The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence

Riham Ayoubi; Walaa Alshafie; Irina Shlaifer; Kathleen Southern; Peter S. McPherson; Carl Laflamme; NeuroSGC/YCharOS/EDDU collaborative group

doi:10.12688/f1000research.132628.1

Home Browse The identification of high-performing antibodies for Sequestosome-1...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Data Note

The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence

[version 1; peer review: 1 approved, 1 approved with reservations]

Riham Ayoubi¹, Walaa Alshafie¹, Irina Shlaifer², [...] Kathleen Southern¹, Peter S. McPherson¹, Carl Laflamme ¹, NeuroSGC/YCharOS/EDDU collaborative group

Riham Ayoubi¹, Walaa Alshafie¹, [...] Irina Shlaifer², Kathleen Southern¹, Peter S. McPherson¹, Carl Laflamme ¹, NeuroSGC/YCharOS/EDDU collaborative group

PUBLISHED 23 Mar 2023

Author details Author details

¹ Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Québec, H3A 2B4, Canada
² The Neuro’s Early Drug Discovery Unit (EDDU), Structural Genomics Consortium, McGill University, Montreal, Québec, H3A 2B4, Canada

Riham Ayoubi
Roles: Investigation, Methodology, Visualization, Writing – Review & Editing

Walaa Alshafie
Roles: Investigation, Methodology

Irina Shlaifer
Roles: Investigation, Writing – Review & Editing

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Peter S. McPherson
Roles: Conceptualization, Funding Acquisition, Resources, Supervision

Carl Laflamme
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Cell & Molecular Biology gateway.

This article is included in the YCharOS (Antibody Characterization through Open Science) gateway.

Abstract

Sequestosome-1, encoded by the gene SQSTM1, functions as a bridge between ubiquitinated proteins and the proteasome or autophagosome, thereby regulating protein degradation pathways. Loss of Sequestosome-1 is hypothesized to enhance neurodegeneration progression in several diseases, including amyotrophic lateral sclerosis (ALS) and frontotemporal disorders (FTD). Sequestosome-1 reproducible research would be facilitated with the availability of well-characterized anti-Sequestosome-1 antibodies. In this study, we characterized seventeen Sequestosome-1 commercial antibodies for Western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs.

Keywords

Uniprot ID Q13501, SQSTM1, Sequestosome-1, antibody characterization, antibody validation, Western blot, immunoprecipitation, immunofluorescence

Corresponding author: Carl Laflamme

Competing interests: For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABclonal -Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems –Thermo Fisher Scientific.

Grant information: This work was supported in part by the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP is a private-public partnership created by the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). The Structural Genomics Consortium is a registered charity (no. 1097737) that receives funds from Bayer AG, Boehringer Ingelheim, Bristol Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda. RA and WA were supported by a Mitacs fellowship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2023 Ayoubi R et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Ayoubi R, Alshafie W, Shlaifer I et al. The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2023, 12:324 (https://doi.org/10.12688/f1000research.132628.1) First published: 23 Mar 2023, 12:324 (https://doi.org/10.12688/f1000research.132628.1) Latest published: 10 Jul 2024, 12:324 (https://doi.org/10.12688/f1000research.132628.2)

Introduction

Sequestosome-1, alternatively known as p62, is an adaptor protein required for selective autophagy and proteasomal degradation.¹^–³ Delivering polyubiquitinated proteins to the autophagosome or proteasome, Sequestosome-1/p62 plays a key role in the degradation of aggregate prone proteins.¹

SQSTM1 gene mutations may act as a potential threat by causing altered autophagy, resulting in pathogenic protein aggregation and the development of a variety of neurodegenerative diseases, including ALS and FTD.⁴ Furthermore, SQSTM1 mutations have been identified in patients with ALS and FTD.⁵ Serving as a signalling hub for neurodegenerative pathways, Sequestosome-1/p62 poses as a prospective therapeutic target in the treatment of neurodegenerative diseases.⁶ Mechanistic studies would be greatly facilitated with the availability of high-quality antibodies.

Here, we compared the performance of a range of commercially available antibodies for Sequestosome-1 and validated high-performing antibodies for Western blot, immunoprecipitation and immunofluorescence, enabling biochemical and cellular assessment of Sequestosome-1 properties and function.

Results and discussion

Our standard protocol involves comparing readouts from wild-type (WT) and knockout (KO) cells.⁷^–⁹ To identify a cell line that expresses adequate levels of Sequestosome-1 protein to provide sufficient signal to noise we examined public proteomics databases, namely PAXdb (RRID:SCR_018910)¹⁰ and DepMap (RRID:SCR_017655).¹¹ U2OS was identified as a suitable cell line and thus U2OS was modified with CRISPR/Cas9 to knockout the corresponding SQSTM1 gene (Table 1).

Table 1. Summary of the cell lines used.

Institution	RRID (Cellosaurus)	Cell line	Genotype
Montreal Neurological Institute	CVCL_0042	U2OS	WT
Montreal Neurological Institute	CVCL_A6LP	U2OS	SQSTM1 KO

For Western blot experiments, we resolved proteins from WT and SQSTM1 KO cell extracts and probed them side-by-side with all antibodies in parallel⁸^,⁹ (Figure 1).

Figure 1. Sequestosome-1 antibody screening by Western blot.

Lysates of U2OS (WT and SQSTM1 KO) were prepared and 25 μg of protein were processed for Western blot with the indicated Sequestosome-1 antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies MA5-32835*, 66184-1-Ig* and 18420-1-AP, which were titrated to 1/200, 1/1000 and 1/1000, respectively, as the signals were too weak when following the supplier’s recommendations. Antibody dilution used: GTX629890* at 1/1000; GTX629888* at 1/1000; GTX100685 at 1/1000; 701510** at 1/1000; 710539** at 1/200; MA5-32835* at 1/200; 66184-1-Ig* at 1/1000; 18420-1-AP at 1/1000; 55274-1-AP at 1/1000; NBP2-23490* at 1/1000; MAB80281** at 1/1000; MAB8028* at 1/1000; MAB8028R** at 1/1000; ab109012** at 1/10000; ab56416* at 1/1000; ab207305** at 1/1000; ab240635** at 1/1000. Predicted band size: ~62 kDa. *= monoclonal antibody, **= recombinant antibody.

For immunoprecipitation experiments, we used the antibodies to immunopurify Sequestosome-1 from U2OS cell extracts. The performance of each antibody was evaluated by detecting the Sequestosome-1 protein in extracts, in the immunodepleted extracts and in the immunoprecipitates⁸^,⁹ (Figure 2).

Figure 2. Sequestosome-1 antibody screening by immunoprecipitation.

U2OS lysates were prepared, and IP was performed using 1.0 μg of the indicated Sequestosome-1 antibodies pre-coupled to protein G or protein A Sepharose beads. Samples were washed and processed for Western blot with the indicated Sequestosome-1 antibody. For Western blot, MAB80281** was used at 1/3000, 66184-1-lg* at 1/3000, ab56416* at 1/5000, ab207305** at 1/10000 and GTX629890* at 1/5000. The Ponceau stained transfers of each blot are shown for similar reasons as in Figure 1. SM= 10% starting material; UB=10% unbound fraction; IP=immunoprecipitate, HC= antibody heavy chain. *= monoclonal antibody, **= recombinant antibody.

For immunofluorescence, as described previously, antibodies were screened using a mosaic strategy.¹² In brief, we plated WT and KO cells together in the same well and imaged both cell types in the same field of view to reduce staining, imaging and image analysis bias (Figure 3).

Figure 3. Sequestosome-1 antibody screening by immunofluorescence.

U2OS WT and SQSTM1 KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated Sequestosome-1 antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody. Acquisition of the green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of red (grayscale images) channel are shown. WT and KO cells are outlined with yellow and magenta dashed line, respectively. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies MA5-32835*, 18420-1-AP and NBP2-23490*, which were titrated to 1/2000, 1/300 and 1/1000, respectively, as the signals were too strong when following the supplier’s recommendations. When the concentration was not indicated by the supplier, we tested antibodies at 1/500 and 1/1000. At this concentration, the signal from each antibody was in the range of detection of the microscope used. Antibody dilution used: GTX629890* at 1/1000; GTX629888* at 1/1000; GTX100685 at 1/700; 701510** at 1/500; 710539** at 1/500; MA5-32835* at 1/2000; 66184-1-Ig* at 1/300; 18420-1-AP at 1/300; 55274-1-AP at 1/1300; NBP2-23490* at 1/1000; MAB80281** at 1/500; MAB8028* at 1/500; MAB8028R** at 1/500; ab109012** at 1/500; ab56416* at 1/1000; ab207305** at 1/200; ab240635** at 1/500. Bars = 10 μm. *= monoclonal antibody, **= recombinant antibody.

In conclusion, we have screened Sequestosome-1 commercial antibodies by Western blot, immunoprecipitation and immunofluorescence and characterized several high-quality antibodies under our standardized experimental conditions. The underlying data can be found on Zenodo.¹³^,¹⁴

Methods

Antibodies

All Sequestosome-1 antibodies are listed in Table 2, together with their corresponding Research Resource Identifiers, or RRID, to ensure the antibodies are cited properly.¹⁵ Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-mouse and anti-rabbit secondary antibodies are from Thermo Fisher Scientific (cat. number A21424 and A21429).

Table 2. Summary of the Sequestosome-1 antibodies tested.

Company	Catalog number	Lot number	RRID (Antibody Registry)	Clonality	Clone ID	Host	Concentration (μg/μl)
GeneTex	GTX629890*	41470	AB_2885144	monoclonal	GT1478	mouse	1.00
GeneTex	GTX629888*	41470	AB_2885143	monoclonal	GT239	mouse	1.00
GeneTex	GTX100685	42893	AB_2038029	polyclonal	-	rabbit	0.67
Thermo Fisher Scientific	701510**	2315239	AB_2532489	recombinant-mono	11HC14LC25	rabbit	0.50
Thermo Fisher Scientific	710539**	RF229394	AB_2532735	recombinant-poly	11HCLC	rabbit	0.50
Thermo Fisher Scientific	MA5-32835*	VL3152616	AB_2802482	monoclonal	10-E10	mouse	2.00
Proteintech	66184-1-Ig*	not provided	AB_2881579	monoclonal	1H5C1	mouse	1.33
Proteintech	18420-1-AP	not provided	AB_10694431	polyclonal	-	rabbit	0.35
Proteintech	55274-1-AP	not provided	AB_11182278	polyclonal	-	rabbit	0.43
Bio-Techne	NBP2-23490*	A-1	AB_2885153	monoclonal	5H7E2	mouse	1.00
Bio-Techne	MAB80281**	CMRM0120031	AB_2888658	recombinant-mono	2533b	rabbit	0.50
Bio-Techne	MAB8028*	CHZL0520071	AB_2885150	monoclonal	864807	mouse	0.50
Bio-Techne	MAB8028R**	CLJP0118091	AB_2885151	recombinant-mono	864807R	mouse	0.50
Abcam	ab109012**	GR3241806-8	AB_2810880	recombinant-mono	EPR4844	rabbit	0.43
Abcam	ab56416*	GR3374761-2	AB_945626	monoclonal	Not provided	mouse	1.00
Abcam	ab207305**	GR323335-4	AB_2885112	recombinant-mono	EPR18351	rabbit	0.21
Abcam	ab240635**	GR3314160-2	AB_2885121	recombinant-mono	EPR23101-103	rabbit	0.49

* = monoclonal antibody.

** = recombinant antibody.

CRISPR/Cas9 genome editing

SQSTM1 KO clone was generated in Cas9-expressing U2OS cell line⁷ with low passage cells using an open-access protocol available on Zenodo.org: https://zenodo.org/record/3875777#.ZA9VdC-96Tf. Two guide RNAs were used to introduce a STOP codon in the SQSTM1 gene (sequence guide 1: CCACCGCCCACCGUGUGCUC, sequence guide 2: AUGCGAGCUUGGUGUGCCCC).

Cell culture

Both U2OS WT and SQSTM1 KO cell lines used are listed in Table 1, together with their corresponding RRID, to ensure the cell lines are cited properly.¹⁶ Cells were cultured in DMEM high glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065), 100 IU penicillin and 100 μg/ml streptomycin (Wisent cat. number 450201).

Antibody screening by Western blot

Western blots were performed as described in our standard operating procedure.¹⁷ U2OS WT and SQSTM1 KO were collected in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1.0 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with protease inhibitor (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 x g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used.

Western blots were performed with large 4-15% polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau staining, which is scanned to show them together with individual Western blots. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4°C with 5% bovine serum albumin (BSA) (Wisent, cat. number 800-095) in TBS with 0.1% Tween 20 (TBST) (Cell Signaling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with regular ECL (cat. number 32106) or super signal West Femto (cat. number 34096) from Thermo Fisher Scientific prior to detection with the HyBlot CL autoradiography films from Denville (cat. number 1159T41).

Antibody screening by immunoprecipitation

Immunoprecipitation was performed as described in our standard operating procedure.¹⁸ Antibody-bead conjugates were prepared by adding 1.0 μg of antibody to 500 μl of phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL) with 0.01% triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) in a 1.5 mL microcentrifuge tube, together with 30 μl of protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) Sepharose beads. Tubes were rocked overnight at 4°C followed by several washes to remove unbound antibodies.

U2OS WT were collected in HEPES lysis buffer (20 mM HEPES, 100 mM sodium chloride, 1 mM EDTA, 1% Triton X-100, pH 7.4) supplemented with protease inhibitor (MilliporeSigma, cat. number P8340). Lysates were rocked 30 min at 4°C and spun at 110,000 x g for 15 min at 4°C. One ml aliquots at 1.0 mg/ml of lysate were incubated with an antibody-bead conjugate for ~2 hours at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of HEPES lysis buffer and processed for SDS-PAGE and Western blot on a 4-15% polyacrylamide gels as described above.

Antibody screening by immunofluorescence

Immunofluorescence was performed as described in our standard operating procedure.⁸^,⁹^,¹² U2OS WT and SQSTM1 KO were labelled with a green and a deep red fluorescence dye from Abcam (cat. number ab176735 and ab176736), respectively. WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37°C, 5% CO₂. Cells were fixed in 4% paraformaldehyde (PFA) (Beantown chemical, cat. number 140770-10ml) in PBS for 15 min at room temperature and then washed three times with PBS. Cells were permeabilized in PBS with 0.1% triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0.01% Triton X-100) containing the primary Sequestosome-1 antibodies overnight at 4°C. Cells were then washed 3 x 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/ml for 1 hr at room temperature. Cells were washed 3 x 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).

Imaging was performed using a Zeiss LSM 880 laser scanning confocal microscope equipped with a Plan-Apo 40x oil objective (NA = 1.40). Analysis was done using ImageJ (RRID:SCR_003070). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.2.1) (RRID:SCR_014199) to adjust contrast and apply 1-pixel Gaussian blur, and then they were assembled with Adobe Illustrator (version 27.3.1) (RRID:SCR_010279).

Data availability

Underlying data

Zenodo: Antibody Characterization Report for Sequestosome-1, https://doi.org/10.5281/zenodo.4731001.¹³

Zenodo: Dataset for the Sequestosome-1 antibody screening study, https://doi.org/10.5281/zenodo.7709902.¹⁴

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Acknowledgments

We would like to thank the NeuroSGC/YCharOS/EDDU collaborative group for their important contribution to the creation of an open scientific ecosystem of antibody manufacturers and knockout cell line suppliers, for the development of community-agreed protocols, and for their shared ideas, resources, and collaboration. Members of the group can be found below.

NeuroSGC/YCharOS/EDDU collaborative group: Riham Ayoubi, Thomas M. Durcan, Aled M. Edwards, Carl Laflamme, Peter S. McPherson, Chetan Raina, Irina Shlaifer and Kathleen Southern.

An earlier version of this of this article can be found on Zenodo (doi: 10.5281/zenodo.4818440).

References

1. Turco E, Savova A, Gere F, et al.: Reconstitution defines the roles of p62, NBR1 and TAX1BP1 in ubiquitin condensate formation and autophagy initiation. Nat. Commun. 2021; 12(1): 5212. PubMed Abstract | Publisher Full Text | Free Full Text
2. Bjørkøy G, Lamark T, Brech A, et al.: p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 2005; 171(4): 603–614. PubMed Abstract | Publisher Full Text | Free Full Text
3. Clausen TH, Lamark T, Isakson P, et al.: p62/SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and their degradation by autophagy. Autophagy. 2010; 6(3): 330–344. PubMed Abstract | Publisher Full Text
4. Rea SL, Majcher V, Searle MS, et al.: SQSTM1 mutations--bridging Paget disease of bone and ALS/FTLD. Exp. Cell Res. 2014; 325(1): 27–37. PubMed Abstract | Publisher Full Text
5. Le Ber I, Camuzat A, Guerreiro R, et al.: SQSTM1 mutations in French patients with frontotemporal dementia or frontotemporal dementia with amyotrophic lateral sclerosis. JAMA Neurol. 2013; 70(11): 1403–1410. PubMed Abstract | Publisher Full Text
6. Ma S, Attarwala IY, Xie XQ: SQSTM1/p62: A Potential Target for Neurodegenerative Disease. ACS Chem. Neurosci. 2019; 10(5): 2094–2114. PubMed Abstract | Publisher Full Text | Free Full Text
7. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8: 8. Publisher Full Text
8. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text
9. Alshafie W, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for Moesin for use in Western Blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 2023(12): 172.
10. Wang M, Herrmann CJ, Simonovic M, et al.: Version 4.0 of PaxDb: Protein abundance data, integrated across model organisms, tissues, and cell-lines. Proteomics. 2015; 15(18): 3163–3168. PubMed Abstract | Publisher Full Text | Free Full Text
11. Nusinow DP, Szpyt J, Ghandi M, et al.: Quantitative Proteomics of the Cancer Cell Line Encyclopedia. Cell. 2020; 180(2): 387–402. e16. PubMed Abstract | Publisher Full Text | Free Full Text
12. Alshafie W, McPherson P, Laflamme C: Antibody screening by Immunofluorescence.2021.
13. Ayoubi R, Alshafie W, Shlaifer I, et al.: Antibody Characterization Report for Sequestosome-1. [Dataset]. Zenodo 2021.
14. Laflamme C: Dataset for the Sequestosome-1 antibody screening study. [Dataset]. Zenodo. 2023.
15. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text
16. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text
17. Ayoubi R, McPherson PS, Laflamme C: Antibody Screening by Immunoblot.2021.
18. Ayoubi R, Fotouhi M, McPherson P, et al.: Antibody screening by Immunoprecitation.2021.

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 23 Mar 2023

Author details Author details

Riham Ayoubi
Roles: Investigation, Methodology, Visualization, Writing – Review & Editing

Walaa Alshafie
Roles: Investigation, Methodology

Irina Shlaifer
Roles: Investigation, Writing – Review & Editing

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Peter S. McPherson
Roles: Conceptualization, Funding Acquisition, Resources, Supervision

Carl Laflamme
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Review & Editing

Competing interests

For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABclonal -Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems –Thermo Fisher Scientific.

Grant information

This work was supported in part by the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP is a private-public partnership created by the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). The Structural Genomics Consortium is a registered charity (no. 1097737) that receives funds from Bayer AG, Boehringer Ingelheim, Bristol Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda. RA and WA were supported by a Mitacs fellowship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (2)

version 2

Revised

Published: 10 Jul 2024, 12:324

https://doi.org/10.12688/f1000research.132628.2

version 1

Published: 23 Mar 2023, 12:324

https://doi.org/10.12688/f1000research.132628.1

© 2023 Ayoubi R et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Ayoubi R, Alshafie W, Shlaifer I et al. The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2023, 12:324 (https://doi.org/10.12688/f1000research.132628.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 23 Mar 2023

Views

Reviewer Report 21 Feb 2024

Guoqiang Xu, soochow university, Jiangsu, China

Approved with Reservations

https://doi.org/10.5256/f1000research.145562.r247595

This paper used the WT and Sequestosome-1 knockout U2OS cells to evaluate the quality of the anti-Sequestosome-1 antibodies obtained from different companies in three different applications, i.e. WB, IP, and IF. The results are very useful for other scientists to choose the right antibody for the specific application.

In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results.

For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding.

For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment.

A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: biochemistry, pharmacology, cancer biology, proteomics

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 10 Jul 2024

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

10 Jul 2024

Author Response

Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously ... Continue reading Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below.

In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results.
Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log₂ (TPM+1), which is significantly above the minimum threshold level, 2.5 log₂ (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI:10.21203/rs.3.pex-2607/v1). This reference has been included in the new version.

For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding.
Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested.

For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment.
Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902.

A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work.
Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1).
Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded.

That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation.
Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below.

In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results.
Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log₂ (TPM+1), which is significantly above the minimum threshold level, 2.5 log₂ (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI:10.21203/rs.3.pex-2607/v1). This reference has been included in the new version.

For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding.
Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested.

For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment.
Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902.

A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work.
Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1).
Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded.

That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 10 Jul 2024

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

10 Jul 2024

Author Response

Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously ... Continue reading Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below.

In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results.
Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log₂ (TPM+1), which is significantly above the minimum threshold level, 2.5 log₂ (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI:10.21203/rs.3.pex-2607/v1). This reference has been included in the new version.

For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding.
Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested.

For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment.
Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902.

A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work.
Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1).
Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded.

That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation.
Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below.

In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results.
Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log₂ (TPM+1), which is significantly above the minimum threshold level, 2.5 log₂ (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI:10.21203/rs.3.pex-2607/v1). This reference has been included in the new version.

For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding.
Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested.

For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment.
Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902.

A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work.
Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1).
Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded.

That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Views

Reviewer Report 21 Feb 2024

Yasukazu Takanezawa, Kitasato University, Tokyo, Japan

Approved

https://doi.org/10.5256/f1000research.145562.r247622

This paper delves into the intricacies of Western blot, immunoprecipitation, and immunofluorescence techniques utilizing commercially available antibodies targeting p62, particularly in the context of neurodegenerative disease pathogenesis. This paper provides valuable insights into the application of p62 antibodies. Additionally, incorporating ... Continue reading

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: As a specialist in toxicology, particularly focused on the interplay between autophagy and heavy metals.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 23 Mar 2023

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 2 (revision) 10 Jul 24		read
Version 1 23 Mar 23	read	read

Yasukazu Takanezawa, Kitasato University, Tokyo, Japan
Guoqiang Xu, soochow university, Jiangsu, China

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

2 Views

11 Jul 2024 | for Version 2

Guoqiang Xu, soochow university, Jiangsu, China

2 Views Cite this report Responses(0)

Approved

This is a useful resource although it is not perfect.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

biochemistry, pharmacology, cancer biology, proteomics

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

17 Views

21 Feb 2024 | for Version 1

Guoqiang Xu, soochow university, Jiangsu, China

17 Views Cite this report Responses(1)

Approved With Reservations

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

biochemistry, pharmacology, cancer biology, proteomics

Respond to this report

Responses (1)

Author Response

10 Jul 2024

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below.

In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results.
Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log₂ (TPM+1), which is significantly above the minimum threshold level, 2.5 log₂ (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI:10.21203/rs.3.pex-2607/v1). This reference has been included in the new version.

For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding.
Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested.

For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment.
Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902.

A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work.
Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1).
Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded.

That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation.

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

5 Views

21 Feb 2024 | for Version 1

Yasukazu Takanezawa, Kitasato University, Tokyo, Japan

5 Views Cite this report Responses(0)

Approved

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

As a specialist in toxicology, particularly focused on the interplay between autophagy and heavy metals.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Turco E, Savova A, Gere F, et al.: Reconstitution defines the roles of p62, NBR1 and TAX1BP1 in ubiquitin condensate formation and autophagy initiation. Nat. Commun. 2021; 12(1): 5212. PubMed Abstract | Publisher Full Text | Free Full Text

[2] 2. Bjørkøy G, Lamark T, Brech A, et al.: p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 2005; 171(4): 603–614. PubMed Abstract | Publisher Full Text | Free Full Text

[3] 3. Clausen TH, Lamark T, Isakson P, et al.: p62/SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and their degradation by autophagy. Autophagy. 2010; 6(3): 330–344. PubMed Abstract | Publisher Full Text

[4] 4. Rea SL, Majcher V, Searle MS, et al.: SQSTM1 mutations--bridging Paget disease of bone and ALS/FTLD. Exp. Cell Res. 2014; 325(1): 27–37. PubMed Abstract | Publisher Full Text

[5] 5. Le Ber I, Camuzat A, Guerreiro R, et al.: SQSTM1 mutations in French patients with frontotemporal dementia or frontotemporal dementia with amyotrophic lateral sclerosis. JAMA Neurol. 2013; 70(11): 1403–1410. PubMed Abstract | Publisher Full Text

[6] 6. Ma S, Attarwala IY, Xie XQ: SQSTM1/p62: A Potential Target for Neurodegenerative Disease. ACS Chem. Neurosci. 2019; 10(5): 2094–2114. PubMed Abstract | Publisher Full Text | Free Full Text

[7] 7. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8: 8. Publisher Full Text

[8] 8. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text

[9] 9. Alshafie W, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for Moesin for use in Western Blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 2023(12): 172.

[10] 10. Wang M, Herrmann CJ, Simonovic M, et al.: Version 4.0 of PaxDb: Protein abundance data, integrated across model organisms, tissues, and cell-lines. Proteomics. 2015; 15(18): 3163–3168. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. Nusinow DP, Szpyt J, Ghandi M, et al.: Quantitative Proteomics of the Cancer Cell Line Encyclopedia. Cell. 2020; 180(2): 387–402. e16. PubMed Abstract | Publisher Full Text | Free Full Text

[12] 12. Alshafie W, McPherson P, Laflamme C: Antibody screening by Immunofluorescence.2021.

[13] 13. Ayoubi R, Alshafie W, Shlaifer I, et al.: Antibody Characterization Report for Sequestosome-1. [Dataset]. Zenodo 2021.

[14] 14. Laflamme C: Dataset for the Sequestosome-1 antibody screening study. [Dataset]. Zenodo. 2023.

[15] 15. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text

[16] 16. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text

[17] 17. Ayoubi R, McPherson PS, Laflamme C: Antibody Screening by Immunoblot.2021.

[18] 18. Ayoubi R, Fotouhi M, McPherson P, et al.: Antibody screening by Immunoprecitation.2021.

The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence

Abstract

Keywords

Introduction

Results and discussion

Table 1. Summary of the cell lines used.

Figure 1. Sequestosome-1 antibody screening by Western blot.

Figure 2. Sequestosome-1 antibody screening by immunoprecipitation.

Figure 3. Sequestosome-1 antibody screening by immunofluorescence.

Methods

Antibodies

Table 2. Summary of the Sequestosome-1 antibodies tested.

CRISPR/Cas9 genome editing

Cell culture

Antibody screening by Western blot

Antibody screening by immunoprecipitation

Antibody screening by immunofluorescence

Data availability

Underlying data

Acknowledgments

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated