Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal

Isolation and culture of Trichoderma isolates

To isolate Trichoderma, soil samples were collected from different agricultural regions spanning three ecological zones in Nepal: the plain region (80-141 m above sea level), the mid-hill region (1284-1650 m above sea level), and the high mountain region (1800-2500 m above sea level). These regions exhibited variations in altitude and ecological traits, and were recognized for cultivating a range of agricultural crops. The soil samples were collected from vegetable-growing areas within each region, covering eight districts in Nepal, including Sindhupalchok and Solukhumbu districts in the high mountains; Kathmandu, Lalitpur, Bhaktapur and Kavrepalanchok districts in the mid-hills, and Sunsari and Morang in the plains (Figure 1).

Figure 1. Map showing soil sampling sites for isolation of Trichoderma isolates.

Using a sterile spatula, approximately 200 grams of soil were collected from the rhizospheric zone of crops such as cauliflower, leaf mustard, cabbage, asparagus bean, tomato, cucumber, brinjal, chilly, pumpkin, and okra. These soil samples were carefully placed in clean polythene bags and appropriately labelled. Subsequently, the soil samples were transported to the National Plant Pathology Research Center, Khumaltar, Nepal and stored at 4°C until isolation.

For isolation, 10 grams soil samples were suspended in 90 ml of sterile distilled water and mixed using a rotary shaking machine set at 260 × g for 30 minutes to ensure thorough homogenization.³⁶ To facilitate the isolation, 1 mL aliquots of the soil suspensions were diluted from 10⁻¹ to 10⁻⁵ onto Trichoderma Selective Media (TSM) using the spread plate technique as described by Askew and Laing.³⁷ After inoculation, Trichoderma colonies were sub-cultured onto potato dextrose agar (PDA) plates and incubated at 28±2°C for seven days to allow for development and growth. Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, odour and colour. Depending on the diversity of colony characteristics, one to two colonies were selected from each sample for pure culture preparation. Each individual isolate was assigned a unique code and stored in a PDA slant for further study. Isolates were then grown on PDA plates for 3-5 days for sporulation. Different dilutions (10⁻¹ to 10⁻³) of spore suspension for each isolate were spread on 10% water agar plates and incubated at 28±2°C for 24 hours in the dark to prepare monoconidial cultures. A germinating, isolated single spore was picked up using a sterile needle from the water agar plates and placed on PDA plates to prepare monoconidial culture for each isolate. Spore suspensions were prepared as mentioned earlier and preserved in silica gel for long term storage at -40°C.³⁸

Morphological and morphometrical characterization

A total of 167 Trichoderma isolates were isolated from various soil samples and preserved using silica gel and were subsequently cultured on PDA plates at 28±2°C for three days. Following the incubation period, cultures with similar morphological characteristics, including growth pattern, diffusible pigments and odor, were observed and sorted into 25 different groups (T1-T25). While most groups consisted of 4 to 5 isolates, T11 and T22 (two larger groups) comprised 20 to 25 isolates each. Within each group, one representative isolate was selected for further study, except for the larger groups where 3 to 5 isolates were chosen for the study. Morphological characteristics such as the aspects of phialides, conidia and chlamydospores were scrutinized under a light microscope (Optika Microscope Italy, B-383PLi) equipped with a camera. To achieve this, Trichoderma isolates were grown on corn meal agar plate for 2-3 days, after which mycelial tips from the colony margin were transferred onto microscope slide and mounted with 3% KOH using sterile glass needles. Subsequently, these specimens were subjected to observation following the flattening and stretching of hyphae with a pair of glass needles. Once suitably prepared, a coverslip was placed over the samples, and any excess liquid was removed using tissue paper. Microscopical measurements and analyses were conducted using the ImageJ software (https://imagej.en.download.it, LOCI, University of Wisconsin). A total of 30 individual phialides and conidia from each specimen were measured and analyzed.

The colony characteristics of Trichoderma isolates were investigated on PDA plates that were incubated at 28°C under dark conditions. Notably, all Trichoderma isolates developed conidia within 4-5 days. Various diffusible pigments were observed, manifesting as distinct colors, which were then compared with the Audrey & Bear Color Chart (https://www.audrey and bear.com). Additionally, the presence or absence of a coconut odor was noted following 48 hours of culturing on PDA plates.³⁹

Molecular characterization of Trichoderma isolates

Genomic DNA was extracted from thirty-three isolates, which morphologically represented different Trichoderma species from various ecological regions (Figure 2). Approximately, 30-40 mg of mycelium was scraped off from 3–5-day-old colonies cultured on potato dextrose agar (PDA) using sterilized glass slides prior to sporulation. The obtained mycelia were then ground in liquid nitrogen and DNA extraction was carried out using the Promega Wizard genomic DNA extraction kit following the manufacturer’s instructions (Promega Corporation, Madison, WI).

Figure 2. Distribution of Trichoderma species/isolates collected across various ecological regions of Nepal.

A fragment of rRNA containing the internal transcribed spacer regions was amplified using the primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG).⁴⁰ The translation elongation factor 1-alpha gene (tef-1α) was amplified using the primers EF1-728F (CATCGAGAAGTTCGAGAAGG)⁴¹ and TEF1R (GCCATCCTTGGGAGATACCAGC).^10,42,43 Each PCR reaction (25 μL) comprised 12.5 μL of GoTaq^® Green Master Mix (Promega), 9.5 μL of nuclease-free water, 1 μL of each forward and reverse primer (10 mM), and 1 μL of gDNA. The PCR reactions were performed using a thermocycler (LifeEco Thermal Cycler (BIOER)) with the following settings: For ITS: 1 cycle of 2 minutes at 95°C followed by 34 cycles of 30 seconds at 95°C, 30 seconds at 57°C, 1 minute at 72°C, followed by a final elongation step at 72°C for 5 minutes. For tef-1α: 1 cycle of 5 minutes at 95°C followed by 35 cycles of 45 seconds at 95°C, 45 seconds at 63°C, 1 minute at 72°C, followed by a final elongation step at 72°C for 10 minutes. Amplified PCR products (3 μL) were subjected to electrophoresis (45 minutes, 100 volts) in a 1.0% agarose gel stained with GelGreen^® Nucleic Acid Gel Stain (Biotium, Fremont, CA, USA) alongside a 1 kb DNA ladder (Promega) for size estimation of the amplified bands. The PCR products were purified using the Wizard SV gel and PCR cleanup system (Promega) following the manufacturer’s instructions and were subsequently sequenced using both reverse and forward primers by Sanger sequencing (BGI Solutions Co., Ltd. Tai Po, Hong Kong, China).

Phylogenetic relationships

Sequences were manually edited using Finch TV 1.4.0 for Windows (Geospiza, https://digitalworldbiology.com/FinchTV). Consensus sequences of forward and reverse amplicons were created using BioEdit software⁴⁴ and deposited in the NCBI under accession numbers (OR140790- OR140818) for ITS rRNA and (OR567133-OR567158) for tef-1α. The BLASTn similarity search program was employed to identify homologous sequences in the NCBI nucleotide database, confirming species-level similarity with the sequence of the isolates. The ITS and tef-1α gene sequences were concatenated using Mesquite software version 2.75.⁴⁵ Final alignments were done using Clustal W 2.0 in MEGA X version 10.1 and were used to construct phylogenetic trees using the Maximum Likelihood method with the Tamura-Nei evolution model.⁴⁶ The choice of the Tamura-Nei evolution model was made after evaluating individual alignments through a model test (MEGAX software). Bootstrap values were computed with 1,000 replications to assess the statistical support for each branch. Graphical representation and editing of the phylogenetic trees were carried out using the Interactive Tree of Life (v3.5.1).^47,48

Analysis of the diversity among Trichoderma species

The degree of dominance index, also known as the McNaughton dominance index (Y), was used to quantitatively assess the habitat preference of Trichoderma isolates in different agricultural fields. The dominance values were calculated using the equation:

Species richness (the total number of species), abundance (the total number of isolates of each species), and diversity were calculated using several ecological indices: the Simpson biodiversity index (D),⁵⁰ Shannon’s biodiversity index (H),⁵¹ Pielou species evenness index (J),⁵² and Margalef’s abundance index (E).⁵³ These indices were applied to quantitatively describe the diversity and habitat preferences of Trichoderma species in various agricultural fields across different ecological zones of Nepal.

The biological diversity indices were calculated using the following equations:

Where Hmax = InS

In these equations, ‘S’ is the total number of Trichoderma species, ‘N’ is the total number of Trichoderma species isolates, ‘Pi’ is the relative quantity of Trichoderma species ‘i’, and ‘ni’ is the number of isolates of Trichoderma species ‘i’.

Morphological characterization of single spores of Trichoderma isolates

A total of 167 Trichoderma isolates were isolated from soil samples collected from rhizospheric regions of various vegetable crops. Among this collection, 33 Trichoderma isolates were selected based on morphological and microscopic characteristics. The isolates were visually characterized based on phenotypic traits such as colony color (ranging from dark green to cottony whitish green, Plate 1), growth pattern, presence or absence of aerial mycelium (Figure 3a, b), as well as the shape and size of phialides (Figure 3c–f) and conidia (Figure 3g–i). Additionally, the presence (Figure 3j) or absence of chlamydospores was observed microscopically (Table 1). Isolates from the groups T2, T3, T6, T7, T8, T9, T11, T14, T18, T19, T24 were morphologically and microscopically identified as belonging to the Harzianum clade. Meanwhile, isolates from groups T1, T4, T10, T12, T13, T15, T16, T21, T22, T23, T25 were identified as members of the Viride clade. Isolates from groups T5 and T17 were grouped within Longibrachiatum clade, corresponding to T. longibrachiatum species, while isolates from T20 group were classified within Brevicompactum clade, associated with T. brevicompactum species.

Plate 1. Culture of Trichoderma isolates grown in 28±2°c in potato dextrose agar medium.

Figure 3. Morphological characteristics of Trichoderma isolates.

a, b: with and without aerial mycelium. c–f: different types of phialides. g–i: different types of spores. j: presence of chlamydospores in Trichoderma asperellum.

Morphological variations were observed among different groups of Trichoderma isolates (Table 1). Illustrations of colonies grown in PDA Petri plates are shown in Plate 1.⁷⁰ Various diffusible pigments were observed, displaying different colors, which were compared to the Audrey & Bear Color Chart (https://www.audreyandbear.com). In the Harzianum clade, which includes species such as T. afroharzianum, T. lentiforme, T. camerunense, T. inhamatum and T. azevedoi colonies exhibited 1-2 concentric rings with the production of green-colored conidia. No diffusible pigments were detected in PDA medium, and a coconut odor was also not noticeable. The conidia were oval to oblong and ranged from 0.6-4.1μm. Within the Viride clade, comprising species like T. asperellum, T. asperelloides, T. koningii and T. atroviride colonies on PDA displayed a somewhat granular appearance with green and white regions distributed throughout the plate. No diffusible pigments were detected in the PDA medium, but coconut odor was found in some groups and absent in others (Table 1). The conidia were generally round and ranged from 1-4 μm. The T5 and T17 groups of isolates displayed white mycelium with green pustules and produced yellow diffusible pigments, classifying them within the Longibrachiatum clade. Conidia in this group were oblong and ranged from 2-3.9 μm. Isolates from T20 group were challenging to differentiate and were grouped together, with conidia measuring 1.2-2.2μm. Phialides were flask-shaped in both the Harzianum and Viride clades and were present in whorls in almost all species, except in ST3 (T. afroharzianum) and ToT11(T. longibrachiatum), where they were solitary.

The Harzianum clade was found within an altitudinal range of 80-1800 masl, spanning from lowland plains to hilly regions, and was common in both tropical and temperate regions (Table 2). Similarly, the Viride clade were also identified in both tropical and temperate regions, with altitudes ranging from between 90-1475 masl, which was generally lower than that of the Harzianum clade. Isolates of the T20 group (T. brevicompactum) were primarily located in lowland plains (at 80 masl), rather than in higher mountain region, whereas T. longibrachiatum was primarily found in mid-hill regions, with altitudes ranging from 1300-1500 masl (Table 2). However, morphological characteristics alone proved insufficient for distinguishing between the various Trichoderma isolates. Therefore, molecular identification was required to differentiate among complex and overlapping Trichoderma isolates.

Molecular characterization and phylogenetic studies of Trichoderma isolates

Trichoderma isolates were further identified using molecular sequencing data of ITS rRNA and tef-1α genes. Out of 33 strains, PCR and bidirectional sequencing were successfully completed for 29 presumptive isolates by ITS oligonucleotide barcode identification (OR140790-OR140818) and for only of 26 isolates using tef-1α (OR567133-OR567158). The average consensus sequence length for tef-1α was 663 bp, while for the ITS rRNA, it was 646 bp. Nucleotide BLAST analysis and pairwise alignments of the ITS rRNA and tef-1α sequences identified the Trichoderma isolates as belonging to T. harzianum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. atroviride, T. asperellum, T. asperelloides, T. brevicompactum, T. koningii and T. longibrachiatum which shared 97-100% identity match with published sequences in the NCBI database.

The phylogenetic tree (Figure 4) based on ITS rRNA unambiguously identified 11 species among the 29 isolates, based on their clustering with reference taxa. The isolates identified in the analysis included T. harzianum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. asperellum, T. asperelloides, T. brevicompactum, T. koningii and T. longibrachiatum. Although the ITS rRNA tree could not clearly delimit the species resolution of the isolates MT8, ST49, MT5, and PanT1, however there were clear and distinct resolution of other isolates (Figure 4). The phylogenetic tree (Figure 5) obtained from the tef-1α region identified 10 species among the 26 isolates, which included T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. atroviride, T. asperellum, T. asperelloides, T. longibrachiatum and T. brevicompactum. The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp), produced four distinct, well supported clades with bootstrap values higher than 70%: Harzianum, Viride, Longibrachiatum and Brevicompactum clades (Figure 6).

Figure 4. Phylogenetic tree of 29 Trichoderma isolates based on ITS rRNA sequences.

Figure 5. Phylogenetic tree of 26 Trichoderma isolates based on tef -1α gene sequences.

Figure 6. Phylogenetic tree of Trichoderma isolates based on tef-1α -ITS gene sequences.

Thus, based on above three phylogenetic trees, four clades were identified: Harzianum, Viride, Brevicompactum and Longibrachiatum clades. Eighty-five isolates belonged to the Harzianum clade, consisting of T. afroharzianum (64 isolates), T. harzianum (3 isolates), T. lentiforme (1 isolate), T. camerunense (11 isolates T. inhamatum (5 isolates), and T. azevedoi (1 isolate). The Viride clade included 67 isolates, comprising species such as T. asperellum (57 isolates), T. asperelloides (6 isolates), T. atroviride (1 isolate), and T. koningii (3 isolates). The Longibrachiatum clade comprised 11 isolates, all belonging to the T. longibrachiatum. The Brevicompactum clade consisted of 4 isolates, all of which were identified as T. brevicompactum (Table 3). Among these, T. afroharzianum was the most abundant species in this study, followed by T. asperellum.

Analysis of the diversity among Trichoderma species

Table 4 shows Simpson’s biodiversity index (D), Shannon’s biodiversity index (H), evenness (J), and the abundance index (E) for various agricultural fields in different ecological zones. The highest species diversity and evennesswere recorded in the high mountain region, with Shannon’s index (H) of 1.724, evenness (J) of 0.84 and Simpson’s index (D) of 0.28). Following this the hilly region which exhibited the Shannon’s index of 1.563, eveness of 0.7 and Simpson’s index of of 0.28. In contrast, the plain region had the lowest species diversity with Shannon and Simpson diversity indices and evenness estimatedto be H = 1.515, J=0.66, D = 0.33. The species abundance values were E = 2.11 for the plain, E = 1.95 for mid-hill and E = 1.99 for the high mountain region. The dominance values (Y) of T. arfoharzianum T. asperellum, T. camerunense and T. longibrachiatum were 0.04, 0.03, 0.01, and 0.01 respectively and they were classified as the principal species. On average, the diversity values for Trichoderma species were H = 1.61, D = 0.29, J = 0.74, and E= 2.02 (Table 4). Simpson’s index (1-D) and the evenness index were close to 1 in all regions except for the plain region, indicating a very high diversity of Trichoderma species in the major agricultural areas of Nepal. The number of species and isolates, as well as the dominant species of Trichoderma, varied geographically (Table 5) revealing that the mid hill and high mountain regions have a high diversity of Trichoderma species.