Identification of high-performing antibodies for Superoxide dismutase [Cu-Zn] 1&nbsp;(SOD1) for use in Western blot, immunoprecipitation, and immunofluorescence

Riham Ayoubi; Walaa Alshafie; Zhipeng You; Kathleen Southern; Peter S. McPherson; Carl Laflamme

doi:10.12688/f1000research.132952.2

Home Browse Identification of high-performing antibodies for Superoxide dismutase...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Data Note

Revised

Identification of high-performing antibodies for Superoxide dismutase [Cu-Zn] 1 (SOD1) for use in Western blot, immunoprecipitation, and immunofluorescence

[version 2; peer review: 2 approved]

Previously titled: The identification of high-performing antibodies for Superoxide dismutase [Cu-Zn] 1 (SOD1) for use in Western blot, immunoprecipitation, and immunofluorescence

Riham Ayoubi¹, Walaa Alshafie¹, Zhipeng You², Kathleen Southern¹, Peter S. McPherson¹, Carl Laflamme ¹

Riham Ayoubi¹, Walaa Alshafie¹, [...] Zhipeng You², Kathleen Southern¹, Peter S. McPherson¹, Carl Laflamme ¹

PUBLISHED 31 Aug 2023

Author details Author details

¹ Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Québec, H34 2B4, Canada
² The Neuro’s Early Drug Discovery Unit (EDDU), Structural Genomics Consortium, McGill University, Montreal, Québec, H3A 2B4, Canada

Riham Ayoubi
Roles: Investigation, Visualization, Writing – Review & Editing

Walaa Alshafie
Roles: Investigation, Methodology

Zhipeng You
Roles: Investigation, Methodology

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Peter S. McPherson
Roles: Conceptualization, Funding Acquisition, Resources, Supervision

Carl Laflamme
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Cell & Molecular Biology gateway.

This article is included in the YCharOS (Antibody Characterization through Open Science) gateway.

Abstract

Superoxide dismutase [Cu-Zn] 1 (SOD1), is an antioxidant enzyme encoded by the gene SOD1, responsible for regulating oxidative stress levels by sequestering free radicals. Identified as the first gene with mutations in Amyotrophic lateral sclerosis (ALS), SOD1 is a determinant for studying diseases of aging and neurodegeneration. With guidance on well-characterized anti-SOD1 antibodies, the reproducibility of SOD1 research would be enhanced. In this study, we characterized eleven SOD1 commercial antibodies for Western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs.

Keywords

Uniprot ID P00441, SOD1, Superoxide dismutase [Cu-Zn], Superoxide dismutase 1, antibody characterization, antibody validation, Western blot, immunoprecipitation, immunofluorescence

Corresponding author: Carl Laflamme

Competing interests: For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABclonal -Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems –Thermo Fisher Scientific.

Grant information: This work was supported in part by the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP is a private-public partnership created by the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). The Structural Genomics Consortium is a registered charity (no. 1097737) that receives funds from Bayer AG, Boehringer Ingelheim, Bristol-Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda. RA and WA were supported by a Mitacs fellowship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2023 Ayoubi R et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Ayoubi R, Alshafie W, You Z et al. Identification of high-performing antibodies for Superoxide dismutase [Cu-Zn] 1 (SOD1) for use in Western blot, immunoprecipitation, and immunofluorescence [version 2; peer review: 2 approved]. F1000Research 2023, 12:391 (https://doi.org/10.12688/f1000research.132952.2) First published: 13 Apr 2023, 12:391 (https://doi.org/10.12688/f1000research.132952.1) Latest published: 31 Aug 2023, 12:391 (https://doi.org/10.12688/f1000research.132952.2)

Revised Amendments from Version 1

In this second version of the article, we have included a short paragraph to the Results and Discussion section to clarify that the authors do not score nor recommend antibodies and the reason why. We also provide the method used to quantify the HeLa lysates, which can be found in the Western blot methods. The title was also amended.

See the authors' detailed response to the review by Nishant N Vaikath

Introduction

Superoxide dismutase [Cu/Zn] 1 (SOD1) is an essential enzyme that protects the body against oxidative stress by acting as the first line of defense against reactive oxidative species.¹^,² Largely cytosolic but also found in the mitochondrial intermembrane space, SOD1 is a 153 amino acid protein functioning as a homodimer to bind copper and zinc in order to carry out its role in scavenging free radicals.³^,⁴

SOD1 was the first gene in which its mutations were identified in ALS over 30 years ago, predicting it to be a causative factor in motor neuron degeneration.⁵ A hallmark of SOD1-associated ALS is the misfolding and aggregation of SOD1 into neurotoxic species induced by gene mutations.⁶ The disease mechanism in which this occurs remains unknown.⁶ Mechanistic studies would be greatly facilitated with the availability of high-quality antibodies.

Here, we compared the performance of a range of commercially available antibodies for SOD1 and validated several antibodies for Western blot, immunoprecipitation and immunofluorescence, enabling biochemical and cellular assessment of SOD1 properties and function.

Results and discussion

Our standard protocol involved comparing readouts from wild-type (WT) and knockout (KO) cells.⁷^–⁹ To identify a cell line that expressed adequate levels of SOD1 protein to provide sufficient signal to noise, we examined public proteomics databases, namely PaxDB¹⁰ and DepMap.¹¹ HeLa was identified as a suitable cell line and thus HeLa was modified with CRISPR/Cas9 to knockout the corresponding SOD1 gene (Table 1).

Table 1. Summary of the cell lines used.

Institution	Catalog number	RRID (Cellosaurus)	Cell line	Genotype
ATCC	CCL-2	CVCL_0030	HeLa	WT
Montreal Neurological Institute	-	CVCL_A8PZ	HeLa	SOD1 KO

For Western blot experiments, we resolved proteins from WT and SOD1 KO cell extracts and probed them side-by-side with all antibodies in parallel⁸^,⁹ (Figure 1). SOD1 is an common essential gene¹² and the remaining SOD1 expression in the KO lysate could be detected with various antibodies.

Figure 1. SOD1 antibody screening by Western Blot.

Lysates of HeLa (WT and SOD1 KO) were prepared, and 20 μg of protein were processed for Western blot with the indicated SOD1 antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies ab51254^** and 10269-1-AP, which were titrated to 1/15000 and 1/1000, respectively, as the signals were too weak when following the supplier’s recommendations. Antibody dilution used: ab252426^** at 1/1000, ab51254^** at 1/15000, ab79390^** at 1/10000, MAB3418^* at 1/1000, GTX100554 at 1/1000, GTX100659 at 1/1000, 10269-1-AP at 1/1000, 67480-1-Ig^* at 1/10000, 702783^** at 1/200, 711818^** at 1/200, MA1-105^* at 1/1000. Predicted band size: 16 kDa. *= monoclonal antibody, **= recombinant antibody.

For immunoprecipitation experiments, we used the antibodies to immunopurify SOD1 from HeLa cell extracts. The performance of each antibody was evaluated by detecting the SOD1 protein in extracts, in the immunodepleted extracts and in the immunoprecipitates⁸^,⁹ (Figure 2).

Figure 2. SOD1 antibody screening by immunoprecipitation.

HeLa lysates were prepared, and IP was performed using 2.0 μg of the indicated SOD1 antibodies pre-coupled to protein G or protein A Sepharose beads. Samples were washed and processed for Western blot with the indicated SOD1 antibody. For Western blot, MAB3418^* was used at 1/1000, 67480-1-Ig^* at 1/1000, 10269-1-AP at 1/2000, MA1-105^* at 1/2000, ab79390^** at 1/15000 and GTX100554 at 1/2000. The Ponceau stained transfers of each blot are shown for similar reasons as in Figure 1. SM=10% starting material; UB=10% unbound fraction; IP=immunoprecipitate; *= monoclonal antibody; **= recombinant antibody.

For immunofluorescence, as described previously, antibodies were screened using a mosaic strategy.¹³ In brief, we plated WT and KO cells together in the same well and imaged both cell types in the same field of view to reduce staining, imaging and image analysis bias (Figure 3).

Figure 3. SOD1 antibody screening by immunofluorescence.

HeLa WT and SOD1 KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated SOD1 antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody. Acquisition of the green (identification of WT cells), red (antibody staining) and far-red (identification of KO cells) channels was performed. Representative images of the red (grayscale) channel are shown. WT and KO cells are outlined with yellow and magenta dashed line, respectively. Antibody dilutions were chosen according to the recommendations of the antibody supplier. An exception was given for antibody 10269-1-AP, which was titrated to 1/500, as the signal was too weak when following the supplier’s recommendations. When the concentration was not indicated by the supplier, which was the case for ab252426^**, GTX100554, GTX100659, 702783^**, 711818^** and MA1-105*, we tested antibodies at 1/200, 1/500 or 1/1000. At these concentrations, the signal from each antibody was in the range of detection of the microscope used. Antibody dilution used: ab252426^** at 1/500, ab51254^** at 1/200, ab79390^** at 1/200, MAB3418^* at 1/500, GTX100554 at 1/200, GTX100659 at 1/500, 10269-1-AP at 1/500, 67480-1-Ig^* at 1/500, 702783^** at 1/500, 711818^** at 1/500, MA1-105^* at 1/1000. Bars = 10 μm. *= monoclonal antibody; **= recombinant antibody.

In conclusion, we have screened SOD1 commercial antibodies by Western blot, immunoprecipitation and immunofluorescence and identified several high-quality antibodies under our standardized experimental conditions. Under our standardized experimental conditions, several high-quality antibodies were identified, however, the authors do not engage in result analysis or offer explicit antibody recommendations. A limitation of this study is the use of universal protocols - any conclusions remain relevant within the confines of the experimental setup and cell line used in this study. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs.

The underlying data can be found on Zenodo.¹⁴^,¹⁵

Methods

Antibodies

All SOD1 antibodies are listed in Table 2, together with their corresponding Research Resource Identifiers, or RRID, to ensure the antibodies are cited properly.¹⁶ Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-mouse and anti-rabbit secondary antibodies are from Thermo Fisher Scientific (cat. number A21424 and A21429).

Table 2. Summary of the SOD1 antibodies tested.

Company	Catalog number	Lot number	RRID (Antibody Registry)	Clonality	Clone ID	Host	Concentration (μg/μL)	Vendors recommended applications
Abcam	ab252426**	GR3334282-1	AB_2885125	recombinant-mono	EPR23549-163	rabbit	0.48	Wb, IP, IF
Abcam	ab51254**	GR3231443-1	AB_882757	recombinant-mono	EP1727Y	rabbit	0.15	Wb, IF
Abcam	ab79390**	GR221266-10	AB_1603741	recombinant-mono	EPR1726	rabbit	0.18	Wb
Bio-Techne	MAB3418*	XJQ0216121	AB_2193899	monoclonal	348808	mouse	0.50	Wb, IF
GeneTex	GTX100554	43222	AB_10618670	polyclonal	-	rabbit	0.15	Wb, IF
GeneTex	GTX100659	41822	AB_1951972	polyclonal	-	rabbit	0.47	Wb, IF
Proteintech	10269-1-AP	00069112	AB_2193750	polyclonal	-	rabbit	0.43	Wb, IP, IF
Proteintech	67480-1-Ig*	10014544	AB_2882707	monoclonal	2F10G1	mouse	0.50	Wb
Thermo Fisher Scientific	702783**	2107589	AB_2716893	recombinant-mono	11H3L1	rabbit	0.50	Wb, IF
Thermo Fisher Scientific	711818**	SH256097	AB_2688303	recombinant-poly	-	rabbit	0.50	Wb, IF
Thermo Fisher Scientific	MA1-105*	VL315171	AB_2536811	monoclonal	8B10	mouse	1.00	Wb, IF

Wb=Western blot; IF= immunofluorescence; IP=immunoprecipitation;

* = monoclonal antibody;

** = recombinant antibody.

CRISPR/Cas9 genome editing

HeLa SOD1 KO clone was generated with low passage cells using an open-access protocol available on Zenodo. Two guide RNAs were used to introduce a STOP codon in the SOD1 gene (sequence guide 1: CCGTTGCAGTCCTCGGAACC, sequence guide 2: GCGCGGGGGGACGAGCGGGT).

Cell culture

Both HeLa WT and SOD1 KO cell lines used are listed in Table 1, together with their corresponding RRID, to ensure the cell lines are cited properly.¹⁷ Cells were cultured in DMEM high-glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065), 100 IU penicillin and 100 μg/mL streptomycin (Wisent cat. number 450201).

Antibody screening by Western Blot

Western blots were performed as described in our standard operating procedure.¹⁸ HeLa WT and SOD1 KO were collected in RIPA buffer (50 mM Tris-HCl pH 8.0, 150mM NaCl, 1.0 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with 1x protease inhibitor cocktail mix (MilliporeSigma, cat. number 78429). Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 x g for 15 min at 4°C. To quantify the HeLa cell lysates, a BCA protein assay kit (Thermo Fisher Scientific, cat. number 23225) was used to measure protein concentration. Once the concentration was determined, equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western blot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.

Western blots were performed with large 8-16% polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual Western blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4°C with 5% bovine serum albumin (BSA) (Wisent, cat. number 800-095) in TBS with 0,1% Tween 20 (TBST) (Cell Signaling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/mL in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) prior to detection with the HyBlot CL autoradiography films (Denville, cat. number 1159T41).

Antibody screening by immunoprecipitation

Immunoprecipitation was performed as described in our standard operating procedure.¹⁹ Antibody-bead conjugates were prepared by 2.0 μg of antibody to 500 μL of phosphate-buffered saline (PBS) (Wisent, cat. number 311-010-CL) with 0,01% triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) in a 1.5 mL microcentrifuge tube, together with 30 μL of protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) Sepharose beads. Tubes were rocked overnight at 4°C followed by two washes to remove unbound antibodies.

HeLa WT were collected in HEPES lysis buffer (20 mM HEPES, 100 mM sodium chloride, 1 mM EDTA, 1% Triton X-100, pH 7.4) supplemented with protease inhibitor. Lysates were rocked 30 min at 4°C and spun at 110,000 x g for 15 min at 4°C. One mL aliquots at 0.5 mg/mL of lysate were incubated with an antibody-bead conjugate for ~2 hours at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of HEPES lysis buffer and processed for SDS-PAGE and Western blot on 8-16% polyacrylamide gels, as described above. Prot-A:HRP (MilliporeSigma, cat. number P8651) and VeriBlot for IP Detection Reagent HRP (Abcam, cat. number ab131366) were used as secondary detection systems for an experiment where a rabbit antibody was used for both immunoprecipitation and its corresponding Western blot. Similarly, anti- mouse IgG for IP HRP (Abcam, cat. number ab131368) was used for an experiment where a mouse antibody was used for immunoprecipitation and it’s corresponding Western blot.

Antibody screening by immunofluorescence

Immunofluorescence was performed as described in our standard operating procedure.⁸^,⁹^,¹³ HeLa WT and SOD1 KO were labelled with a green and a far-red fluorescence dye, respectively. The fluorescent dyes used are from Thermo Fisher Scientific (cat. number C2925 and C34565). WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37 ^oC, 5% CO₂. Cells were fixed in 4% paraformaldehyde (PFA) (Beantown chemical, cat. number 140770-10ml) in PBS for 15 min at room temperature and then washed 3 times with PBS. Cells were permeabilized in PBS with 0,1% Triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary SOD1 antibodies overnight at 4 °C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/mL for 1 hr at room temperature. Cells were washed 3 × 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).

Imaging was performed using a Zeiss LSM 880 laser scanning confocal microscope equipped with a Plan-Apo 40x oil objective (NA = 1.40). Analysis was done using the Zen navigation software (Zeiss). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.1.2) to adjust contrast then assembled with Adobe Illustrator (version 27.3.1).

Data availability

Underlying data

Zenodo: Antibody Characterization Report for Superoxide Dismutase [Cu-Zn] (SOD1), https://doi.org/10.5281/zenodo.5061103.¹⁴

Zenodo: Dataset for the Superoxide Dismutase 1 Cu-Zn (SOD1) antibody screening study, https://doi.org/10.5281/zenodo.7709943.¹⁵

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Acknowledgment

We would like to thank the NeuroSGC/YCharOS/EDDU collaborative group for their important contribution to the creation of an open scientific ecosystem of antibody manufacturers and knockout cell line suppliers, for the development of community-agreed protocols, and for their shared ideas, resources and collaboration. Members of the group can be found below.

NeuroSGC/YCharOS/EDDU collaborative group: Riham Ayoubi, Thomas M. Durcan, Aled M. Edwards, Carl Laflamme, Peter S. McPherson, Chetan Raina, Kathleen Southern and Zhipeng You

An earlier version of this of this article can be found on Zenodo (doi:10.5281/zenodo.5061103).

References

1. Kangralkar V, Patil SD, Bandivadekar R: Oxidative stress and diabetes: a review. Int. J. Pharm. Appl. 2010; 1(1): 38–45.
2. Landis GN, Tower J: Superoxide dismutase evolution and life span regulation. Mech. Ageing Dev. 2005; 126(3): 365–379. PubMed Abstract | Publisher Full Text
3. Kim J, Lee H, Lee JH, et al.: Dimerization, oligomerization, and aggregation of human amyotrophic lateral sclerosis copper/zinc superoxide dismutase 1 protein mutant forms in live cells. J. Biol. Chem. 2014; 289(21): 15094–15103. PubMed Abstract | Publisher Full Text | Free Full Text
4. Okado-Matsumoto A, Fridovich I: Subcellular distribution of superoxide dismutases (SOD) in rat liver: Cu,Zn-SOD in mitochondria. J. Biol. Chem. 2001; 276(42): 38388–38393. PubMed Abstract | Publisher Full Text
5. Rosen DR: Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature. 1993; 364(6435): 362. Publisher Full Text
6. McAlary L, Aquilina JA, Yerbury JJ: Susceptibility of Mutant SOD1 to Form a Destabilized Monomer Predicts Cellular Aggregation and Toxicity but Not in vitro Aggregation Propensity. Front. Neurosci. 2016; 10: 499. PubMed Abstract
7. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8: 8. Publisher Full Text
8. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text
9. Alshafie W, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for Moesin for use in Western Blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 172. Publisher Full Text
10. Wang M, Herrmann CJ, Simonovic M, et al.: Version 4.0 of PaxDb: Protein abundance data, integrated across model organisms, tissues, and cell-lines. Proteomics. 2015; 15(18): 3163–3168. PubMed Abstract | Publisher Full Text | Free Full Text
11. Nusinow DP, Szpyt J, Ghandi M, et al.: Quantitative Proteomics of the Cancer Cell Line Encyclopedia. Cell. 2020; 180(2): 387–402.e16. PubMed Abstract | Publisher Full Text | Free Full Text
12. DepMap, Broad: DepMap 19Q3 Public ed.2019.
13. Alshafie W, McPherson P, Laflamme C: Antibody screening by Immunofluorescence.2021.
14. Ayoubi R, Alshafie W, You Z, et al.: Antibody Characterization Report for Superoxide dismutase [Cu/Zn] (SOD1).2021.
15. Laflamme C: Dataset for Superoxide dismutase 1Cu/Zn (SOD1) antibody screening study. [Data set]. Zenodo. 2023.
16. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text
17. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text
18. Ayoubi R, McPherson PS, Laflamme C: Antibody Screening by Immunoblot.2021.
19. Ayoubi R, Fotouhi M, McPherson P, et al.: Antibody screening by Immunoprecitation.2021.

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 13 Apr 2023

Author details Author details

Riham Ayoubi
Roles: Investigation, Visualization, Writing – Review & Editing

Walaa Alshafie
Roles: Investigation, Methodology

Zhipeng You
Roles: Investigation, Methodology

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Peter S. McPherson
Roles: Conceptualization, Funding Acquisition, Resources, Supervision

Carl Laflamme
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Review & Editing

Competing interests

For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABclonal -Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems –Thermo Fisher Scientific.

Grant information

This work was supported in part by the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP is a private-public partnership created by the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). The Structural Genomics Consortium is a registered charity (no. 1097737) that receives funds from Bayer AG, Boehringer Ingelheim, Bristol-Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda. RA and WA were supported by a Mitacs fellowship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (2)

version 2

Revised

Published: 31 Aug 2023, 12:391

https://doi.org/10.12688/f1000research.132952.2

version 1

Published: 13 Apr 2023, 12:391

https://doi.org/10.12688/f1000research.132952.1

© 2023 Ayoubi R et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Ayoubi R, Alshafie W, You Z et al. Identification of high-performing antibodies for Superoxide dismutase [Cu-Zn] 1 (SOD1) for use in Western blot, immunoprecipitation, and immunofluorescence [version 2; peer review: 2 approved]. F1000Research 2023, 12:391 (https://doi.org/10.12688/f1000research.132952.2)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 2

VERSION 2

PUBLISHED 31 Aug 2023

Revised

Views

Reviewer Report 17 Oct 2023

Chi Kwan Tsang, Clinical Neuroscience Institute, The First Affiliated Hospital of Jinan University, Guangzhou, China

Approved

https://doi.org/10.5256/f1000research.155278.r214146

In this Data Note, Ayoubi et al. tested eleven commercially available SOD1 antibodies in WT and CRISPR/Cas9-mediated knockout HeLa cells. They presented a comprehensive comparisons among these antibodies in Western blot, immunoprecipitation, and immunofluorescence staining using a well-defined experimental protocols. They identified some high-performing antibodies which seem to be appropriate for these experiments while a few other of them failed to produce satisfactory results. This report should be useful for readers who plan to perform the above experiments for selection of suitable antibodies.

In general, the report was well-written and a few comments and recommendation are listed below:

Please carefully check the whole text for typos, e.g. “… an common …”; “An earlier version of this of this article…”.
In the reference section, it may be better to add the ULR links for the papers. For example, they may add “https://zenodo.org/record/5717516/files/2021-11-21-SOP-IP.pdf?download=1” to ref#19. Same for references #13, 14, 15, 18.
In the first paragraph of the Introduction, the authors mentioned that Sod1 is largely cytosolic but also found in the mitochondrial intermembrane space…”. Sod1 is also present in the nucleus. Please add the citation below and clarify this point.
Tsang CK, Liu, Y., Thomas, J., Zhang, Y., Zheng, X.F. (2014) Superoxide dismutase 1 acts as a nuclear transcription factor to regulate oxidative stress resistance. Nature Communications 5, 3446.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

References

1. Tsang CK, Liu Y, Thomas J, Zhang Y, et al.: Superoxide dismutase 1 acts as a nuclear transcription factor to regulate oxidative stress resistance.Nat Commun. 2014; 5: 3446 PubMed Abstract | Publisher Full Text

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Molecular and Cellular Biology, Molecular Neuroscience, CNS diseases, Stroke.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Respond or Comment

Views

Reviewer Report 07 Sep 2023

Nishant N Vaikath, Neurological Disorder Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University, Doha, Doha, Qatar

Approved

https://doi.org/10.5256/f1000research.155278.r202703

Thank you for the revised manuscript. I ... Continue reading

CITE

Report a concern

Respond or Comment

Version 1

VERSION 1

PUBLISHED 13 Apr 2023

Views

Reviewer Report 18 Aug 2023

Nishant N Vaikath, Neurological Disorder Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University, Doha, Doha, Qatar

Approved with Reservations

https://doi.org/10.5256/f1000research.145911.r186895

In this study, Ayoubi et al, have characterized commercially available SOD1 antibodies for use in biochemical techniques, including Western Blotting, Immunoprecipitation, and Immunofluorescence, utilizing lysates from knockout cell lines and isogenic parental controls. The aim was to identify high-performing antibodies suitable for specific applications. While the authors have screened and compared the antibodies using different applications, there are some areas that require improvement, as outlined below:

Quantification of HeLa lysates: The authors need to provide information on how the HeLa lysates were quantified. Adding details about the quantification method will enhance the reroducibility and accuracy of the results.
Elaboration of the results section: The results section needs to be more detailed and informative. Currently, it lacks clarity regarding the outcomes for each technique and the identification of the best-suited antibodies for each application.
Table of tested antibodies: To facilitate better understanding for readers, the authors should consider providing a table that lists the antibodies tested along with the techniques they were evaluated in. This table could highlight which antibodies performed best for each technique, making it easier for researchers to identify suitable antibodies for their experiments.

By addressing these minor comments and enhancing the results section, the study's findings will become more accessible and beneficial to the scientific community.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Neuroscience, Antibody development, Antibody engineering, Nanobody

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 19 Oct 2023

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H34 2B4, Canada

19 Oct 2023

Author Response

Thank you to Nishant N Vaikath for reviewing this article and providing a peer-review report.
To respond to your first suggestion, we have added a short description of the quantification ... Continue reading Thank you to Nishant N Vaikath for reviewing this article and providing a peer-review report.
To respond to your first suggestion, we have added a short description of the quantification method used. Please review the Western Blot methods section of the second version of the article we have uploaded.
As for your second and third points, YCharOs does not engage in result analysis nor do we offer explicit antibody recommendations. The primary goal of our initiative is to deliver high-quality antibody validation data to the scientific community. We have found that, for the most part, scientists viewing our articles have the expertise to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Recognizing the potential ambiguity of this point within the article, we have taken proactive measures to rectify the situation. As such, a new paragraph has been added to the Results and Discussion section, explaining our reasonings as to why we do not recommend or score the antibodies tested.
Thank you again for your suggestions, we always appreciate feedback on how to improve the reproducibility of our data. After reviewing the second version of the article, newly submitted, we hope that you chose to reconsider your approval status.
Thank you to Nishant N Vaikath for reviewing this article and providing a peer-review report.
To respond to your first suggestion, we have added a short description of the quantification method used. Please review the Western Blot methods section of the second version of the article we have uploaded.
As for your second and third points, YCharOs does not engage in result analysis nor do we offer explicit antibody recommendations. The primary goal of our initiative is to deliver high-quality antibody validation data to the scientific community. We have found that, for the most part, scientists viewing our articles have the expertise to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Recognizing the potential ambiguity of this point within the article, we have taken proactive measures to rectify the situation. As such, a new paragraph has been added to the Results and Discussion section, explaining our reasonings as to why we do not recommend or score the antibodies tested.
Thank you again for your suggestions, we always appreciate feedback on how to improve the reproducibility of our data. After reviewing the second version of the article, newly submitted, we hope that you chose to reconsider your approval status.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 19 Oct 2023

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H34 2B4, Canada

19 Oct 2023

Author Response

Thank you to Nishant N Vaikath for reviewing this article and providing a peer-review report.
To respond to your first suggestion, we have added a short description of the quantification ... Continue reading Thank you to Nishant N Vaikath for reviewing this article and providing a peer-review report.
To respond to your first suggestion, we have added a short description of the quantification method used. Please review the Western Blot methods section of the second version of the article we have uploaded.
As for your second and third points, YCharOs does not engage in result analysis nor do we offer explicit antibody recommendations. The primary goal of our initiative is to deliver high-quality antibody validation data to the scientific community. We have found that, for the most part, scientists viewing our articles have the expertise to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Recognizing the potential ambiguity of this point within the article, we have taken proactive measures to rectify the situation. As such, a new paragraph has been added to the Results and Discussion section, explaining our reasonings as to why we do not recommend or score the antibodies tested.
Thank you again for your suggestions, we always appreciate feedback on how to improve the reproducibility of our data. After reviewing the second version of the article, newly submitted, we hope that you chose to reconsider your approval status.
Thank you to Nishant N Vaikath for reviewing this article and providing a peer-review report.
To respond to your first suggestion, we have added a short description of the quantification method used. Please review the Western Blot methods section of the second version of the article we have uploaded.
As for your second and third points, YCharOs does not engage in result analysis nor do we offer explicit antibody recommendations. The primary goal of our initiative is to deliver high-quality antibody validation data to the scientific community. We have found that, for the most part, scientists viewing our articles have the expertise to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Recognizing the potential ambiguity of this point within the article, we have taken proactive measures to rectify the situation. As such, a new paragraph has been added to the Results and Discussion section, explaining our reasonings as to why we do not recommend or score the antibodies tested.
Thank you again for your suggestions, we always appreciate feedback on how to improve the reproducibility of our data. After reviewing the second version of the article, newly submitted, we hope that you chose to reconsider your approval status.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 13 Apr 2023

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 2 (revision) 31 Aug 23	read	read
Version 1 13 Apr 23	read

Nishant N Vaikath, Hamad Bin Khalifa University, Doha, Qatar
Chi Kwan Tsang, The First Affiliated Hospital of Jinan University, Guangzhou, China

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

10 Views

17 Oct 2023 | for Version 2

Chi Kwan Tsang, Clinical Neuroscience Institute, The First Affiliated Hospital of Jinan University, Guangzhou, China

10 Views Cite this report Responses(0)

Approved

Please carefully check the whole text for typos, e.g. “… an common …”; “An earlier version of this of this article…”.
In the reference section, it may be better to add the ULR links for the papers. For example, they may add “https://zenodo.org/record/5717516/files/2021-11-21-SOP-IP.pdf?download=1” to ref#19. Same for references #13, 14, 15, 18.
In the first paragraph of the Introduction, the authors mentioned that Sod1 is largely cytosolic but also found in the mitochondrial intermembrane space…”. Sod1 is also present in the nucleus. Please add the citation below and clarify this point.
Tsang CK, Liu, Y., Thomas, J., Zhang, Y., Zheng, X.F. (2014) Superoxide dismutase 1 acts as a nuclear transcription factor to regulate oxidative stress resistance. Nature Communications 5, 3446.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

References

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Molecular and Cellular Biology, Molecular Neuroscience, CNS diseases, Stroke.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

7 Views

07 Sep 2023 | for Version 2

Nishant N Vaikath, Neurological Disorder Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University, Doha, Doha, Qatar

7 Views Cite this report Responses(0)

Approved

Thank you for the revised manuscript. I have no further comments to make.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Neuroscience, Antibody development, Antibody engineering, Nanobody

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

22 Views

18 Aug 2023 | for Version 1

Nishant N Vaikath, Neurological Disorder Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University, Doha, Doha, Qatar

22 Views Cite this report Responses(1)

Approved With Reservations

Quantification of HeLa lysates: The authors need to provide information on how the HeLa lysates were quantified. Adding details about the quantification method will enhance the reroducibility and accuracy of the results.
Elaboration of the results section: The results section needs to be more detailed and informative. Currently, it lacks clarity regarding the outcomes for each technique and the identification of the best-suited antibodies for each application.
Table of tested antibodies: To facilitate better understanding for readers, the authors should consider providing a table that lists the antibodies tested along with the techniques they were evaluated in. This table could highlight which antibodies performed best for each technique, making it easier for researchers to identify suitable antibodies for their experiments.

By addressing these minor comments and enhancing the results section, the study's findings will become more accessible and beneficial to the scientific community.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Neuroscience, Antibody development, Antibody engineering, Nanobody

Respond to this report

Responses (1)

Author Response

19 Oct 2023

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H34 2B4, Canada

Thank you to Nishant N Vaikath for reviewing this article and providing a peer-review report.
To respond to your first suggestion, we have added a short description of the quantification method used. Please review the Western Blot methods section of the second version of the article we have uploaded.
As for your second and third points, YCharOs does not engage in result analysis nor do we offer explicit antibody recommendations. The primary goal of our initiative is to deliver high-quality antibody validation data to the scientific community. We have found that, for the most part, scientists viewing our articles have the expertise to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Recognizing the potential ambiguity of this point within the article, we have taken proactive measures to rectify the situation. As such, a new paragraph has been added to the Results and Discussion section, explaining our reasonings as to why we do not recommend or score the antibodies tested.
Thank you again for your suggestions, we always appreciate feedback on how to improve the reproducibility of our data. After reviewing the second version of the article, newly submitted, we hope that you chose to reconsider your approval status.

View more View less

Competing Interests

No competing interests were disclosed.

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Kangralkar V, Patil SD, Bandivadekar R: Oxidative stress and diabetes: a review. Int. J. Pharm. Appl. 2010; 1(1): 38–45.

[2] 2. Landis GN, Tower J: Superoxide dismutase evolution and life span regulation. Mech. Ageing Dev. 2005; 126(3): 365–379. PubMed Abstract | Publisher Full Text

[3] 3. Kim J, Lee H, Lee JH, et al.: Dimerization, oligomerization, and aggregation of human amyotrophic lateral sclerosis copper/zinc superoxide dismutase 1 protein mutant forms in live cells. J. Biol. Chem. 2014; 289(21): 15094–15103. PubMed Abstract | Publisher Full Text | Free Full Text

[4] 4. Okado-Matsumoto A, Fridovich I: Subcellular distribution of superoxide dismutases (SOD) in rat liver: Cu,Zn-SOD in mitochondria. J. Biol. Chem. 2001; 276(42): 38388–38393. PubMed Abstract | Publisher Full Text

[5] 5. Rosen DR: Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature. 1993; 364(6435): 362. Publisher Full Text

[6] 6. McAlary L, Aquilina JA, Yerbury JJ: Susceptibility of Mutant SOD1 to Form a Destabilized Monomer Predicts Cellular Aggregation and Toxicity but Not in vitro Aggregation Propensity. Front. Neurosci. 2016; 10: 499. PubMed Abstract

[7] 7. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8: 8. Publisher Full Text

[8] 8. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text

[9] 9. Alshafie W, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for Moesin for use in Western Blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 172. Publisher Full Text

[10] 10. Wang M, Herrmann CJ, Simonovic M, et al.: Version 4.0 of PaxDb: Protein abundance data, integrated across model organisms, tissues, and cell-lines. Proteomics. 2015; 15(18): 3163–3168. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. Nusinow DP, Szpyt J, Ghandi M, et al.: Quantitative Proteomics of the Cancer Cell Line Encyclopedia. Cell. 2020; 180(2): 387–402.e16. PubMed Abstract | Publisher Full Text | Free Full Text

[12] 12. DepMap, Broad: DepMap 19Q3 Public ed.2019.

[13] 13. Alshafie W, McPherson P, Laflamme C: Antibody screening by Immunofluorescence.2021.

[14] 14. Ayoubi R, Alshafie W, You Z, et al.: Antibody Characterization Report for Superoxide dismutase [Cu/Zn] (SOD1).2021.

[15] 15. Laflamme C: Dataset for Superoxide dismutase 1Cu/Zn (SOD1) antibody screening study. [Data set]. Zenodo. 2023.

[16] 16. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text

[17] 17. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text

[18] 18. Ayoubi R, McPherson PS, Laflamme C: Antibody Screening by Immunoblot.2021.

[19] 19. Ayoubi R, Fotouhi M, McPherson P, et al.: Antibody screening by Immunoprecitation.2021.

Identification of high-performing antibodies for Superoxide dismutase [Cu-Zn] 1 (SOD1) for use in Western blot, immunoprecipitation, and immunofluorescence

Abstract

Keywords

Revised Amendments from Version 1

Introduction

Results and discussion

Table 1. Summary of the cell lines used.

Figure 1. SOD1 antibody screening by Western Blot.

Figure 2. SOD1 antibody screening by immunoprecipitation.

Figure 3. SOD1 antibody screening by immunofluorescence.

Methods

Antibodies

Table 2. Summary of the SOD1 antibodies tested.

CRISPR/Cas9 genome editing

Cell culture

Antibody screening by Western Blot

Antibody screening by immunoprecipitation

Antibody screening by immunofluorescence

Data availability

Underlying data

Acknowledgment

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated