ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Data Note

The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence

[version 1; peer review: 1 approved, 1 approved with reservations]
PUBLISHED 23 Mar 2023
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the YCharOS (Antibody Characterization through Open Science) gateway.

This article is included in the Cell & Molecular Biology gateway.

Abstract

Sequestosome-1, encoded by the gene SQSTM1, functions as a bridge between ubiquitinated proteins and the proteasome or autophagosome, thereby regulating protein degradation pathways. Loss of Sequestosome-1 is hypothesized to enhance neurodegeneration progression in several diseases, including amyotrophic lateral sclerosis (ALS) and frontotemporal disorders (FTD). Sequestosome-1 reproducible research would be facilitated with the availability of well-characterized anti-Sequestosome-1 antibodies. In this study, we characterized seventeen Sequestosome-1 commercial antibodies for Western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs.

Keywords

Uniprot ID Q13501, SQSTM1, Sequestosome-1, antibody characterization, antibody validation, Western blot, immunoprecipitation, immunofluorescence

Introduction

Sequestosome-1, alternatively known as p62, is an adaptor protein required for selective autophagy and proteasomal degradation.13 Delivering polyubiquitinated proteins to the autophagosome or proteasome, Sequestosome-1/p62 plays a key role in the degradation of aggregate prone proteins.1

SQSTM1 gene mutations may act as a potential threat by causing altered autophagy, resulting in pathogenic protein aggregation and the development of a variety of neurodegenerative diseases, including ALS and FTD.4 Furthermore, SQSTM1 mutations have been identified in patients with ALS and FTD.5 Serving as a signalling hub for neurodegenerative pathways, Sequestosome-1/p62 poses as a prospective therapeutic target in the treatment of neurodegenerative diseases.6 Mechanistic studies would be greatly facilitated with the availability of high-quality antibodies.

Here, we compared the performance of a range of commercially available antibodies for Sequestosome-1 and validated high-performing antibodies for Western blot, immunoprecipitation and immunofluorescence, enabling biochemical and cellular assessment of Sequestosome-1 properties and function.

Results and discussion

Our standard protocol involves comparing readouts from wild-type (WT) and knockout (KO) cells.79 To identify a cell line that expresses adequate levels of Sequestosome-1 protein to provide sufficient signal to noise we examined public proteomics databases, namely PAXdb (RRID:SCR_018910)10 and DepMap (RRID:SCR_017655).11 U2OS was identified as a suitable cell line and thus U2OS was modified with CRISPR/Cas9 to knockout the corresponding SQSTM1 gene (Table 1).

Table 1. Summary of the cell lines used.

InstitutionRRID (Cellosaurus)Cell lineGenotype
Montreal Neurological InstituteCVCL_0042U2OSWT
Montreal Neurological InstituteCVCL_A6LPU2OSSQSTM1 KO

For Western blot experiments, we resolved proteins from WT and SQSTM1 KO cell extracts and probed them side-by-side with all antibodies in parallel8,9 (Figure 1).

5cf1672d-a5fe-4bfb-8a4e-4f8051734877_figure1.gif

Figure 1. Sequestosome-1 antibody screening by Western blot.

Lysates of U2OS (WT and SQSTM1 KO) were prepared and 25 μg of protein were processed for Western blot with the indicated Sequestosome-1 antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies MA5-32835*, 66184-1-Ig* and 18420-1-AP, which were titrated to 1/200, 1/1000 and 1/1000, respectively, as the signals were too weak when following the supplier’s recommendations. Antibody dilution used: GTX629890* at 1/1000; GTX629888* at 1/1000; GTX100685 at 1/1000; 701510** at 1/1000; 710539** at 1/200; MA5-32835* at 1/200; 66184-1-Ig* at 1/1000; 18420-1-AP at 1/1000; 55274-1-AP at 1/1000; NBP2-23490* at 1/1000; MAB80281** at 1/1000; MAB8028* at 1/1000; MAB8028R** at 1/1000; ab109012** at 1/10000; ab56416* at 1/1000; ab207305** at 1/1000; ab240635** at 1/1000. Predicted band size: ~62 kDa. *= monoclonal antibody, **= recombinant antibody.

For immunoprecipitation experiments, we used the antibodies to immunopurify Sequestosome-1 from U2OS cell extracts. The performance of each antibody was evaluated by detecting the Sequestosome-1 protein in extracts, in the immunodepleted extracts and in the immunoprecipitates8,9 (Figure 2).

5cf1672d-a5fe-4bfb-8a4e-4f8051734877_figure2.gif

Figure 2. Sequestosome-1 antibody screening by immunoprecipitation.

U2OS lysates were prepared, and IP was performed using 1.0 μg of the indicated Sequestosome-1 antibodies pre-coupled to protein G or protein A Sepharose beads. Samples were washed and processed for Western blot with the indicated Sequestosome-1 antibody. For Western blot, MAB80281** was used at 1/3000, 66184-1-lg* at 1/3000, ab56416* at 1/5000, ab207305** at 1/10000 and GTX629890* at 1/5000. The Ponceau stained transfers of each blot are shown for similar reasons as in Figure 1. SM= 10% starting material; UB=10% unbound fraction; IP=immunoprecipitate, HC= antibody heavy chain. *= monoclonal antibody, **= recombinant antibody.

For immunofluorescence, as described previously, antibodies were screened using a mosaic strategy.12 In brief, we plated WT and KO cells together in the same well and imaged both cell types in the same field of view to reduce staining, imaging and image analysis bias (Figure 3).

5cf1672d-a5fe-4bfb-8a4e-4f8051734877_figure3.gif

Figure 3. Sequestosome-1 antibody screening by immunofluorescence.

U2OS WT and SQSTM1 KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated Sequestosome-1 antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody. Acquisition of the green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of red (grayscale images) channel are shown. WT and KO cells are outlined with yellow and magenta dashed line, respectively. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies MA5-32835*, 18420-1-AP and NBP2-23490*, which were titrated to 1/2000, 1/300 and 1/1000, respectively, as the signals were too strong when following the supplier’s recommendations. When the concentration was not indicated by the supplier, we tested antibodies at 1/500 and 1/1000. At this concentration, the signal from each antibody was in the range of detection of the microscope used. Antibody dilution used: GTX629890* at 1/1000; GTX629888* at 1/1000; GTX100685 at 1/700; 701510** at 1/500; 710539** at 1/500; MA5-32835* at 1/2000; 66184-1-Ig* at 1/300; 18420-1-AP at 1/300; 55274-1-AP at 1/1300; NBP2-23490* at 1/1000; MAB80281** at 1/500; MAB8028* at 1/500; MAB8028R** at 1/500; ab109012** at 1/500; ab56416* at 1/1000; ab207305** at 1/200; ab240635** at 1/500. Bars = 10 μm. *= monoclonal antibody, **= recombinant antibody.

In conclusion, we have screened Sequestosome-1 commercial antibodies by Western blot, immunoprecipitation and immunofluorescence and characterized several high-quality antibodies under our standardized experimental conditions. The underlying data can be found on Zenodo.13,14

Methods

Antibodies

All Sequestosome-1 antibodies are listed in Table 2, together with their corresponding Research Resource Identifiers, or RRID, to ensure the antibodies are cited properly.15 Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-mouse and anti-rabbit secondary antibodies are from Thermo Fisher Scientific (cat. number A21424 and A21429).

Table 2. Summary of the Sequestosome-1 antibodies tested.

CompanyCatalog numberLot numberRRID (Antibody Registry)ClonalityClone IDHostConcentration (μg/μl)
GeneTexGTX629890*41470AB_2885144monoclonalGT1478mouse1.00
GeneTexGTX629888*41470AB_2885143monoclonalGT239mouse1.00
GeneTexGTX10068542893AB_2038029polyclonal-rabbit0.67
Thermo Fisher Scientific701510**2315239AB_2532489recombinant-mono11HC14LC25rabbit0.50
Thermo Fisher Scientific710539**RF229394AB_2532735recombinant-poly11HCLCrabbit0.50
Thermo Fisher ScientificMA5-32835*VL3152616AB_2802482monoclonal10-E10mouse2.00
Proteintech66184-1-Ig*not providedAB_2881579monoclonal1H5C1mouse1.33
Proteintech18420-1-APnot providedAB_10694431polyclonal-rabbit0.35
Proteintech55274-1-APnot providedAB_11182278polyclonal-rabbit0.43
Bio-TechneNBP2-23490*A-1AB_2885153monoclonal5H7E2mouse1.00
Bio-TechneMAB80281**CMRM0120031AB_2888658recombinant-mono2533brabbit0.50
Bio-TechneMAB8028*CHZL0520071AB_2885150monoclonal864807mouse0.50
Bio-TechneMAB8028R**CLJP0118091AB_2885151recombinant-mono864807Rmouse0.50
Abcamab109012**GR3241806-8AB_2810880recombinant-monoEPR4844rabbit0.43
Abcamab56416*GR3374761-2AB_945626monoclonalNot providedmouse1.00
Abcamab207305**GR323335-4AB_2885112recombinant-monoEPR18351rabbit0.21
Abcamab240635**GR3314160-2AB_2885121recombinant-monoEPR23101-103rabbit0.49

* = monoclonal antibody.

** = recombinant antibody.

CRISPR/Cas9 genome editing

SQSTM1 KO clone was generated in Cas9-expressing U2OS cell line7 with low passage cells using an open-access protocol available on Zenodo.org: https://zenodo.org/record/3875777#.ZA9VdC-96Tf. Two guide RNAs were used to introduce a STOP codon in the SQSTM1 gene (sequence guide 1: CCACCGCCCACCGUGUGCUC, sequence guide 2: AUGCGAGCUUGGUGUGCCCC).

Cell culture

Both U2OS WT and SQSTM1 KO cell lines used are listed in Table 1, together with their corresponding RRID, to ensure the cell lines are cited properly.16 Cells were cultured in DMEM high glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065), 100 IU penicillin and 100 μg/ml streptomycin (Wisent cat. number 450201).

Antibody screening by Western blot

Western blots were performed as described in our standard operating procedure.17 U2OS WT and SQSTM1 KO were collected in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1.0 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with protease inhibitor (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 x g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used.

Western blots were performed with large 4-15% polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau staining, which is scanned to show them together with individual Western blots. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4°C with 5% bovine serum albumin (BSA) (Wisent, cat. number 800-095) in TBS with 0.1% Tween 20 (TBST) (Cell Signaling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with regular ECL (cat. number 32106) or super signal West Femto (cat. number 34096) from Thermo Fisher Scientific prior to detection with the HyBlot CL autoradiography films from Denville (cat. number 1159T41).

Antibody screening by immunoprecipitation

Immunoprecipitation was performed as described in our standard operating procedure.18 Antibody-bead conjugates were prepared by adding 1.0 μg of antibody to 500 μl of phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL) with 0.01% triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) in a 1.5 mL microcentrifuge tube, together with 30 μl of protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) Sepharose beads. Tubes were rocked overnight at 4°C followed by several washes to remove unbound antibodies.

U2OS WT were collected in HEPES lysis buffer (20 mM HEPES, 100 mM sodium chloride, 1 mM EDTA, 1% Triton X-100, pH 7.4) supplemented with protease inhibitor (MilliporeSigma, cat. number P8340). Lysates were rocked 30 min at 4°C and spun at 110,000 x g for 15 min at 4°C. One ml aliquots at 1.0 mg/ml of lysate were incubated with an antibody-bead conjugate for ~2 hours at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of HEPES lysis buffer and processed for SDS-PAGE and Western blot on a 4-15% polyacrylamide gels as described above.

Antibody screening by immunofluorescence

Immunofluorescence was performed as described in our standard operating procedure.8,9,12 U2OS WT and SQSTM1 KO were labelled with a green and a deep red fluorescence dye from Abcam (cat. number ab176735 and ab176736), respectively. WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37°C, 5% CO2. Cells were fixed in 4% paraformaldehyde (PFA) (Beantown chemical, cat. number 140770-10ml) in PBS for 15 min at room temperature and then washed three times with PBS. Cells were permeabilized in PBS with 0.1% triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0.01% Triton X-100) containing the primary Sequestosome-1 antibodies overnight at 4°C. Cells were then washed 3 x 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/ml for 1 hr at room temperature. Cells were washed 3 x 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).

Imaging was performed using a Zeiss LSM 880 laser scanning confocal microscope equipped with a Plan-Apo 40x oil objective (NA = 1.40). Analysis was done using ImageJ (RRID:SCR_003070). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.2.1) (RRID:SCR_014199) to adjust contrast and apply 1-pixel Gaussian blur, and then they were assembled with Adobe Illustrator (version 27.3.1) (RRID:SCR_010279).

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 23 Mar 2023
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Ayoubi R, Alshafie W, Shlaifer I et al. The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2023, 12:324 (https://doi.org/10.12688/f1000research.132628.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 23 Mar 2023
Views
23
Cite
Reviewer Report 21 Feb 2024
Guoqiang Xu, soochow university, Jiangsu, China 
Approved with Reservations
VIEWS 23
This paper used the WT and Sequestosome-1 knockout U2OS cells to evaluate the quality of the anti-Sequestosome-1 antibodies obtained from different companies in three different applications, i.e. WB, IP, and IF.  The results are very useful for other scientists to ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Xu G. Reviewer Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2023, 12:324 (https://doi.org/10.5256/f1000research.145562.r247595)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 10 Jul 2024
    Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada
    10 Jul 2024
    Author Response
    Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 10 Jul 2024
    Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada
    10 Jul 2024
    Author Response
    Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously ... Continue reading
Views
8
Cite
Reviewer Report 21 Feb 2024
Yasukazu Takanezawa, Kitasato University, Tokyo, Japan 
Approved
VIEWS 8
This paper delves into the intricacies of Western blot, immunoprecipitation, and immunofluorescence techniques utilizing commercially available antibodies targeting p62, particularly in the context of neurodegenerative disease pathogenesis. This paper provides valuable insights into the application of p62 antibodies. Additionally, incorporating ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Takanezawa Y. Reviewer Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2023, 12:324 (https://doi.org/10.5256/f1000research.145562.r247622)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 23 Mar 2023
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.