Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis

Dedi Ardinata; Novita Sari Harahap; Nenni Dwi Aprianti Lubis; Tetty Aman Nasution

doi:10.12688/f1000research.133517.3

Home Browse Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Revised

Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis

[version 3; peer review: 2 approved, 1 approved with reservations]

Previously titled: Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis

Dedi Ardinata ¹, Novita Sari Harahap², Nenni Dwi Aprianti Lubis³, Tetty Aman Nasution⁴

PUBLISHED 08 May 2024

Author details Author details

¹ Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia
² Department of Sport Science, Faculty of Sport Science, Universitas Negeri Medan, Medan, North Sumatra, Indonesia
³ Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia
⁴ Department of Microbiology, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia

Dedi Ardinata
Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing

Novita Sari Harahap
Roles: Data Curation, Formal Analysis, Funding Acquisition, Methodology, Project Administration, Resources

Nenni Dwi Aprianti Lubis
Roles: Data Curation, Funding Acquisition, Investigation, Methodology, Project Administration, Validation, Writing – Review & Editing

Tetty Aman Nasution
Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Validation, Writing – Original Draft Preparation, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Genomics and Genetics gateway.

Abstract

Background

Relationship age, hemoglobin, and physical frailty have all been investigated in older people with more than one chronic disease. There has been little analysis of the relationship between hemoglobin, age, physical frailty, plasma levels of Sirtuin1 (SIRT1), and the gene polymorphism (SNP) rs7895833 A>G. The goal of this study was to find out how SIRT1 level, SNP rs7895833, hemoglobin, age, and physical frailty (frail score) are related in older Indonesian adults with comorbid chronic diseases.

Methods

This was an observational study. Demographic and clinical data were retrieved from the electronic health records of Universitas Sumatera Utara Hospital, Medan, Indonesia. Physical frailty, SIRT1 level, and SNP rs7895833 were measured using an appropriate and valid method. Purposive sampling was used to determine the eligibility of 132 elderly adults from November 2022 to February 2023.

Results

The indirect effect of hemoglobin on the frail score (FS) through age was negative and significant, according to a conditional mediation analysis (β=-0.0731; p=0.023). Meanwhile, the direct effect of hemoglobin on the FS was negative and not significant (β=0.1632; p=0.052). According to the conditional moderated mediation analysis, the size of the direct effect of age on FS was increased by genotype AG-GG and SIRT1 level (βlow=0.2647; p=0.002, βmiddle=0.2956; p<0.001, and βhigh=0.319; p<0.001). The size of the conditional indirect effect of Hemoglobin on FS through age was negative and significantly increased by SNP genotype AG-GG and SIRT1 level (βlow=-0.0647; p=0.032, βmiddle=-0.0723; p=0.024, and βhigh=-0.078; p=0.02).

Conclusions

Higher plasma levels of SIRT1 and the SNP genotype AG-GG may both contribute to physical frailty in the elderly population. Hemoglobin levels in the blood fall with age, which can negatively impact older persons who already have chronic diseases. However, the interactions between these factors are intricate, requiring more study to completely understand the processes underlying development.

Keywords

Hemoglobin, physical frailty, SIRT1 expression, SNP rs7895833, moderated mediation analysis.

Corresponding author: Dedi Ardinata

Competing interests: No competing interests were disclosed.

Grant information: This study was funded by the Universitas Sumatera Utara through the TALENTA scheme 2022 with contract No. 335/UN5.2.3.1/PPM/KP-TALENTA/2022.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2024 Ardinata D et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Ardinata D, Sari Harahap N, Lubis NDA and Nasution TA. Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations]. F1000Research 2024, 12:510 (https://doi.org/10.12688/f1000research.133517.3) First published: 17 May 2023, 12:510 (https://doi.org/10.12688/f1000research.133517.1) Latest published: 08 May 2024, 12:510 (https://doi.org/10.12688/f1000research.133517.3)

Revised Amendments from Version 2

We acknowledge the importance of analyzing the impact of comorbidities and individual BMI scores on the relationships studied. However, due to the high prevalence of multiple comorbidities in our study population and the relatively small sample size in each subgroup, we were unable to conduct these analyses. This limitation has been added to the revised manuscript.
Regarding the rs7895833 SNP, we have included information about its biological impacts in the background section. However, a thorough literature search did not yield specific data on the population distribution of this SNP in Indonesia and North Sumatra, highlighting a gap in current knowledge and the need for future research to investigate the prevalence and potential effects of this genetic variation in these populations.
We also recognize the importance of exploring subjects' lifestyle factors, such as routine exercise and diet, which may influence plasma SIRT1 levels. Unfortunately, we did not collect detailed data on these factors, limiting our ability to analyze their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study.
Despite these limitations, we believe that our core conclusions remain valid. However, we agree that addressing these factors could further improve our introduction, method, and discussion sections, particularly in terms of the study's limitations. We appreciate the reviewer's valuable input and hope that our responses adequately address their concerns.

See the authors' detailed response to the review by Made Putra Semadhi
See the authors' detailed response to the review by Amit Singh

Introduction

Frailty has a yearly incidence rate of 4.34%, with a global prevalence rate of 13.6% among older adults.¹ In Indonesia, however, the number of people aged 60 and older was 18.1 million in 2010, representing 7.6% and is projected to rise to 33.7 million by 2025 and 48.2 million by 2035.²

Among older adult residents, it has been shown that the prevalence of multimorbidity is between 55 and 98%, anemia was within 19 and 76%, and frailty is around 70 and 93%.³^–⁵ According to the literature, older adults who have more chronic diseases are more vulnerable to the risk developing anemia.⁶ Anemia and frailty in older adults were found to be correlated, according to a systematic review and meta-analysis of observational studies.⁷ Some cross-sectional studies indicate a relationship between older adults’ frailty and hemoglobin levels.⁸^,⁹ The following hypothesis is therefore proposed: Hypothesis 1 (H1): Hemoglobin is negatively related to FS.

The aging process or the presence of comorbidities are associated to the development of frailty.¹⁰ Frailty and age-related chronic diseases are not only often associated, but one increases the risk of the other, suggesting a bidirectional association between frailty and comorbidity aging-related disorders.¹¹^,¹² The pathobiology of aging relates chronic disease, multimorbidity, and frailty, and this knowledge provides criteria for diagnosis and management approaches.¹³ Able to follow is the hypothesis: Hypothesis 2 (H2): Age is positively related to FS.

Hemoglobin is a protein found in red blood cells that carries oxygen throughout the body.¹⁴ Low hemoglobin levels, known as anemia, are a common condition in older adults and can be caused by a variety of factors, including nutritional deficiencies, chronic diseases, and medications¹⁵ which can lead to a decrease in physical function and an increased risk of frailty. Age is a major risk factor for physical frailty¹⁶^,¹⁷ which is defined as a state of decreased physiological reserve and increased vulnerability to stressors.¹⁸ As people age, they may experience declines in muscle mass and strength, balance and coordination, and cardiovascular and respiratory function, which can contribute to physical frailty.¹⁹ Based on the preceding considerations, the following hypothesis is proposed: Hypothesis 3 (H3): Age mediates the relationship between hemoglobin and FS.

Previous studies have indicated that the SIRT1 SNP rs7895833 is located in the promoter region of the SIRT1 gene, about 21kb upstream of the coding region.²⁰ Its location in the promoter suggests that it could influence SIRT1 gene expression levels. Altered SIRT1 levels caused by the SNP could dysregulate these processes and lead to much worse health outcomes, including chronic obstructive pulmonary disease,²¹ cardiovascular diseases,²² oxidative stress,²³ essential hypertension and type 2 diabetes mellitus,²⁴ coronary artery disease,²⁵ rheumatoid arthritis,²⁶ dyslipidaemia,²⁷ metabolic syndrome,²⁸ rheumatoid arthritis,²⁹ and neurodegenerative disease.³⁰ There was limited research on the specific interaction between SIRT1 SNP rs7895833, hemoglobin, age, and physical frailty. However, it is possible that these factors may be related to each other through various biological pathways.

SIRT1 has been related to both frailty and deteriorating health outcomes. However, other investigations have produced inconsistent results. Using Fried’s criteria, there was no consistent correlation between SIRT1 and frailty in older people living in the community,³¹ and there was no correlation between frailty and serum-induced SIRT1 expression.³² Participants in the lowest quintile had a lower likelihood of being weak, but serum-induced SIRT1 expression was not related to age or mortality.³³ Kumar et al., found frail people’s serum sirtuin levels (SIRT1 and SIRT3) were much lower than those of non-frail persons.³⁴ Frail older adults had higher levels of SIRT1 than robust older adults.³⁵

Even though the relationship of age, hemoglobin, and frailty in older adults has been studied, there is currently limited studies on the association of these three variables with plasma levels of SIRT1 and the SNP genotype rs7895833 in elderly adults with chronic disease comorbidity. As a consequence, we come to the following hypothesis: Hypothesis 4 (H4): SNP genotype AG-GG and plasma levels of SIRT1 negatively moderates the effect of hemoglobin on FS through age as a mediator.

The purpose of this study was to investigate the effects of plasma levels of SIRT1 and the SIRT1 SNP rs7895833 A>G in the promoter region on the relationship between hemoglobin, age, and frailty in Indonesian older adults with chronic diseases comorbid.

Methods

This study follows ‘A Guideline for Reporting Mediation Analyses of Randomized Trials and Observational Studies (AGReMA)³⁶ and The Strengthening the Reporting of Observational studies in Epidemiology (STROBE).³⁷

We conducted observational (cohort) studies of the moderated mediation analyses to find any potential causal effects. The mediator role of age in the association between hemoglobin level and frail scale score is explained by plasma levels of SIRT1 and the NSP rs7895833 genotype serving as moderating variables.

The study included 132 older adults who were scheduled to receive outpatient care at the Universitas Sumatera Utara Hospital in Medan, Indonesia, and who met the study criteria: men and women over the age of 60 with a complete electronic health record of laboratory and clinical data, as well as having chronic diseases one year prior. There are no mental or physical disorders that are interfering with their capacity to respond to questionnaire questions. A purposive sampling approach was used to choose the study subjects. The sample size was determined using the following formula³⁸:

n = \frac{{Z_{1 - α ∕ 2}}^{2} p (1 - p)}{d^{2}}

Z_1-α/2²/22 (type I error 5%)=1.96, expected proportion in population based on previous studies (p)=18.7%,³⁹ absolute error/precision (d)=0.05.

Measurements

Sociodemographic, clinical, and laboratory data

We used sociodemographic, clinical, and laboratory data results from an electronic health record database after clinical diagnoses were determined for each subject one year ago.

Frailty assessment

The physical frailty phenotype was assessed that used the frailty scale score. During face-to-face interviews with the patients, trained nursing staff used the Indonesian version of the FRAIL scale, which has been proven to be a reliable and valid screening tool for frailty syndrome assessment.⁴⁰ The FRAIL scale (FS) consists of five components: fatigue, resistance, ambulation, sickness, and weight loss. The FRAIL scale scores range from 0 to 5 (one point for each component; 0 represents best to 5 represents worst) and indicate robust (0), pre-frail (1 to 2), frail (3 to 5). The physical frailty phenotype was also treated as a continuous variable, ranging from 0 to 5, in the study.

Blood sampling

Blood samples were collected from each subject in line with approved protocols. Subjects were instructed to fast for at least 8 hours before blood collection, which took place between 8:00 and 10:00 a.m. Professional phlebotomists collected 2 mL of blood in tubes containing EDTA using a predefined method.

Blood processing and DNA isolation

The collected blood samples were immediately processed for plasma separation. Plasma samples were aliquoted and stored at -80°C until analysis. Genomic DNA was extracted from the residual white blood cells using a DNA isolation kit (Wizard^®, Madison, USA, A1120) and the manufacturer’s instructions. All pure DNA samples were kept at 2-8°C until PCR was used for SIRT1 genotyping.

SIRT1 assay

The plasma levels of SIRT1 was determined by a monoclonal antibody-based ELISA method using a commercially available human SIRT1 ELISA kit (Elabscience^®, Houston, USA, E-EL-H1546). Microtiter plates were coated with an antibody specific to human SIRT1. 100 μL standard and plasma samples were pipetted into the appropriate wells, and the protocol was followed by using a secondary antibody and then avidin conjugated horseradish peroxidase. The formation of horseradish peroxidase was measured using ELISA reader (Thermo Fisher Scientific, Finland) at 450 nm. Seven different concentrations of purified SIRT1 (20, 10, 5, 2.500, 1.250, 0.630, and 0.31 ng/mL) were used to plot a standard curve. The inter- and intra-assay coefficients of variation were 4.04% and 4.55% respectively, with a detection range of 0.31–20 ng/mL.

Determination of SIRT1 gene polymorphisms

The single nucleotide polymorphism (SNP) rs7895833 was selected because it is one of the most frequent polymorphisms in the SIRT1 gene, and has been associated frailty and several diseases.

SIRT1 rs7895833 A>G in the promoter region⁴¹ were analysed using polymerase chain reactions with two-pair primers (PCR-CTPP) assay with minor modifications.⁴² The SIRT1 gene encompassing rs7895833 A>G, polymorphic sites were amplified by PCR using the primers.⁴¹ Briefly, 25 ml total PCR mixtures containing 100–200 ng DNA, 10.0 pmol of each primers, 1.0 mM dNTP (deoxynucleotide triphosphates), 25 mM MgCl2 and 2.5U Taq DNA polymerase in the supplied reaction buffer (Taq Buffer with (NH₄)₂SO₄) were prepared. PCR was performed with the primers were the following:

Forward primer 1: CCCAGGGTTCAACAAATCTATGTTG

Forward primer 2: CCCAGGGTTCAACAAATCTATGTTG

Reverse primer 1: GCTTCCTAATCTCCATTACGTTGAC

Reverse primer 2: CCTCCCAGTCAACGACTTTATC

with the initial denaturation at 95°C for 10 min.; 30 cycles of 95°C for 1 min., 64°C for rs7895833 A>G polymorphism, PCR products were visualized on a 2% agarose gel with ethidium bromide staining and genotyped. The genotypes for polymorphism were defined by 3 distinct banding patterns (Figure 1); for rs7895833 AG polymorphism: 320, 241 bp for AA genotype; 320, 241 and 136 bp for AG genotype; and 320, 136 bp for GG genotype.⁴¹

Figure 1. SIRT1 SNP rs7895833 A>G representative PCR gel electrophoresis images.

Statistical evaluation

Hardy–Weinberg equilibrium tests were performed with Hardy-Weinberg Equilibrium online calculator.

All statistical analyses were carried out using statistical tool jamovi ver.2.3. and the significance was set at p<0.05 (two-tail). Descriptive statistics were used to examine all of the subject’s characteristics. Normally distributed variables were reported using means and standard deviations, while non-normally distributed ones were summarized with medians and ranges. Qualitative variables were described using the numbers of events and frequencies.

The correlation plot (Qgraph) created with jamovi’s seolmatrix. This module was used to determine how the potential major variables interacted with one another.⁴³

The jAMM GLM Mediation Model was used to analysis the conditional process. The conditional process analysis to determine how much more the mechanism(s) by which an effect operates is conditional on or varies depending on the nature, environment, stimulus, or individual variations.⁴⁴ Mediation and moderation could be integrated analytically as a conditional process model in a variety of ways, depending on which step of the mediation process is moderated, the number of mediators, the number of moderators, and whether or not the direct effect is likewise moderated.⁴⁵

Mediating effect

An analysis of mediation was investigated to assess if age mediated the relation between hemoglobin level and frail score. This model was used to determine if hemoglobin and frail score had a considerable indirect influence. When mediator variables are included, the direct effect is diminished but still statistically significant; this effect is known as “partial mediation”. Complete mediation shows that the direct effect is no longer significant when mediator variables have been included.⁴⁶

Moderating effect

A subgroup evaluation was carried in the multiple-mediation model to see whether there was a moderating effect on simple pathways. It was considered that the existence of the moderation effect in this path was shown by the statistically significant difference in the path coefficient between the two variables.⁴⁷

Moderated mediation

Testing for mediation effects in each subgroup will lead in a biased estimated parameter and low statistical power, in accordance with Edwards’ hypothesis. The estimated parameters, including the total, indirect, and direct effects of the moderated mediation model, were conducted by integrating moderation and mediation models. Subgrouping analysis was solely used to test which path the moderator affected.⁴⁸^,⁴⁹

Before testing all mediational hypotheses, conditional process analysis depicting all interactions was developed using the general linear mediation model (i.e., the GLM mediation model) with factor coding “dummies” for genotypes AA=0 and AG-GG = 1 and covariates scaling “standardized” for hemoglobin level and plasma levels of SIRT1. A standard (delta method) procedure that leverages the approximation from the central limit theorem⁵⁰ was used to test the significance of the total and indirect effects, and the coefficient confidence intervals were deemed statistically significant if they did not include zero.

Ethical considerations

This study was authorized by the Universitas Sumatera Utara Health Ethical Committee under the number 1097/KEPK/USU/2022. Each participant completed a structured questionnaire after signing informed consent, which included questions about their demographics, level of physical frailty (Frail scale), and willingness to submit a blood sample. The Declaration of Helsinki ethical principles were followed during the study’s conduction.

Results

Hardy–Weinberg equilibrium tests

The genotypic frequencies of the SNP rs7895833 A>G in the SIRT1 gene were not in accordance with those expected by Hardy-Weinberg equilibrium in the current investigation, confirming a previous study.⁵¹ We looked at several possibilities: first, we evaluated the possibility of recruiting bias. Second, faults in the real-time PCR genotyping experiment. In each batch, however, proper controls were applied, and the probes used were definitely capable of discriminating between genotypes. Third, the Hardy-Weinberg departure occurred by chance since the observed and expected genotype frequency variations were minimal.

Characteristics of the study’s subjects

This study included 132 eligible subjects. More than half of the participants were female (51.5%). The median age was 65 (range: 60 to 85), and the FS was 1 (range: 0 to 3). Meanwhile, the mean hemoglobin level was 12.35 (±1.8) mg/dL, and the plasma SIRT1 level was 57.1 (±32.3) ng/ml. Table 1 shows the study subjects’ detailed characteristics.

Table 1. Demographic, clinical and genotype characteristics of elderly adults with multimorbid (n=132).

Characteristics		Characteristics
Age (year)	65 (60-85)^a	Comorbidities
Sex (Female)	68 (51.5)^b	Diabetes mellitus	82 (62.12)^b
Frail score	1 (0-3)^a	Cardiovascular disease	81 (61.36)^b
%BMI loss 1 year	2.06 (-12.2 – 24.6)^a	Hypertension	58 (43.94)^b
Sirtuin1 plasma level (ng/ml)	57.1 (32.3)^c	Arthritis	49 (37.12)^b
Systolic Blood Pressure (mmHg)	138.5 (21.7)^c	Stroke	35 (26.52)^b
Diastolic Blood Pressure (mmHg)	75.13 (10.81)^c	Chronic lung disease	23 (17.42)^b
Hemoglobin (g/dL)	12.35 (1.8)^c	Chronic kidney disease	17 (12.88)^b
Fasting blood glucose (mg/dL)	120 (83 – 420)^a	Cancer	7 (5.30)^b
HbA1c (%)	7.95 (2.49)^c	Genotype rs7895833
Total cholesterol (mg/dL)	195.18 (43.89)^c	AA	16 (12.1)^b
Triglyceride (mg/dL)	132 (53 – 669)^a	AG	79 (59.8)^b
High-density lipoprotein (mg/dL)	45 (20-445)^a	GG	37 (28.0)^b
Low-density lipoprotein (mg/dL)	133.74 (42.19)^c	AG-GG	116 (87.9)^b
Blood urea nitrogen (mg/dL)	20.3 (5.9 – 114.5)^a	AA-AG	95 (72.0)^b
Creatinine (mg/dL)	0.9 (0.1 – 15.1)^a	Allele rs7895833
		A	111 (42.05)^b
		G	153 (57.95)^b

a Median (min–max).

b n (%).

c Mean (±SD).

The interrelationship between the potential main variables

There was a negative relationship between hemoglobin levels and FS (r=-0.236, p=0.006). The age yielded similar results (r=-0.259, p=0.003). Meanwhile, age was also shown to have a significant positive association with FS (r=0.325, p=0.006) but a negative correlation with SIRT1 (r=-0.192, p=0.027). There were no statistically significant correlations or relationships detected between the SNP genotypes AA, AG-GG and any of the covariates (Figure 2).

Figure 2. The correlation plot of the interrelationship between the potential main variables.

Hb (Hemoglobin); SIRT1 (Sirtuin1); Frail score (frailty); genotype (AA, AG-GG). Spearman's rank correlation with two tail significant: *p<0.05, **p<0.01, ***p<0.001.

Hypothesis testing

According to Baron and Kenny’s⁴⁷ criterion, there are three conditions for the existence of mediating role: 1) there is a significant correlation between independent variable (hemoglobin) and dependent variable (physical frailty); 2) there is a significant correlation between independent variable (hemoglobin) and mediating variables (age); 3) finally, the regression coefficients of independent variables (hemoglobin) and mediating variable (age) are simultaneously regressed to the dependent variable (physical frailty), the coefficient of mediator should be significant and the coefficient of independent variable become non-significant (complete mediation) or reduced (partial mediation).

Figure 2 depicts them in accordance with the partial correlation’s results. It can be seen that hemoglobin and FS had a moderately strong negative relationship (r=-0.236, p=0.006), and that age and FS had a moderately strong positive relationship (r=0.325, p<0.001). Therefore, the first and second conditions are satisfied. Hence, H1 and H2 were accepted.

The mediating effect of age

Mediation analyses for direct effects, indirect mediation by age, and total effects are provided in Figure 3A and Table 2. When age was included in the model, the following occurred: The direct effect of hemoglobin on FS was negative and non-significant (β=-0.1632, p=0.052). The indirect effect or indirect mediation of hemoglobin on FS was negative and significant (β=-0.0731, p=0.023) and the total effect was negative and significant (β=-0.2363, p=0.005). As a consequence, we may conclude that age completely mediates the negative relationship between hemoglobin and FS, with a significant model mediation effect of 13% (R²=0.13, p=0.001, F=9.68). As a result, H3 was accepted. This result reveals that lower hemoglobin levels may lead to physical frailty and that this effect was totally influenced by the increasing age of an elderly adult with comorbid chronic diseases.

Figure 3. A conceptual diagram that shows hypothesized interactions between variables study; (A) Mediation model, (B) Moderated mediation model with two moderators.

Table 2. The mediation effect of age between hemoglobin and frail score.

Age	ab	a	b	c’	c
	-0.0731; 0.023	-0.2587; 0.002	0.2828; <0.001	-0.1632; 0.052	-0.2363; 0.005
Full model effect	R²	F	p
	0.13	3.43	0.004

Moderated mediation relationship

The moderated mediation model was then put to the test. The SNP genotypes (AA and AG-GG) and SIRT1 were integrated into this model (Figure 3B and Table 3). Conditional moderated mediation was assessed at levels of SIRT1 of 25% (low), 50% (middle), and 75% (high) and SNP genotypes of AA and AG-GG. We noted the following: The size of the conditional direct effect of age on FS was moderately positive and significantly increased by SNP genotypes AA and SIRT1 level (β_middle=0.1828, p=0.034 and β_high=0.2087, p=0.015). Whereas by genotype AG-GG and SIRT1 level (β_low=0.2647, p=0.002, β_middle=0.2956, p<0.001, and β_high=0.319, p<0.001). The size of the conditional direct effect of hemoglobin on FS was moderately negative but non-significant by SNP genotypes AA, AG-GG, and all SIRT1 levels. The size of the conditional indirect effect of hemoglobin on FS through age was moderately negative and significantly increased by SNP genotypes AG-GG and SIRT1 level (β_low=0.2647, p=0.002, β_middle=0.2956, p<0.001, and β_high=0.319, p<0.001). The total effect was negative and significant (β=-0.2246, p=0.008). such that the conditional negative indirect effect of hemoglobin on FS completely through age becomes stronger when the SNP genotype was AG-GG and levels of SIRT1 increase (moderated mediation). The SNP genotype and SIRT1 have a 14.1% moderated mediation effect (R²=0.141, p=0.004, F=3.43) Therefore, H4 was accepted. The study may have found that individuals with the AG-GG genotype and higher levels of SIRT1 may experience a stronger negative indirect effect of hemoglobin on physical frailty, compared to individuals with the AA genotype and lower levels of SIRT1. According to these analyses, decreased hemoglobin levels can lead to physical frailty, and this effect is completely mediated by age, through the SNP genotype AG-GG and elevated SIRT1 levels in elderly adults with comorbid chronic diseases.

Table 3. The moderation effects of SNP genotypes AA, AG-GG, and SIRT1 between hemoglobin and frail score through age as mediation variables.

Genotype * SIRT1	ab	a	b	c’	c
AA * 25%	-0.0364; 0.137	-0.2444: 0.003	0.149; 0.085	-0.1633; 0.063	-0.2246: 0.008
AA * 50%	-0.0447; 0.085	-0.2444: 0.003	0.1828; 0.034	-0.163; 0.064	-0.2246: 0.008
AA * 75%	-0.051; 0.061	-0.2444: 0.003	0.2087; 0.015	-0.1625; 0.064	-0.2246: 0.008
AG-GG * 25%	-0.0647; 0.032	-0.2444: 0.003	0.2647; 0.002	-0.1608; 0.055	-0.2246: 0.008
AG-GG * 50%	-0.0723; 0.024	-0.2444: 0.003	0.2956; <0.001	-0.1594; 0.058	-0.2246: 0.008
AG-GG * 75%	-0.078; 0.02	-0.2444: 0.003	0.319; <0.001	-0.1581; 0.061	-0.2246: 0.008
Full model effect	R²	F	p
	0.141	3.43	0.004

Discussion

In terms of physical frailty, the current research was conducted in a moderated-moderated mediation or conditional moderated mediation relationship. Hypotheses have been created based on the conceptual model in Figure 1 and the findings of prior studies. The findings supported each of the research hypotheses. The model provided the five variables that supported our conceptual model.

A recent study revealed that the relationship between low hemoglobin levels and physical frailty in older adults with one or more chronic diseases was affected by the age.

Age is a major risk factor for physical frailty,¹⁶^,¹⁷ which is defined as a state of decreased physiological reserve and increased vulnerability to stressors.¹⁸ As people age, they may experience declines in muscle mass and strength, balance and coordination, and cardiovascular and respiratory function, which can contribute to physical frailty.¹⁹

Low hemoglobin levels, also called anemia, is a condition in which the number of red blood cells or the amount of hemoglobin in the blood drops. This usually happens in older adults. Causes of anemia in older adults include nutritional deficiency, chronic kidney disease, chronic inflammation, and occult blood loss from gastrointestinal malignancy, although in many patients the aetiology were unknown.⁸^,⁵²^–⁵⁴ Previous studies have shown that the prevalence of physical frailty increases with age, and that low hemoglobin levels are also more common in older adults.⁵³^,⁵⁵ In addition, there is evidence to suggest that low hemoglobin levels are a risk factor for physical frailty, as anemia can lead to reduced physical function and decreased muscle mass.

According to the study, low hemoglobin levels and physical frailty were related. Age completely mediated the effect of low hemoglobin levels on physical frailty, indicating that the relationship between these two variables was only significant when age was excluded. This study further showed that age completely mediated this effect and that SNP genotype AG-GG and high SIRT1 levels further moderated this effect in elderly adults with comorbid chronic diseases. This showed that the following two factors, including the existence of comorbid chronic diseases and a specific genetic variant (AG-GG) of SNP SIRT1, further moderated the relation between low hemoglobin levels and physical frailty. The correlation between low hemoglobin levels and physical frailty, in particular, may have depended on the levels of SIRT1, a protein involved in cellular metabolism, among older adults with comorbid chronic diseases and the AG-GG genotype.

There was a complex interaction between hemoglobin levels, physical frailty, age, and genetic factors that could have big effects on older people with chronic conditions. The blood contained the important protein hemoglobin, which was responsible for carrying oxygen from the lungs to the body’s tissues and organs.⁵⁶ Decreased hemoglobin levels can lead to anemia, which can cause fatigue, weakness, and physical frailty.

Physical frailty is a common concern for elderly people, and it is a complex condition affected by several factors, including age, chronic diseases, life styles, and heredity. Studies have shown that elderly adults, particularly those with chronic diseases, who have low hemoglobin levels are more plausible to become physically frail.⁵⁷^–⁵⁹

Furthermore, genetic factors may contribute to the development of physical frailty in elderly adults. The SIRT1 SNP rs7895833 A>G is closely associated with an increased risk of developing chronic diseases., such as cardiovascular disease,²²^,²⁵ chronic obstructive pulmonary disease,²¹ Parkinson’s disease,⁶⁰ type 2 diabetes mellitus,⁶¹ rheumatoid arthritis.²⁹ These chronic diseases can contribute to the development of physical frailty in elderly adults by reducing muscle mass, strength, and function¹¹^,⁶² and also anemia.⁶³

SIRT1, a protein that protects cells from oxidative stress, controls glucose and lipid metabolism, and increases DNA integrity by binding to and deacetylating numerous substrates, may also have a role in physical frailty.⁶⁴^,⁶⁵ SIRT1 is regarded to be one of the potential molecules for promoting healthy aging because of its protective activities against numerous age-related diseases. Some studies have suggested that SIRT1 levels decrease with age; according to several studies, SIRT1 has been studied for its potential role in aging and age-related diseases.²³^,⁶⁶^,⁶⁷ Additionally, it is well known that it alters skeletal muscle metabolism and function, two major considerations in physical frailty.

There were few studies on the role of SIRT1 in iron metabolism related anaemia of chronic disease or anaemia of inflammation that decreases plasma iron with suppression of erythropoiesis. A study showed that activating SIRT1 can reduce iron accumulation in splenic macrophages by inhibiting hepcidin.⁶⁸ This suggests that SIRT1 may inhibit ferroptosis by reducing intracellular iron levels. Another study showed that Intestinal SIRT1 deficiency improved iron metabolism in ethanol-induced liver injury in mice, reducing ferroptosis in hepatocytes.⁶⁹

There are still not many studies that show what role the SNP rs7895833 A>G, especially genotype AG-GG, plays in the activity of SIRT1 in older adults. The patients with the wild-type (AA) genotype had a significantly higher level of SIRT1 protein and a significantly lower level of endothelial nitric oxide synthase (eNOS) expression. Patients with the heterozygote mutant (AG) genotype also had a significantly higher level of SIRT1 protein, but eNOS expression was not significantly different.²² Kilic et al., who observed that older people carrying both the wild-type (AA) genotype and the heterozygote (AG) genotype had significantly higher SIRT1 expression levels in plasma, while older people carrying the heterozygote mutant (AG) genotype had a significantly higher SIRT1 level compared with older people carrying the wild-type (AA) genotype.²³

As was already mentioned, the NSP rs7895833 A>G affects the expression of the SIRT1 gene. It can impact the expression of the SIRT1 gene because it is located in the promoter region, 21 kb upstream of the gene. Thus, the activity of SIRT1 appears to be regulated by a promoter-dependent change in expression mechanism, which may have an impact on the elderly’s metabolism or the progression of neurological disease. Chromatin and transcription are regulated by SIRT1, linking NAD+ signaling and metabolism to the regulation of cellular activities.⁷⁰

Limitations

This study has established moderated mediation analysis among the drivers of physical frailty in elderly adults with comorbid chronic diseases, but it is not without limitations. Some limitations of the present study should be noted: The study used an observational (cohort) design and studied only elderly individuals from a university hospital, which may constitute a selection bias, meaning that we may not have been able to establish a causal relationship between the variables of interest. Another constraint of the study is the sample size, which was insufficient to detect all associations with the other studied variables and could limit the generalizability of the results. Other factors, such as multi-comorbidity, BMI, lifestyle habits (including routine exercise, diet, etc.), environmental factors, and medications, could have influenced the results, and we may not have accounted for these variables. However, our findings are supported by previously published literature; several studies with probabilistic samples and a greater number of individuals reported changes in physical frailty in relation to hemoglobin, age, the polymorphism rs7895833, involving genotype AG-GG, and plasma SIRT1 levels.

Conclusion

The present study emphasizes the nuanced interaction of biological variables, especially SIRT1 plasma levels, NSP rs7895833 genotype, and age, in influencing physical frailty in elderly people with chronic diseases. Our findings suggests that SIRT1 levels and genotype modify the effect of age on frailty.

Data availability

Underlying data

Figshare: Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. A moderated mediation analysis, https://doi.org/10.6084/m9.figshare.22492603.v2.⁷¹

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Acknowledgments

We would like to thank all the patients and Laboratory staffs in an integrated laboratory faculty of Medicine, Universitas Sumatera Utara and Universitas Sumatera Utara Hospital who participated in the study.

References

1. Ofori-Asenso R, Chin KL, Mazidi M, et al.: Global Incidence of Frailty and Prefrailty among Community-Dwelling Older Adults: A Systematic Review and Meta-analysis. JAMA Netw. Open. 2019; 2(8): e198398. PubMed Abstract | Publisher Full Text | Free Full Text
2. Adioetomo SM: Indonesia on the Threshold of Population Ageing. Indonesia: UNFPA; 2014; 65(632).
3. Barnett K, Mercer SW, Norbury M, et al.: Epidemiology of multimorbidity and implications for health care, research, and medical education: A cross-sectional study. Lancet. 2012; 380(9836): 37–43. Publisher Full Text
4. Biritwum RB, Minicuci N, Yawson AE, et al.: Prevalence of and factors associated with frailty and disability in older adults from China, Ghana, India, Mexico, Russia and South Africa. Maturitas. 2016; 91: 8–18. PubMed Abstract | Publisher Full Text
5. Kojima G: Prevalence of Frailty in Nursing Homes: A Systematic Review and Meta-Analysis. J. Am. Med. Dir. Assoc. 2015; 16: 940–945. PubMed Abstract | Publisher Full Text
6. Gandhi SJ, Hagans I, Nathan K, et al.: Prevalence, Comorbidity and Investigation of Anemia in the Primary Care Office. J. Clin. Med. Res. 2017; 9(12): 970–980. Publisher Full Text
7. Palmer K, Vetrano DL, Marengoni A, et al.: The Relationship Between Anaemia and Frailty: A Systematic Review and Meta-Analysis of Observational Studies. J. Nutr. Health Aging. 2018; 22: 965–974. Publisher Full Text
8. Ruan Y, Guo Y, Kowal P, et al.: Association between anemia and frailty in 13,175 community-dwelling adults aged 50 years and older in China. BMC Geriatr. 2019; 19(1): 327. PubMed Abstract | Publisher Full Text | Free Full Text
9. Steinmeyer Z, Delpierre C, Soriano G, et al.: Hemoglobin concentration; A pathway to frailty. BMC Geriatr. 2020; 20(1): 202. PubMed Abstract | Publisher Full Text | Free Full Text
10. Angioni D, Macaron T, Takeda C, et al.: Can We Distinguish Age-Related Frailty from Frailty Related to Diseases? Data from the MAPT Study. J. Nutr. Health Aging. 2020; 24(10): 1144–1151. PubMed Abstract | Publisher Full Text
11. Angulo J, El Assar M, Rodríguez-Mañas L: Frailty and sarcopenia as the basis for the phenotypic manifestation of chronic diseases in older adults. Mol. Asp. Med. 2016; 50: 1–32. Publisher Full Text
12. Kleipool EEF, Hoogendijk EO, Trappenburg MC, et al.: Frailty in older adults with cardiovascular disease: Cause, effect or both? Aging Dis. 2018; 9(3): 489–497. PubMed Abstract | Publisher Full Text | Free Full Text
13. Thillainadesan J, Scott IA, Le Couteur DG: Frailty, a multisystem ageing syndrome. Age and Ageing. Oxford University Press; 2020; Vol. 49. : p. 758–63. Publisher Full Text
14. Ahmed MH, Ghatge MS, Safo MK: Hemoglobin: Structure, Function and Allostery. Subcell. Biochem. 2020. PubMed Abstract | Publisher Full Text | Free Full Text
15. Stauder R, Thein SL: Anemia in the elderly: Clinical implications and new therapeutic concepts. Haematologica. 2014; 99: 1127–1130. PubMed Abstract | Publisher Full Text | Free Full Text
16. Badrasawi M, Shahar S, Kaur Ajit Singh D: Risk Factors of Frailty Among Multi-Ethnic Malaysian Older Adults. Int. J. Gerontol. 2017; 11(3): 154–160. Publisher Full Text
17. Wang X, Hu J, Wu D: Risk factors for frailty in older adults. Medicine (United States). Lippincott Williams and Wilkins; 2022; Vol. 101. : p. E30169.
18. Fried LP, Cohen AA, Xue QL, et al.: The physical frailty syndrome as a transition from homeostatic symphony to cacophony. Nat Aging. 2021; 1(1): 36–46. PubMed Abstract | Publisher Full Text | Free Full Text
19. Angulo J, El Assar M, Álvarez-Bustos A, et al.: Physical activity and exercise: Strategies to manage frailty. Redox Biol. 2020; 35: 101513. PubMed Abstract | Publisher Full Text | Free Full Text
20. Shimoyama Y, Suzuki K, Hamajima N, et al.: Sirtuin 1 gene polymorphisms are associated with body fat and blood pressure in Japanese. Transl. Res. 2011; 157(6): 339–347. PubMed Abstract | Publisher Full Text
21. Kalemci S, Gokdogan Edgunlu T, Kara M, et al.: Sirtuin gene polymorphisms are associated with chronic obstructive pulmonary disease in patients in Muğla province. Kardiochirurgia i Torakochirurgia Polska. 2014; 3(3): 306–310. Publisher Full Text
22. Kilic U, Gok O, Bacaksiz A, et al.: SIRT1 gene polymorphisms affect the protein expression in cardiovascular diseases. PLoS One. 2014; 9(2): e90428. PubMed Abstract | Publisher Full Text | Free Full Text
23. Kilic U, Gok O, Erenberk U, et al.: A Remarkable Age-Related Increase in SIRT1 Protein Expression against Oxidative Stress in Elderly: SIRT1 Gene Variants and Longevity in Human. PLoS One. 2015; 10: 10. Publisher Full Text Reference Source
24. Mahmoud AA, Ali AHK, Eldin EN: Sirtuin 1 gene rs2273773 C > T single nucleotide polymorphism and protein oxidation markers in asthmatic patients. Egypt. J. Med. Hum. Genet. 2016; 17(2): 191–196. Publisher Full Text
25. Ramkaran P, Moodley D, Chuturgoon A, et al.: Sirtuin 1 rs1467568 and rs7895833 in South African Indians with early-onset coronary artery disease. Cardiovasc. J. Afr. 2016; 27: 213–217. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
26. Sabry D, Kaddafy SR, Abdelaziz AA, et al.: Association of SIRT-1 Gene Polymorphism and Vitamin D Level in Egyptian Patients With Rheumatoid Arthritis. J. Clin. Med. Res. 2018; 10(3): 189–195. Publisher Full Text
27. Casarotto AAF, Galera BB, Sumiyoshi LM, et al.: Polymorphism rs7895833 in the SIRT1 gene and its association with dyslipidaemia in the elderly. Rev. Esp. Geriatr. Gerontol. 2019; 54(4): 214–219. PubMed Abstract | Publisher Full Text
28. Tao TT, Lin XH, Tang SJ, et al.: Association of genetic variants in the Sirt1 and Nrf2 genes with the risk of metabolic syndrome in a Chinese Han population. BMC Endocr. Disord. 2022; 22(1): 84. PubMed Abstract | Publisher Full Text | Free Full Text
29. Zhou J, He YW, Fu L, et al.: Gene polymorphisms of SIRT1 in patients with rheumatoid arthritis. Int. J. Rheum. Dis. 2022; 25(2): 210–217. PubMed Abstract | Publisher Full Text
30. Siwak M, Maślankiewicz M, Nowak-Zduńczyk A, et al.: Analysis of rs7895833 polymorphism of SIRT1 gene and its influence on the risk occurrence and progression of neurodegenerative disease, such as primary open-angle glaucoma in a Polish population. J. Pre-Clin. Clin. Res. 2022 Dec 27; 16(4): 127–130. Publisher Full Text
31. Fried LP, Tangen CM, Walston J, et al.: Frailty in older adults: Evidence for a phenotype. J. Gerontol. A Biol. Sci. Med. Sci. 2001; 56(3): M146–M157. Publisher Full Text
32. Le Couteur DL , Benson V, Mcmahon A, et al.: Determinants of serum-induced SIRT1 expression in older men: the CHAMP study. J. Gerontol. A Biol. Sci. Med. Sci. 2011; 66(1): 3–8. PubMed Abstract | Publisher Full Text Reference Source
33. Razi S, Cogger V, Kennerson M, et al.: SIRT1 Polymorphisms and Serum-Induced SIRT1 Protein Expression in Aging and Frailty: The CHAMP Study.2017. Reference Source
34. Kumar R, Mohan N, Upadhyay A, et al.: Identification of serum sirtuins as novel noninvasive protein markers for frailty. Aging Cell. 2014; 13: 975–980. Publisher Full Text Reference Source
35. Ma L, Niu H, Sha G, et al.: Serum SIRT1 is Associated with Frailty and Adipokines in Older Adults. J. Nutr. Health Aging. 2018; 23: 246–250. Publisher Full Text Reference Source
36. Lee H, Cashin AG, Lamb SE, et al.: A Guideline for Reporting Mediation Analyses of Randomized Trials and Observational Studies: The AGReMA Statement. JAMA. 2021; 326(11): 1045–1056. PubMed Abstract | Publisher Full Text | Free Full Text
37. Cuschieri S: The STROBE guidelines. Saudi J. Anaesth. 2019; 13: 31–S34. PubMed Abstract | Publisher Full Text | Free Full Text
38. Charan J, Biswas T: How to calculate sample size for different study designs in medical research? Indian J. Psychol. Med. 2013; 35: 121–126. PubMed Abstract | Publisher Full Text | Free Full Text
39. Setiati S, Soejono CH, Harimurti K, et al.: Frailty and Its Associated Risk Factors: First Phase Analysis of Multicentre Indonesia Longitudinal Aging Study. Front. Med (Lausanne). 2021 Apr 29; 8.
40. Dwipa L, Apandi M, Utomo PP, et al.: Adaptation and validation of the indonesian version of the frail scale and the sarc-f in older adults. Asian J. Gerontol. Geriatr. 2021; 16(1).
41. Shimoyama Y, Suzuki K, Hamajima N, et al.: Sirtuin 1 gene polymorphisms are associated with body fat and blood pressure in Japanese. Transl. Res. 2011; 157(6): 339–347. PubMed Abstract | Publisher Full Text Reference Source
42. Yin G, Mitsuda Y, Ezaki T, et al.: A new PCR method: One primer amplification of PCR-CTPP products. Mol. Biotechnol. 2012; 52(2).
43. Epskamp S, Cramer AOJ, Waldorp LJ, et al.: Qgraph: Network visualizations of relationships in psychometric data. J. Stat. Softw. 2012; 48: 48. Publisher Full Text
44. Hayes AF, Rockwood NJ: Conditional Process Analysis: Concepts, Computation, and Advances in the Modeling of the Contingencies of Mechanisms. Am. Behav. Sci. 2020; 64(1): 19–54. Publisher Full Text
45. Hayes AF, Rockwood NJ: Regression-based statistical mediation and moderation analysis in clinical research: Observations, recommendations, and implementation. Behav. Res. Ther. 2017; 98: 39–57. PubMed Abstract | Publisher Full Text
46. Hayes AF: Partial, conditional, and moderated moderated mediation: Quantification, inference, and interpretation. Commun. Monogr. 2018; 85(1): 4–40. Publisher Full Text
47. Baron RM, Kenny DA: The moderator-mediator variable distinction in social psychological research: Conceptual, strategic, and statistical considerations. J. Pers. Soc. Psychol. 1986; 51(6): 1173–1182. PubMed Abstract | Publisher Full Text
48. Edwards JR, Lambert LS: Methods for integrating moderation and mediation: A general analytical framework using moderated path analysis. Psychol. Methods. 2007; 12(1): 1–22. PubMed Abstract | Publisher Full Text
49. Preacher KJ, Hayes AF: Asymptotic and resampling strategies for assessing and comparing indirect effects in multiple mediator models. Behav. Res. Methods. 2008; 40: 879–891. PubMed Abstract | Publisher Full Text
50. Deng A, Knoblich U, Lu J: Applying the Delta Method in Metric Analytics.2018.
51. Tagliari CFdS, de Oliveira CN , Vogel GM, et al.: Investigation of SIRT1 gene variants in HIV-associated lipodystrophy and metabolic syndrome. Genet. Mol. Biol. 2020; 43(1): e20190142. PubMed Abstract | Publisher Full Text | Free Full Text
52. Pires Corona L, Drumond Andrade FC, de Oliveira Duarte YA , et al.: The relationship between anemia, hemoglobin concentration and frailty in Brazilian older adults. J. Nutr. Health Aging. 2015; 19(9): 935–940. Publisher Full Text
53. Corona LP, Duarte YA d O, Lebrão ML: Prevalence of anemia and associated factors in older adults: Evidence from the SABE Study. Rev. Saude Publica. 2014; 48(5): 431–723. PubMed Abstract | Publisher Full Text | Free Full Text
54. Katsumi A, Abe A, Tamura S, et al.: Anemia in older adults as a geriatric syndrome: A review. Geriatr. Gerontol. Int. 2021; 21(7): 549–554. PubMed Abstract | Publisher Full Text
55. Lee CT, Chen MZ, Yip CYC, et al.: Prevalence of Anemia and Its Association with Frailty, Physical Function and Cognition in Community-Dwelling Older Adults: Findings from the HOPE Study. J. Nutr. Health Aging. 2021; 25(5): 679–687. PubMed Abstract | Publisher Full Text
56. Roy CN: Anemia in Frailty. Clin. Geriatr. Med. 2011; 27: 67–78. PubMed Abstract | Publisher Full Text | Free Full Text
57. Baker GT, Martin GR: Biological Aging and Longevity: Underlying Mechanisms and Potential Intervention Strategies. J. Aging Phys. Act. 2016; 2(4): 304–328. Publisher Full Text
58. Caprara G: Diet and longevity: The effects of traditional eating habits on human lifespan extension. Med. J. Nutrition Metab. 2018; 11(3): 261–294. Publisher Full Text
59. Pignatti C, D’adamo S, Stefanelli C, et al.: Nutrients and pathways that regulate health span and life span. Geriatrics (Switzerland). 2020; 5. Publisher Full Text
60. Chen X, Mai H, Chen X, et al.: Rs2015 Polymorphism in miRNA Target Site of Sirtuin2 Gene Is Associated with the Risk of Parkinson’s Disease in Chinese Han Population. Biomed. Res. Int. 2019; 2019: 1–8. Publisher Full Text
61. Mahmoud AA, Moghazy HM, Ezat MAW: Association of sirtuin 1 gene single nucleotide polymorphisms with type 2 diabetes mellitus in essential hypertension patients. Meta Gene. 2016; 10: 8–12. Publisher Full Text
62. Zazzara MB, Vetrano DL, Carfì A, et al.: Frailty and chronic disease. Panminerva Med. 2019; 61. Publisher Full Text
63. Madu AJ, Ughasoro MD: Anaemia of Chronic Disease: An In-Depth Review. Med. Princ. Pract. 2017; 26: 1–9. PubMed Abstract | Publisher Full Text | Free Full Text
64. Guarente L: Sirtuins, Aging, and Medicine. N. Engl. J. Med. 2011; 364(23): 2235–2244. Publisher Full Text
65. Zia A, Sahebdel F, Farkhondeh T, et al.: A review study on the modulation of SIRT1 expression by miRNAs in aging and age-associated diseases. Int. J. Biol. Macromol. 2021; 188: 52–61. Publisher Full Text
66. Chen C, Zhou M, Ge Y, et al.: SIRT1 and aging related signaling pathways. Mech. Ageing Dev. 2020; 187: 111215. Publisher Full Text
67. Manjula R, Anuja K, Alcain FJ: SIRT1 and SIRT2 Activity Control in Neurodegenerative Diseases. Front. Pharmacol. 2021; 11. PubMed Abstract | Publisher Full Text | Free Full Text
68. Xin H, Wang M, Tang W, et al.: Hydrogen Sulfide Attenuates Inflammatory Hepcidin by Reducing IL-6 Secretion and Promoting SIRT1-Mediated STAT3 Deacetylation. Antioxid. Redox Signal. 2016; 24(2): 70–83. PubMed Abstract | Publisher Full Text | Free Full Text
69. Zhou Z, Ye TJ, DeCaro E, et al.: Intestinal SIRT1 Deficiency Protects Mice from Ethanol-Induced Liver Injury by Mitigating Ferroptosis. Am. J. Pathol. 2020; 190(1): 82–92. PubMed Abstract | Publisher Full Text | Free Full Text
70. Zhang T, Kraus WL: SIRT1-dependent regulation of chromatin and transcription: Linking NAD+ metabolism and signaling to the control of cellular functions. Biochim. Biophys. Acta. 2010; 1804: 1666–1675. PubMed Abstract | Publisher Full Text | Free Full Text
71. Ardinata D, Harahap NS, Lubis NDA, et al.: Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. A moderated mediation analysis. Dataset. figshare. 2023. Publisher Full Text

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 17 May 2023

Author details Author details

Dedi Ardinata
Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing

Novita Sari Harahap
Roles: Data Curation, Formal Analysis, Funding Acquisition, Methodology, Project Administration, Resources

Nenni Dwi Aprianti Lubis
Roles: Data Curation, Funding Acquisition, Investigation, Methodology, Project Administration, Validation, Writing – Review & Editing

Tetty Aman Nasution
Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Validation, Writing – Original Draft Preparation, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

This study was funded by the Universitas Sumatera Utara through the TALENTA scheme 2022 with contract No. 335/UN5.2.3.1/PPM/KP-TALENTA/2022.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (3)

version 3

Revised

Published: 08 May 2024, 12:510

https://doi.org/10.12688/f1000research.133517.3

version 2

Revised

Published: 16 Apr 2024, 12:510

https://doi.org/10.12688/f1000research.133517.2

version 1

Published: 17 May 2023, 12:510

https://doi.org/10.12688/f1000research.133517.1

© 2024 Ardinata D et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Ardinata D, Sari Harahap N, Lubis NDA and Nasution TA. Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis [version 3; peer review: 2 approved, 1 approved with reservations]. F1000Research 2024, 12:510 (https://doi.org/10.12688/f1000research.133517.3)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?

Key to Reviewer Statuses VIEW HIDE

ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions

Version 3

VERSION 3

PUBLISHED 08 May 2024

Revised

Views

Reviewer Report 06 Jun 2024

Amit Singh, LMBI, National Institute on Aging, Baltimore, Maryland, USA

Approved

https://doi.org/10.5256/f1000research.165990.r266845

Authors have answered all my ... Continue reading

CITE

Report a concern

Respond or Comment

Version 2

VERSION 2

PUBLISHED 16 Apr 2024

Revised

Views

Reviewer Report 02 May 2024

Made Putra Semadhi, Prodia National Reference Laboratory, Jakarta, Indonesia; Padjadjaran University, Sumedang, Indonesia

Approved with Reservations

https://doi.org/10.5256/f1000research.164941.r253713

For the methodology,
1. It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition.
2. For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results.
3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade). It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra.
4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable.
5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions
6. The conclusions drawn will be broader following additional updated explanations

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Biochemistry and Geriatrics

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 19 Jun 2024

Dedi Ardinata, Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

19 Jun 2024

Author Response
Reviewer's comments:
1. It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled
... Continue reading
Reviewer's comments:

It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition.

For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results.

Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section.
Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade).
Author's response: I have already added in the background
It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra.
Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript."
Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable.
Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study.
Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions.
Author's response: I've already included the information in the method section.
Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations.
Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions.
Reviewer's comments:

It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition.

For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results.

Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section.
Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade).
Author's response: I have already added in the background
It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra.
Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript."
Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable.
Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study.
Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions.
Author's response: I've already included the information in the method section.
Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations.
Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 19 Jun 2024

Dedi Ardinata, Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

19 Jun 2024

Author Response
Reviewer's comments:
1. It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled
... Continue reading
Reviewer's comments:

It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition.

For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results.

Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section.
Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade).
Author's response: I have already added in the background
It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra.
Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript."
Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable.
Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study.
Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions.
Author's response: I've already included the information in the method section.
Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations.
Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions.
Reviewer's comments:

It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition.

For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results.

Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section.
Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade).
Author's response: I have already added in the background
It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra.
Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript."
Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable.
Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study.
Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions.
Author's response: I've already included the information in the method section.
Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations.
Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Version 1

VERSION 1

PUBLISHED 17 May 2023

Views

Reviewer Report 04 Apr 2024

Amit Singh, LMBI, National Institute on Aging, Baltimore, Maryland, USA

Approved with Reservations

https://doi.org/10.5256/f1000research.146512.r253712

Report for Ardinata et al.- Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis.
Ardinata et al claim to study the effects of SIRT1 protein expression and the associated SIRT1 promoter SNP in Indonesian older adult cohort. They further correlated these levels with hemoglobin, age, and frailty with chronic diseases comorbid. Study emphasize the known SIRT1 effects in interesting cohort and will be useful for aging related studies.
Study lacks in following areas and should be updated accordingly.
Authors claim SIRT1 levels and its relationship with various parameters. It should be corrected in title and also in text that these are plasma levels of SIRT1 not cellular protein. Explanation of plasma source of SIRT1 should be provided.
Manuscript holds just one data figure of genotyping gel. In genotyping gel image the marker lane is labelled as 50bp ladder, first, the marker bands are not clear and second if we follow the marker bands (which should be labelled for each band) the size doesn’t matches the genotype product DNA bands'. The 136bp according to the marker will be 75bp and 241bp will be 200bp and so on. Please lable the gel properly.
Since, SIRT1 is major focus of the manuscript, authors are encouraged to show at least some correlation plots of all 132 donors with SIRT1 levels and frailty or other important parameter.
Repetitions from introduction in discussion part should be avoided. Last paragraph of discussion has many typographical errors and there are also such errors thought out the manuscript, such mistakes should be avoided.
Conclusions can be shortened and many extreme speculations can be avoided.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Immunology, Aging, Inflammation

CITE

Report a concern

Author Response 30 Apr 2024

Dedi Ardinata, Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

30 Apr 2024

Author Response

Dear Amit Singh

Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on ... Continue reading Dear Amit Singh

Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly.

Clarification of SIRT1 Levels (Plasma vs. Cellular):
We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives.

Genotyping Gel Image Clarification:
We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size.

Inclusion of Correlation Plots:
Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript.

Reduction of Repetitions and Typographical Errors:
We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality.

Revision of Conclusions:
We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization.

We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication.

Sincerely,

Dedi Ardinata and co-authors
Dear Amit Singh

Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly.

Clarification of SIRT1 Levels (Plasma vs. Cellular):
We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives.

Genotyping Gel Image Clarification:
We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size.

Inclusion of Correlation Plots:
Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript.

Reduction of Repetitions and Typographical Errors:
We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality.

Revision of Conclusions:
We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization.

We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication.

Sincerely,

Dedi Ardinata and co-authors
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 30 Apr 2024

Dedi Ardinata, Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

30 Apr 2024

Author Response

Dear Amit Singh

Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on ... Continue reading Dear Amit Singh

Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly.

Clarification of SIRT1 Levels (Plasma vs. Cellular):
We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives.

Genotyping Gel Image Clarification:
We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size.

Inclusion of Correlation Plots:
Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript.

Reduction of Repetitions and Typographical Errors:
We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality.

Revision of Conclusions:
We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization.

We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication.

Sincerely,

Dedi Ardinata and co-authors
Dear Amit Singh

Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly.

Clarification of SIRT1 Levels (Plasma vs. Cellular):
We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives.

Genotyping Gel Image Clarification:
We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size.

Inclusion of Correlation Plots:
Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript.

Reduction of Repetitions and Typographical Errors:
We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality.

Revision of Conclusions:
We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization.

We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication.

Sincerely,

Dedi Ardinata and co-authors
Competing Interests: No competing interests were disclosed. Close
Report a concern

Views

Reviewer Report 20 Feb 2024

Ramu Manjula, Yale University, Connecticut, USA

Approved

https://doi.org/10.5256/f1000research.146512.r243614

This study aimed to investigate the relationship between SIRT1 levels, SNP rs7895833, hemoglobin levels, age, and physical frailty (frail score) among 132 older Indonesian adults with comorbid chronic diseases. The present study aligns with recent research suggesting that the association between low hemoglobin levels and physical frailty among older adults with one or more chronic diseases is influenced by age. Furthermore, this study revealed that the SNP genotype AG-GG and high SIRT1 levels further moderated the relationship between low hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. While multiple studies support the protective role of increased SIRT1 expression in the body, the study highlights that SNP rs7895833 A>G affects the expression of the SIRT1 gene.
The manuscript is structured well, and the authors have proved their hypothesis. As mentioned by the authors, along with the sample size the strong limitations of this study are lifestyle habits, environmental factors, and medications, which could have influenced the results.
I believe that conclusions cannot be drawn based on these results.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Sirtuin biology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 17 May 2023

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2	3
Version 3 (revision) 08 May 24		read
Version 2 (revision) 16 Apr 24			read
Version 1 17 May 23	read	read

Ramu Manjula, Yale University, Connecticut, USA
Amit Singh, National Institute on Aging, Baltimore, USA
Made Putra Semadhi, Prodia National Reference Laboratory, Jakarta, Indonesia; Padjadjaran University, Sumedang, Indonesia

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

3 Views

06 Jun 2024 | for Version 3

Amit Singh, LMBI, National Institute on Aging, Baltimore, Maryland, USA

3 Views Cite this report Responses(0)

Approved

Authors have answered all my concerns, Manuscript can be approved.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Molecular Biology, Immunology and Aging

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

8 Views

02 May 2024 | for Version 2

Made Putra Semadhi, Prodia National Reference Laboratory, Jakarta, Indonesia; Padjadjaran University, Sumedang, Indonesia

8 Views Cite this report Responses(1)

Approved With Reservations

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Biochemistry and Geriatrics

Respond to this report

Responses (1)

Author Response

19 Jun 2024

Dedi Ardinata, Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

Reviewer's comments:

It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition.
For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results.

Author's response: Analyses with comorbidities and clustering of BMI scores may have a different impact on the relationship between the variables studied. This would provide some insight into potential differences across comorbidity subgroups and BMI scores. However, this study did not analyze the impact of comorbidities and individual BMI scores due to the high prevalence of multiple comorbidities in the study population and the relatively small sample size in each subgroup, so statistical comparisons could not be made. This is a limitation of this study, which we have added in the limitations section.
Reviewer's comment: 3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade).
Author's response: I have already added in the background
It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra.
Author's response: The biological impacts and population distribution of the rs7895833 A>G SNP, particularly in Indonesia and North Sumatra. However, after a thorough literature search, we were unable to find specific data or references regarding the population distribution of this SNP in these regions. This highlights a gap in the current knowledge and underscores the need for future studies to investigate the prevalence and potential effects of this genetic variation in Indonesian and North Sumatran populations. Such research could provide valuable insights into the role of this SNP in different ethnic and geographical contexts and help to better understand its potential implications for health outcomes in these populations. We have added a brief discussion of this limitation and the need for further research in the revised manuscript."
Reviewer's comment: 4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable.
Author's response: Moreover, we did not collect detailed data on the subjects' lifestyle habits, such as routine exercise and diet, which could potentially influence plasma SIRT1 levels. Previous studies have shown that regular physical activity and certain dietary patterns, such as caloric restriction, can modulate SIRT1 expression and activity. Therefore, the lack of information on these factors is a limitation of our study, as we cannot analysis for their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study.
Reviewer's comment: 5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions.
Author's response: I've already included the information in the method section.
Reviewer's comment: 6. The conclusions drawn will be broader following additional updated explanations.
Author's response: We both agree that our introduction, method, and discussion (especially about the study's limitations) could be better if we looked into the effects of some comorbidities, the BMI score subgroup, lifestyle factors (like regular exercise, diet, etc.), gave more information on the rs7895833 SNP, and made sure that everyone was given the same conditions for blood sampling. However, we believe that these factors would not fundamentally alter our core conclusions.

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

17 Views

04 Apr 2024 | for Version 1

Amit Singh, LMBI, National Institute on Aging, Baltimore, Maryland, USA

17 Views Cite this report Responses(1)

Approved With Reservations

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Immunology, Aging, Inflammation

Respond to this report

Responses (1)

Author Response

30 Apr 2024

Dedi Ardinata, Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

Dear Amit Singh

Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly.

Clarification of SIRT1 Levels (Plasma vs. Cellular):
We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives.

Genotyping Gel Image Clarification:
We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size.

Inclusion of Correlation Plots:
Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript.

Reduction of Repetitions and Typographical Errors:
We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality.

Revision of Conclusions:
We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization.

We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication.

Sincerely,

Dedi Ardinata and co-authors

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

6 Views

20 Feb 2024 | for Version 1

Ramu Manjula, Yale University, Connecticut, USA

6 Views Cite this report Responses(0)

Approved

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Sirtuin biology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Ofori-Asenso R, Chin KL, Mazidi M, et al.: Global Incidence of Frailty and Prefrailty among Community-Dwelling Older Adults: A Systematic Review and Meta-analysis. JAMA Netw. Open. 2019; 2(8): e198398. PubMed Abstract | Publisher Full Text | Free Full Text

[2] 2. Adioetomo SM: Indonesia on the Threshold of Population Ageing. Indonesia: UNFPA; 2014; 65(632).

[3] 3. Barnett K, Mercer SW, Norbury M, et al.: Epidemiology of multimorbidity and implications for health care, research, and medical education: A cross-sectional study. Lancet. 2012; 380(9836): 37–43. Publisher Full Text

[4] 4. Biritwum RB, Minicuci N, Yawson AE, et al.: Prevalence of and factors associated with frailty and disability in older adults from China, Ghana, India, Mexico, Russia and South Africa. Maturitas. 2016; 91: 8–18. PubMed Abstract | Publisher Full Text

[5] 5. Kojima G: Prevalence of Frailty in Nursing Homes: A Systematic Review and Meta-Analysis. J. Am. Med. Dir. Assoc. 2015; 16: 940–945. PubMed Abstract | Publisher Full Text

[6] 6. Gandhi SJ, Hagans I, Nathan K, et al.: Prevalence, Comorbidity and Investigation of Anemia in the Primary Care Office. J. Clin. Med. Res. 2017; 9(12): 970–980. Publisher Full Text

[7] 7. Palmer K, Vetrano DL, Marengoni A, et al.: The Relationship Between Anaemia and Frailty: A Systematic Review and Meta-Analysis of Observational Studies. J. Nutr. Health Aging. 2018; 22: 965–974. Publisher Full Text

[8] 8. Ruan Y, Guo Y, Kowal P, et al.: Association between anemia and frailty in 13,175 community-dwelling adults aged 50 years and older in China. BMC Geriatr. 2019; 19(1): 327. PubMed Abstract | Publisher Full Text | Free Full Text

[9] 9. Steinmeyer Z, Delpierre C, Soriano G, et al.: Hemoglobin concentration; A pathway to frailty. BMC Geriatr. 2020; 20(1): 202. PubMed Abstract | Publisher Full Text | Free Full Text

[10] 10. Angioni D, Macaron T, Takeda C, et al.: Can We Distinguish Age-Related Frailty from Frailty Related to Diseases? Data from the MAPT Study. J. Nutr. Health Aging. 2020; 24(10): 1144–1151. PubMed Abstract | Publisher Full Text

[11] 11. Angulo J, El Assar M, Rodríguez-Mañas L: Frailty and sarcopenia as the basis for the phenotypic manifestation of chronic diseases in older adults. Mol. Asp. Med. 2016; 50: 1–32. Publisher Full Text

[12] 12. Kleipool EEF, Hoogendijk EO, Trappenburg MC, et al.: Frailty in older adults with cardiovascular disease: Cause, effect or both? Aging Dis. 2018; 9(3): 489–497. PubMed Abstract | Publisher Full Text | Free Full Text

[13] 13. Thillainadesan J, Scott IA, Le Couteur DG: Frailty, a multisystem ageing syndrome. Age and Ageing. Oxford University Press; 2020; Vol. 49. : p. 758–63. Publisher Full Text

[14] 14. Ahmed MH, Ghatge MS, Safo MK: Hemoglobin: Structure, Function and Allostery. Subcell. Biochem. 2020. PubMed Abstract | Publisher Full Text | Free Full Text

[15] 15. Stauder R, Thein SL: Anemia in the elderly: Clinical implications and new therapeutic concepts. Haematologica. 2014; 99: 1127–1130. PubMed Abstract | Publisher Full Text | Free Full Text

[16] 16. Badrasawi M, Shahar S, Kaur Ajit Singh D: Risk Factors of Frailty Among Multi-Ethnic Malaysian Older Adults. Int. J. Gerontol. 2017; 11(3): 154–160. Publisher Full Text

[17] 17. Wang X, Hu J, Wu D: Risk factors for frailty in older adults. Medicine (United States). Lippincott Williams and Wilkins; 2022; Vol. 101. : p. E30169.

[18] 18. Fried LP, Cohen AA, Xue QL, et al.: The physical frailty syndrome as a transition from homeostatic symphony to cacophony. Nat Aging. 2021; 1(1): 36–46. PubMed Abstract | Publisher Full Text | Free Full Text

[19] 19. Angulo J, El Assar M, Álvarez-Bustos A, et al.: Physical activity and exercise: Strategies to manage frailty. Redox Biol. 2020; 35: 101513. PubMed Abstract | Publisher Full Text | Free Full Text

[20] 20. Shimoyama Y, Suzuki K, Hamajima N, et al.: Sirtuin 1 gene polymorphisms are associated with body fat and blood pressure in Japanese. Transl. Res. 2011; 157(6): 339–347. PubMed Abstract | Publisher Full Text

[21] 21. Kalemci S, Gokdogan Edgunlu T, Kara M, et al.: Sirtuin gene polymorphisms are associated with chronic obstructive pulmonary disease in patients in Muğla province. Kardiochirurgia i Torakochirurgia Polska. 2014; 3(3): 306–310. Publisher Full Text

[22] 22. Kilic U, Gok O, Bacaksiz A, et al.: SIRT1 gene polymorphisms affect the protein expression in cardiovascular diseases. PLoS One. 2014; 9(2): e90428. PubMed Abstract | Publisher Full Text | Free Full Text

[23] 23. Kilic U, Gok O, Erenberk U, et al.: A Remarkable Age-Related Increase in SIRT1 Protein Expression against Oxidative Stress in Elderly: SIRT1 Gene Variants and Longevity in Human. PLoS One. 2015; 10: 10. Publisher Full Text Reference Source

[24] 24. Mahmoud AA, Ali AHK, Eldin EN: Sirtuin 1 gene rs2273773 C > T single nucleotide polymorphism and protein oxidation markers in asthmatic patients. Egypt. J. Med. Hum. Genet. 2016; 17(2): 191–196. Publisher Full Text

[25] 25. Ramkaran P, Moodley D, Chuturgoon A, et al.: Sirtuin 1 rs1467568 and rs7895833 in South African Indians with early-onset coronary artery disease. Cardiovasc. J. Afr. 2016; 27: 213–217. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[26] 26. Sabry D, Kaddafy SR, Abdelaziz AA, et al.: Association of SIRT-1 Gene Polymorphism and Vitamin D Level in Egyptian Patients With Rheumatoid Arthritis. J. Clin. Med. Res. 2018; 10(3): 189–195. Publisher Full Text

[27] 27. Casarotto AAF, Galera BB, Sumiyoshi LM, et al.: Polymorphism rs7895833 in the SIRT1 gene and its association with dyslipidaemia in the elderly. Rev. Esp. Geriatr. Gerontol. 2019; 54(4): 214–219. PubMed Abstract | Publisher Full Text

[28] 28. Tao TT, Lin XH, Tang SJ, et al.: Association of genetic variants in the Sirt1 and Nrf2 genes with the risk of metabolic syndrome in a Chinese Han population. BMC Endocr. Disord. 2022; 22(1): 84. PubMed Abstract | Publisher Full Text | Free Full Text

[29] 29. Zhou J, He YW, Fu L, et al.: Gene polymorphisms of SIRT1 in patients with rheumatoid arthritis. Int. J. Rheum. Dis. 2022; 25(2): 210–217. PubMed Abstract | Publisher Full Text

[30] 30. Siwak M, Maślankiewicz M, Nowak-Zduńczyk A, et al.: Analysis of rs7895833 polymorphism of SIRT1 gene and its influence on the risk occurrence and progression of neurodegenerative disease, such as primary open-angle glaucoma in a Polish population. J. Pre-Clin. Clin. Res. 2022 Dec 27; 16(4): 127–130. Publisher Full Text

[31] 31. Fried LP, Tangen CM, Walston J, et al.: Frailty in older adults: Evidence for a phenotype. J. Gerontol. A Biol. Sci. Med. Sci. 2001; 56(3): M146–M157. Publisher Full Text

[32] 32. Le Couteur DL , Benson V, Mcmahon A, et al.: Determinants of serum-induced SIRT1 expression in older men: the CHAMP study. J. Gerontol. A Biol. Sci. Med. Sci. 2011; 66(1): 3–8. PubMed Abstract | Publisher Full Text Reference Source

[33] 33. Razi S, Cogger V, Kennerson M, et al.: SIRT1 Polymorphisms and Serum-Induced SIRT1 Protein Expression in Aging and Frailty: The CHAMP Study.2017. Reference Source

[34] 34. Kumar R, Mohan N, Upadhyay A, et al.: Identification of serum sirtuins as novel noninvasive protein markers for frailty. Aging Cell. 2014; 13: 975–980. Publisher Full Text Reference Source

[35] 35. Ma L, Niu H, Sha G, et al.: Serum SIRT1 is Associated with Frailty and Adipokines in Older Adults. J. Nutr. Health Aging. 2018; 23: 246–250. Publisher Full Text Reference Source

[36] 36. Lee H, Cashin AG, Lamb SE, et al.: A Guideline for Reporting Mediation Analyses of Randomized Trials and Observational Studies: The AGReMA Statement. JAMA. 2021; 326(11): 1045–1056. PubMed Abstract | Publisher Full Text | Free Full Text

[37] 37. Cuschieri S: The STROBE guidelines. Saudi J. Anaesth. 2019; 13: 31–S34. PubMed Abstract | Publisher Full Text | Free Full Text

[38] 38. Charan J, Biswas T: How to calculate sample size for different study designs in medical research? Indian J. Psychol. Med. 2013; 35: 121–126. PubMed Abstract | Publisher Full Text | Free Full Text

[39] 39. Setiati S, Soejono CH, Harimurti K, et al.: Frailty and Its Associated Risk Factors: First Phase Analysis of Multicentre Indonesia Longitudinal Aging Study. Front. Med (Lausanne). 2021 Apr 29; 8.

[40] 40. Dwipa L, Apandi M, Utomo PP, et al.: Adaptation and validation of the indonesian version of the frail scale and the sarc-f in older adults. Asian J. Gerontol. Geriatr. 2021; 16(1).

[41] 41. Shimoyama Y, Suzuki K, Hamajima N, et al.: Sirtuin 1 gene polymorphisms are associated with body fat and blood pressure in Japanese. Transl. Res. 2011; 157(6): 339–347. PubMed Abstract | Publisher Full Text Reference Source

[42] 42. Yin G, Mitsuda Y, Ezaki T, et al.: A new PCR method: One primer amplification of PCR-CTPP products. Mol. Biotechnol. 2012; 52(2).

[43] 43. Epskamp S, Cramer AOJ, Waldorp LJ, et al.: Qgraph: Network visualizations of relationships in psychometric data. J. Stat. Softw. 2012; 48: 48. Publisher Full Text

[44] 44. Hayes AF, Rockwood NJ: Conditional Process Analysis: Concepts, Computation, and Advances in the Modeling of the Contingencies of Mechanisms. Am. Behav. Sci. 2020; 64(1): 19–54. Publisher Full Text

[45] 45. Hayes AF, Rockwood NJ: Regression-based statistical mediation and moderation analysis in clinical research: Observations, recommendations, and implementation. Behav. Res. Ther. 2017; 98: 39–57. PubMed Abstract | Publisher Full Text

[46] 46. Hayes AF: Partial, conditional, and moderated moderated mediation: Quantification, inference, and interpretation. Commun. Monogr. 2018; 85(1): 4–40. Publisher Full Text

[47] 47. Baron RM, Kenny DA: The moderator-mediator variable distinction in social psychological research: Conceptual, strategic, and statistical considerations. J. Pers. Soc. Psychol. 1986; 51(6): 1173–1182. PubMed Abstract | Publisher Full Text

[48] 48. Edwards JR, Lambert LS: Methods for integrating moderation and mediation: A general analytical framework using moderated path analysis. Psychol. Methods. 2007; 12(1): 1–22. PubMed Abstract | Publisher Full Text

[49] 49. Preacher KJ, Hayes AF: Asymptotic and resampling strategies for assessing and comparing indirect effects in multiple mediator models. Behav. Res. Methods. 2008; 40: 879–891. PubMed Abstract | Publisher Full Text

[50] 50. Deng A, Knoblich U, Lu J: Applying the Delta Method in Metric Analytics.2018.

[51] 51. Tagliari CFdS, de Oliveira CN , Vogel GM, et al.: Investigation of SIRT1 gene variants in HIV-associated lipodystrophy and metabolic syndrome. Genet. Mol. Biol. 2020; 43(1): e20190142. PubMed Abstract | Publisher Full Text | Free Full Text

[52] 52. Pires Corona L, Drumond Andrade FC, de Oliveira Duarte YA , et al.: The relationship between anemia, hemoglobin concentration and frailty in Brazilian older adults. J. Nutr. Health Aging. 2015; 19(9): 935–940. Publisher Full Text

[53] 53. Corona LP, Duarte YA d O, Lebrão ML: Prevalence of anemia and associated factors in older adults: Evidence from the SABE Study. Rev. Saude Publica. 2014; 48(5): 431–723. PubMed Abstract | Publisher Full Text | Free Full Text

[54] 54. Katsumi A, Abe A, Tamura S, et al.: Anemia in older adults as a geriatric syndrome: A review. Geriatr. Gerontol. Int. 2021; 21(7): 549–554. PubMed Abstract | Publisher Full Text

[55] 55. Lee CT, Chen MZ, Yip CYC, et al.: Prevalence of Anemia and Its Association with Frailty, Physical Function and Cognition in Community-Dwelling Older Adults: Findings from the HOPE Study. J. Nutr. Health Aging. 2021; 25(5): 679–687. PubMed Abstract | Publisher Full Text

[56] 56. Roy CN: Anemia in Frailty. Clin. Geriatr. Med. 2011; 27: 67–78. PubMed Abstract | Publisher Full Text | Free Full Text

[57] 57. Baker GT, Martin GR: Biological Aging and Longevity: Underlying Mechanisms and Potential Intervention Strategies. J. Aging Phys. Act. 2016; 2(4): 304–328. Publisher Full Text

[58] 58. Caprara G: Diet and longevity: The effects of traditional eating habits on human lifespan extension. Med. J. Nutrition Metab. 2018; 11(3): 261–294. Publisher Full Text

[59] 59. Pignatti C, D’adamo S, Stefanelli C, et al.: Nutrients and pathways that regulate health span and life span. Geriatrics (Switzerland). 2020; 5. Publisher Full Text

[60] 60. Chen X, Mai H, Chen X, et al.: Rs2015 Polymorphism in miRNA Target Site of Sirtuin2 Gene Is Associated with the Risk of Parkinson’s Disease in Chinese Han Population. Biomed. Res. Int. 2019; 2019: 1–8. Publisher Full Text

[61] 61. Mahmoud AA, Moghazy HM, Ezat MAW: Association of sirtuin 1 gene single nucleotide polymorphisms with type 2 diabetes mellitus in essential hypertension patients. Meta Gene. 2016; 10: 8–12. Publisher Full Text

[62] 62. Zazzara MB, Vetrano DL, Carfì A, et al.: Frailty and chronic disease. Panminerva Med. 2019; 61. Publisher Full Text

[63] 63. Madu AJ, Ughasoro MD: Anaemia of Chronic Disease: An In-Depth Review. Med. Princ. Pract. 2017; 26: 1–9. PubMed Abstract | Publisher Full Text | Free Full Text

[64] 64. Guarente L: Sirtuins, Aging, and Medicine. N. Engl. J. Med. 2011; 364(23): 2235–2244. Publisher Full Text

[65] 65. Zia A, Sahebdel F, Farkhondeh T, et al.: A review study on the modulation of SIRT1 expression by miRNAs in aging and age-associated diseases. Int. J. Biol. Macromol. 2021; 188: 52–61. Publisher Full Text

[66] 66. Chen C, Zhou M, Ge Y, et al.: SIRT1 and aging related signaling pathways. Mech. Ageing Dev. 2020; 187: 111215. Publisher Full Text

[67] 67. Manjula R, Anuja K, Alcain FJ: SIRT1 and SIRT2 Activity Control in Neurodegenerative Diseases. Front. Pharmacol. 2021; 11. PubMed Abstract | Publisher Full Text | Free Full Text

[68] 68. Xin H, Wang M, Tang W, et al.: Hydrogen Sulfide Attenuates Inflammatory Hepcidin by Reducing IL-6 Secretion and Promoting SIRT1-Mediated STAT3 Deacetylation. Antioxid. Redox Signal. 2016; 24(2): 70–83. PubMed Abstract | Publisher Full Text | Free Full Text

[69] 69. Zhou Z, Ye TJ, DeCaro E, et al.: Intestinal SIRT1 Deficiency Protects Mice from Ethanol-Induced Liver Injury by Mitigating Ferroptosis. Am. J. Pathol. 2020; 190(1): 82–92. PubMed Abstract | Publisher Full Text | Free Full Text

[70] 70. Zhang T, Kraus WL: SIRT1-dependent regulation of chromatin and transcription: Linking NAD+ metabolism and signaling to the control of cellular functions. Biochim. Biophys. Acta. 2010; 1804: 1666–1675. PubMed Abstract | Publisher Full Text | Free Full Text

[71] 71. Ardinata D, Harahap NS, Lubis NDA, et al.: Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. A moderated mediation analysis. Dataset. figshare. 2023. Publisher Full Text

Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis

Abstract

Background

Methods

Results

Conclusions

Keywords

Revised Amendments from Version 2

Introduction

Methods

Measurements

Figure 1. SIRT1 SNP rs7895833 A>G representative PCR gel electrophoresis images.

Statistical evaluation

Ethical considerations

Results

Hardy–Weinberg equilibrium tests

Characteristics of the study’s subjects

Table 1. Demographic, clinical and genotype characteristics of elderly adults with multimorbid (n=132).

The interrelationship between the potential main variables

Figure 2. The correlation plot of the interrelationship between the potential main variables.

Hypothesis testing

Figure 3. A conceptual diagram that shows hypothesized interactions between variables study; (A) Mediation model, (B) Moderated mediation model with two moderators.

Table 2. The mediation effect of age between hemoglobin and frail score.

Table 3. The moderation effects of SNP genotypes AA, AG-GG, and SIRT1 between hemoglobin and frail score through age as mediation variables.

Discussion

Limitations

Conclusion

Data availability

Underlying data

Acknowledgments

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated