    Carl Laflamme, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Canada
    24 Nov 2022
    Author Response
    We thank Simon Goodman (reviewer #2) for his review of our manuscript, and for summarizing the YCharOS effort.

    Dr. Goodman states “The specificity of the antibodies in the various ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 24 Nov 2022
    Carl Laflamme, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Canada
    24 Nov 2022
    Author Response
    We thank Simon Goodman (reviewer #2) for his review of our manuscript, and for summarizing the YCharOS effort.

    Dr. Goodman states “The specificity of the antibodies in the various ... Continue reading
Views
70
Cite
Reviewer Report 06 Sep 2022
Nicolas Charlet, Institut de Genetique et de Biologie Moleculaire et Cellulaire (IGBMC), INSERM , CNRS, Université of Strasbourg, Illkirch, France 
Approved
VIEWS 70
In this work, Laflamme and collaborators investigate the quality and specificity of various commercial antibodies directed against the TBK1 protein, an important kinase regulating immunity and which loss- or gain-of-function mutations cause Amyotrophic Lateral Sclerosis or Normal-Tension Glaucoma, respectively.
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Charlet N. Reviewer Report For: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved]. F1000Research 2022, 11:977 (https://doi.org/10.5256/f1000research.136844.r148432)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 24 Nov 2022
    Carl Laflamme, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Canada
    24 Nov 2022
    Author Response
    We thank Nicolas Charlet (reviewer #1) for review of our manuscript. Dr. Charlet suggests we “include a table summarizing what antibody is best recommended for what usage” to avoid misinterpretation ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 24 Nov 2022
    Carl Laflamme, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Canada
    24 Nov 2022
    Author Response
    We thank Nicolas Charlet (reviewer #1) for review of our manuscript. Dr. Charlet suggests we “include a table summarizing what antibody is best recommended for what usage” to avoid misinterpretation ... Continue reading

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 24 Aug 2022
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.