ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal

[version 2; peer review: 1 approved, 2 approved with reservations]
PUBLISHED 09 Jan 2025
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Agriculture, Food and Nutrition gateway.

Abstract

Background

Trichoderma spp. hold significant potential as biocontrol agents in agriculture due to their antagonistic properties against plant pathogens. The study aimed to characterize and identify Trichoderma isolates from rhizospheric regions of vegetable crops.

Methods

In this study, Trichoderma isolates were collected from rhizospheric soil samples of vegetable crops from different ecological zones and were selected for comprehensive morphological and molecular characterization. The isolates were visually assessed for colony color, growth pattern, aerial mycelium presence, phialide and conidial morphology, and chlamydospore presence. Molecular analysis was employed based on ITS and tef-1α sequences. Diversity indices were also computed for different ecological zones.

Results

The morphological characteristics and phylogenetic trees for both regions provided a clear species resolution, with four main clades: Harzianum, Viride, Brevicompactum and Longibrachiatum with 12 species T. harzinaum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. atroviride, T. asperellum, T. asperelloides, T. koningii, T. longibrachiatum and T. brevicompactum and nine species as a new country record. Diversity indices indicated that high mountain regions displayed the highest species diversity and evenness (H = 1.724 [0.28], J = 0.84, D = 0.28), followed by hilly regions (H = 1.563 [0.28], J = 0.72, D = 0.28). Plains, on the other hand, exhibited lower species diversity (H = 1.515, J = 0.66, D = 0.33). The calculated species abundance values showed that plains (E = 2.11), mid-hills (E = 1.95), and high mountains (E = 1.99) each had their unique diversity profiles. Notably, T. afroharzianum and T. asperellum were predominant.

Conclusions

Overall, the study unveiled a rich diversity of Trichoderma species in different agricultural zones of Nepal. These findings shed light on the ecological distribution and diversity of Trichoderma spp., which could have significant implications for sustainable agriculture and biological control strategies.

Keywords

Biocontrol agent; phylogenetic analysis; Rhizospheric region; Species diversity; Nepal

Revised Amendments from Version 1

The changes have been made in the introduction section, where the relevance of Trichoderma spp. to smallholder farmers has been added. A few more references (25 and 29) have been supplied. Discussion on discrepancies observed between ITS and tef-1α sequencing results has been added as suggested by reviewers.

See the authors' detailed response to the review by Yunus Korkom
See the authors' detailed response to the review by Eder Marques
See the authors' detailed response to the review by Raja Asad Ali Khan

Introduction

The genus Trichoderma comprises a highly diverse group of soil dwelling fungi, demonstrating remarkable versatility. Within this genus, a wide array of strains exhibits significant potential for various applications, including biological control as biopesticides, biofertilizers, soil enhancers and promoters of crop growth.1,2 Furthermore, Trichoderma isolates have the capacity to stimulate plant defense mechanisms, a phenomenon extensively documented in studies conducted by various researchers.36

The Trichoderma genus was originally proposed by Persoon in Germany in 1794, more than two centuries ago, and their potential as bioagents was first documented by Weindling in 1932.7 To date, over 250 Trichoderma species have been identified worldwide.8 Trichoderma species can be readily isolated from soil using various conventional methods, thanks to their adaptability to diverse conditions, ranging from deserts and wetlands to the Himalayan regions. However, the most effective method for isolating Trichoderma spp. is from rhizospheric soil samples.9 A comprehensive understanding of Trichoderma biodiversity is crucial for harnessing the full potential of this genus in various biological applications. Previous surveys that investigated Trichoderma diversity in specific geographical regions have primarily focused on isolates obtained from soil samples. These surveys have been conducted in various locations, including Russia and the Siberian Himalayas,10,11 China,12,13 South-East Asia,14 India,15 Egypt,16 Iran,17 Philippines,18 Europe,19 Canary Islands,20 Sardinia,21 South America,22 and Turkey.23 The potential of Trichoderma species as biological control agents (BCAs) has been under investigation for over 70 years, and more recently, these species have become commercially available.24,25 Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions.2629 Trichoderma deploys diverse mechanisms, including antibiosis, competition, mycoparasitism, and enzymatic hydrolysis, to manifest its biocontrol activity.30

Nepal's agriculture is dominated by smallholder farmers with limited access to modern agricultural inputs such as chemical pesticides and fertilizers. Trichoderma, with its versatile role in crop production, offers eco-friendly and cost-effective solutions to challenges like biotic stresses (diseases and pests) and abiotic stresses (drought and cold). Additionally, it addresses issues of low soil fertility, particularly in hilly regions, by strengthening plant root systems to improve nutrient and soil absorption. Therefore, identifying native Trichoderma isolates that are better adapted to the local environment, thrive better in local soil conditions, and exhibit versatile capabilities in suppressing multiple stresses in crops is critically important for the successful commercial application of Trichoderma in Nepal. However, it is important to note that not all Trichoderma species yield the same effects on crops or pathogens. Therefore, the characterization and precise identification of isolates at the species level are pivotal for their effective application as BCAs and the preservation of isolates as viable commercial products.25

Traditional methods for identifying Trichoderma species have conventionally relied on morphological characteristics and culture-based approaches. However, owing to the limited and often indistinguishable morphological features shared among Trichoderma species, alongside the increasing recognition of morphologically cryptic species, accurate identification through these methods becomes challenging and can potentially lead to misidentification.10,31 As a result, molecular techniques such as amplification of important taxonomic markers, and sequencing have emerged as indispensable tools for achieving precise species identification.3134 In the present study, the identification of Trichoderma species at the species level was accomplished by focusing on two key genetic markers: the Internal Transcribed Spacer (ITS) region of rDNA and a partial sequence of the translation elongation factor 1-alpha gene (tef-1α) in addition to classical taxonomy.35 Recent researches have evaluated the ecological specialization of diversity. Numerous studies have documented the discovery of new isolates and phylogenetic species across various natural ecosystems.20,36 While some studies have been conducted in Nepal, they all have focused on different ecological zones.37 In contrast, limited attention has been given to studying Trichoderma in agricultural environments. Importantly, such investigations have practical implications, as they highlight the potential of agricultural soil rhizosphere as a rich source of beneficial strains with biocontrol capabilities. Building upon these findings, we propose that the composition, distribution, and genetic structure of Trichoderma spp. in the rhizosphere of vegetable crops along with ecological domains and altitudinal gradients may exhibit significant differences. Confirming these differences will enhance our understanding of Trichoderma’s biodiversity across distinct biological niches and various altitudinal gradients across the country.

Methods

Isolation and culture of Trichoderma isolates

To isolate Trichoderma, soil samples were collected from different agricultural regions spanning three ecological zones in Nepal: the plain region (80-141 m above sea level), the mid-hill region (1284-1650 m above sea level), and the high mountain region (1800-2500 m above sea level). These regions exhibited variations in altitude and ecological traits, and were recognized for cultivating a range of agricultural crops. The soil samples were collected from vegetable-growing areas within each region, covering eight districts in Nepal, including Sindhupalchok and Solukhumbu districts in the high mountains; Kathmandu, Lalitpur, Bhaktapur and Kavrepalanchok districts in the mid-hills, and Sunsari and Morang in the plains ( Figure 1).

ae36fe4f-b4ab-4ec5-bcf4-5d0728b08c8d_figure1.gif

Figure 1. Map showing soil sampling sites for isolation of Trichoderma isolates.

Using a sterile spatula, approximately 200 grams of soil were collected from the rhizospheric zone of crops such as cauliflower, leaf mustard, cabbage, asparagus bean, tomato, cucumber, brinjal, chilly, pumpkin, and okra. These soil samples were carefully placed in clean polythene bags and appropriately labelled. Subsequently, the soil samples were transported to the National Plant Pathology Research Center, Khumaltar, Nepal and stored at 4°C until isolation.

For isolation, 10 grams soil samples were suspended in 90 ml of sterile distilled water and mixed using a rotary shaking machine set at 260 × g for 30 minutes to ensure thorough homogenization.38 To facilitate the isolation, 1 mL aliquots of the soil suspensions were diluted from 10−1 to 10−5 onto Trichoderma Selective Media (TSM) using the spread plate technique as described by Askew and Laing.39 After inoculation, Trichoderma colonies were sub-cultured onto potato dextrose agar (PDA) plates and incubated at 28±2°C for seven days to allow for growth. Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, and colour. Depending on the diversity of colony characteristics, one to two colonies were selected from each sample for pure culture preparation. Each individual isolate was assigned a unique code and stored in a PDA slant for further study. Isolates were then grown on PDA plates for 3-5 days for sporulation. Different dilutions (10−1 to 10−3) of spore suspension for each isolate were spread on 10% water agar plates and incubated at 28±2°C for 24 hours in the dark to prepare monoconidial cultures. A germinating, isolated single spore was picked up using a sterile needle from the water agar plates and placed on PDA plates to prepare monoconidial culture for each isolate. Spore suspensions were prepared as mentioned earlier and preserved in silica gel for long term storage at -40°C.40

Morphological and morphometrical characterization

A total of 167 Trichoderma isolates were isolated from various soil samples and preserved using silica gel and were subsequently cultured on PDA plates at 28±2°C for three days. Following the incubation period, cultures with similar morphological characteristics, including growth pattern, diffusible pigments and odor, were observed and sorted into 25 different groups (T1-T25). While most groups consisted of 4 to 5 isolates, T11 and T22 (two larger groups) comprised 20 to 25 isolates each. Within each group, one representative isolate was selected for further study, except for the larger groups where 3 to 5 isolates were chosen for the study. Morphological characteristics such as the aspects of phialides, conidia and chlamydospores were scrutinized under a light microscope (Optika Microscope Italy, B-383PLi) equipped with a camera. To achieve this, Trichoderma isolates were grown on corn meal agar plate for 2-3 days, after which mycelial tips from the colony margin were transferred onto microscope slide and mounted with 3% KOH using sterile glass needles. Subsequently, these specimens were subjected to observation following the flattening and stretching of hyphae with a pair of glass needles. Once suitably prepared, a coverslip was placed over the samples, and any excess liquid was removed using tissue paper. Microscopical measurements and analyses were conducted using the ImageJ software (https://imagej.en.download.it, LOCI, University of Wisconsin). A total of 30 individual phialides and conidia from each specimen were measured and analyzed.

The colony characteristics of Trichoderma isolates were investigated on PDA plates that were incubated at 28°C under dark conditions. Notably, all Trichoderma isolates developed conidia within 4-5 days. Various diffusible pigments were observed, manifesting as distinct colors, which were then compared with the Audrey & Bear Color Chart (https://audreyandbear.com/products/audrey-bear-color-chart). Additionally, the presence or absence of a coconut odor was noted following 48 hours of culturing on PDA plates.41

Molecular characterization of Trichoderma isolates

Thirty-three Trichoderma spp. isolates, representing diverse groups based on similarities in morphological traits such as growth patterns and diffusible pigments, were selected from various ecological regions for DNA extraction and molecular characterization ( Figure 2).

ae36fe4f-b4ab-4ec5-bcf4-5d0728b08c8d_figure2.gif

Figure 2. Distribution of Trichoderma species/isolates collected across various ecological regions of Nepal.

Approximately, 30-40 mg of mycelium was scraped off from 3–5-day-old colonies cultured on potato dextrose agar (PDA) using sterilized glass slides prior to sporulation for genomic DNA extraction. The obtained mycelia were then ground in liquid nitrogen and DNA extraction was carried out using the Promega Wizard genomic DNA extraction kit (Catalogue No. A1120) following the manufacturer’s instructions (Promega Corporation, Madison, WI).

A fragment of rRNA containing the internal transcribed spacer regions was amplified using the primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG).42 The translation elongation factor 1-alpha gene (tef-1α) was amplified using the primers EF1-728F (CATCGAGAAGTTCGAGAAGG)43 and TEF1R (GCCATCCTTGGGAGATACCAGC).10,44,45 Each PCR reaction (25 μL) comprised 12.5 μL of GoTaq® Green Master Mix (Promega), 9.5 μL of nuclease-free water, 1 μL of each forward and reverse primer (10 mM), and 1 μL of gDNA. The PCR reactions were performed using a thermocycler (LifeEco Thermal Cycler (BIOER)) with the following settings: For ITS: 1 cycle of 2 minutes at 95°C followed by 34 cycles of 30 seconds at 95°C, 30 seconds at 57°C, 1 minute at 72°C, followed by a final elongation step at 72°C for 5 minutes. For tef-1α: 1 cycle of 5 minutes at 95°C followed by 35 cycles of 45 seconds at 95°C, 45 seconds at 63°C, 1 minute at 72°C, followed by a final elongation step at 72°C for 10 minutes. Amplified PCR products (3 μL) were subjected to electrophoresis (45 minutes, 100 volts) in a 1.0% agarose gel stained with GelGreen® Nucleic Acid Gel Stain (Biotium, Fremont, CA, USA) alongside a 1 kb DNA ladder (Promega) for size estimation of the amplified bands. The PCR products were purified using the Wizard SV gel and PCR cleanup system (Promega) following the manufacturer’s instructions and were subsequently sequenced using both reverse and forward primers by Sanger sequencing (BGI Solutions Co., Ltd. Tai Po, Hong Kong, China).

Phylogenetic relationships

Sequences were manually edited using Finch TV 1.4.0 for Windows (Geospiza, https://digitalworldbiology.com/FinchTV). Consensus sequences of forward and reverse amplicons were created using BioEdit software46 and deposited in the The National Center for Biotechnology Information (NCBI) NCBI under accession numbers (OR140790- OR140818) for ITS rRNA and (OR567133-OR567158) for tef-1α. The BLASTn similarity search program was employed to identify homologous sequences in the NCBI nucleotide database, confirming species-level similarity with the sequence of the isolates. The ITS and tef-1α gene sequences were concatenated using Mesquite software version 2.75.47 Final alignments were done using Clustal W 2.0 in MEGA X version 10.1 and were used to construct phylogenetic trees using the Maximum Likelihood method with the Tamura-Nei evolution model.48 The choice of the Tamura-Nei evolution model was made after evaluating individual alignments through a model test (MEGAX software). Bootstrap values were computed with 1,000 replications to assess the statistical support for each branch. Graphical representation and editing of the phylogenetic trees were carried out using the Interactive Tree of Life (v3.5.1).49,50

Analysis of the diversity among Trichoderma species

The degree of dominance index, also known as the McNaughton dominance index (Y), was used to quantitatively assess the habitat preference of Trichoderma isolates in different agricultural fields. The dominance values were calculated using the equation:

Y=nifiN
where ‘N’ is the total number of Trichoderma isolates, ‘ni’ is the number of the genus (species) i, and ‘fi’ is the frequency with which genus (species) i appears in the samples. A species i is considered dominant when Y > 0.02.51

Species richness (the total number of species), abundance (the total number of isolates of each species), and diversity were calculated using several ecological indices: the Simpson biodiversity index (D),52 Shannon’s biodiversity index (H),53 Pielou species evenness index (J),54 and Margalef’s abundance index (E).55 These indices were applied to quantitatively describe the diversity and habitat preferences of Trichoderma species in various agricultural fields across different ecological zones of Nepal.

The biological diversity indices were computed numerically using the following equations in Microsoft Excel (Excel 2010 (v14.0))

D=1Σni(ni1)N(N1)
H=ΣPilnPi
where Ni = 1, and Pi = niN
J=HHmax

Where Hmax = InS

E=S1lnN

In these equations, ‘S’ is the total number of Trichoderma species, ‘N’ is the total number of Trichoderma species isolates, ‘Pi’ is the relative quantity of Trichoderma species ‘i’, and ‘ni’ is the number of isolates of Trichoderma species ‘i’.

Results

Morphological characterization of single spores of Trichoderma isolates

A total of 167 Trichoderma isolates were isolated from soil samples collected from rhizospheric regions of various vegetable crops. Among this collection, 33 Trichoderma isolates were selected based on morphological and microscopic characteristics. The isolates were visually characterized based on phenotypic traits such as colony color (ranging from dark green to cottony whitish green, Plate 1),56 growth pattern, presence or absence of aerial mycelium ( Figure 3a, b), as well as the shape and size of phialides ( Figure 3c–f) and conidia ( Figure 3g–i). Additionally, the presence ( Figure 3j) or absence of chlamydospores was observed microscopically ( Table 1).57 Isolates from the groups T2, T3, T6, T7, T8, T9, T11, T14, T18, T19, T24 were morphologically and microscopically identified as belonging to the Harzianum clade. Meanwhile, isolates from groups T1, T4, T10, T12, T13, T15, T16, T21, T22, T23, T25 were identified as members of the Viride clade. Isolates from groups T5 and T17 were grouped within Longibrachiatum clade, corresponding to T. longibrachiatum species, while isolates from T20 group were classified within Brevicompactum clade, associated with T. brevicompactum species.

ae36fe4f-b4ab-4ec5-bcf4-5d0728b08c8d_graphics1.gif

Plate 1. Culture of Trichoderma isolates grown in 28±2°c in potato dextrose agar medium.

ae36fe4f-b4ab-4ec5-bcf4-5d0728b08c8d_figure3.gif

Figure 3. Morphological characteristics of Trichoderma isolates.

a, b: with and without aerial mycelium. c–f: different types of phialides. g–i: different types of spores. j: presence of chlamydospores in Trichoderma asperellum.

Table 1. Morphological characteristics of Trichoderma isolates isolated from various ecological zones of Nepal.

Name of Trichoderma isolatesColonyPhialidesConidia Species Molecular clade
Form and colorFront colorReverse colorAerial myceliumConidiation Size (μm)Shape Spore width (μm)xCoconut odorChlamydospore
T1 ToT8 Green color concentric ringsGreenBanana yellowPresentWhorl5.8-9.5Round1.9-3.3PresentAbsent T. asperellum Viride
T2 ST49 green in middle and wooly white peripheryGreenBanana yellowAbsentWhorl5-8.5Round1.6-2.2absentAbsentT. lentiforme Harzianum
T3 BaT5 Green and white ringFern greenBanana yellowAbsentWhorl5.1-6.6Oblong1.2-2.6AbsentAbsentT. afroharzianum Harzianum
T4 ToT7 Creamy wooly green colonygreenCreamAbsentWhorl5.0-7.0Round1.4-2.2PresentAbsentT. asperelloides Viride
T5 PT11 Green and white colonygreenWhitePresentWhorl4.9-7.4Oblong2-3.3/1.2-1.9presentPresentT. longibrachiatum Longibrachiatum
T6 DT7 Granular granny smith appleGranny smith applecreamAbsentWhorl6.1-8Round1.4-2.9AbsentPresentT. harzianum Harzianum
T7 NaT2, MT5 Concentric green ring colonyGreenSunshineAbsentWhorl5-6.4Round1.9-2.6AbsentPresentT. afroharzianum, T. azevedoi Harzianum
T8 MT8 Concentric ringSea greenStrawAbsentWhorl4.9-7.4Round1.2-3.08absentNot clearT. inhamatum Harzianum
T9 PanT1 Sea green concentric ringSea greenCreamAbsentWhorl05-SepOblong2.5-4.1/0.9-1.9AbsentRarely PresentT. camerunense Harzianum
T10 ST43 Fern green concentric ringFern greenCanary yellowPresentWhorl5-8.1Oval2.2-3.2/1.2-2.9PresentPresentT. asperellum Viride
T11 ST10, SolT21, MT4, MT30, MT11, BaT9 Fern green concentric ringFern greenDijon pigmentAbsentWhorl4.9-9.5Round0.9-1.9PresentRarely PresentT. afroharzianum Harzianum
T12 DT22 White center and fern greenFern greenCreamAbsentWhorl5.5-7.6Round1.02-2.17AbsentPresentT. koningii Viride
T13 SaT4 Granular fern green ringFern greenBanana yellowAbsentWhorl6.6-11.7Round1.2-2.9AbsentAbsenT. atroviride Viride
T14 SolT24b Concentric granny smith apple colonyGranny smith apple greenSandAbsentWhorl4.3-7.9Round.6-1.7AbsentPresentT. afroharzianum Harzianum
T15 PanT2 Granular green and white colonyFern greenTangerineAbsentWhorl5.8-10.4Oblong1.2-3.8/1.2-1.9absentPresentT. asperelloides Viride
T16 MT9 Wooly white colonyFern greenPumpkin orangePresentWhorl aggregate6.3-8.8Round1.02-2.9AbsentRarely presentT. asperellum Viride
T17 ToT11 Granular fern green colonyFern greenMustard yellowAbsentSolitary5.2-9.9Oblong2.3-3.6/0.9-1.9AbsentAbsentT. longibrachiatum Longibrachiatum
T18 PT13 Wooly white colonyWhiteSunshineAbsentWhorl4.8-6.7Oblong2.5-3.6/.9-1.9PresentPresentT. afroharzianum Harzianum
T19 ST6 Green concentric ringgreensunshineAbsentWhorl5.5-7.9Round.9-1.9AbsentPresentT. afroharzianum Harzianum
T20 MT15 Sea green ring colonySea greenstrawAbsentWhorl7.7-10.6Round1.2-2.2AbsentPresentT. brevicompactum Brevicompactum
T21 KT11, ST20 Fern green colonyFern greenBanana yellowAbsentWhorl7-9.6Round1.9-4AbsentPresentT.asperellum Viride
T22 NaT7 Fern green and white granular colonyFern greenCanary yellowAbsent2-3in Whorl6.2-8.8Round1.9-3.3AbsentRarely PresentT.asperellum Viride
T23 KT6, SolT6b Granular green and white colonyFern greenCream baseAbsent2-3 in Whorl6.8-8.7Round1.6-3.3PresentPresentT. asperellum Viride
T24 ST3 Wooly green colonyGreenCanary yellowAbsentSolitary6.2-7.7Round1.3-2AbsentPresentT. afroharzianum Harzianum
T25 KT13 Granular green and white colonyFern greenwhiteAbsentSolitary/2-3whorl5.5-8.4Round1.2-2.9AbsentPresentT. asperellum Viride

Morphological variations were observed among different groups of Trichoderma isolates ( Table 1).57 Illustrations of colonies grown in PDA Petri plates are shown in Plate 1.56 Various diffusible pigments were observed, displaying different colors, which were compared to the Audrey & Bear Color Chart (https://audreyandbear.com/products/audrey-bear-color-chart). In the Harzianum clade, which includes species such as T. afroharzianum, T. lentiforme, T. camerunense, T. inhamatum and T. azevedoi colonies exhibited 1-2 concentric rings with the production of green-colored conidia. No diffusible pigments were detected in PDA medium, and a coconut odor was also not noticeable. The conidia were oval to oblong and ranged from 0.6-4.1μm. Within the Viride clade, comprising species like T. asperellum, T. asperelloides, T. koningii and T. atroviride colonies on PDA displayed a somewhat granular appearance with green and white regions distributed throughout the plate. No diffusible pigments were detected in the PDA medium, but coconut odor was found in some groups and absent in others ( Table 1).57 The conidia were generally round and ranged from 1-4 μm. The T5 and T17 groups of isolates displayed white mycelium with green pustules and produced yellow diffusible pigments, classifying them within the Longibrachiatum clade. Conidia in this group were oblong and ranged from 2-3.9 μm. Isolates from T20 group were challenging to differentiate and were grouped together, with conidia measuring 1.2-2.2μm. Phialides were flask-shaped in both the Harzianum and Viride clades and were present in whorls in almost all species, except in ST3 (T. afroharzianum) and ToT11(T. longibrachiatum), where they were solitary.

The Harzianum clade was found within an altitudinal range of 80-1800 masl, spanning from lowland plains to hilly regions, and was common in both tropical and temperate regions ( Table 2).57 Similarly, the Viride clade were also identified in both tropical and temperate regions, with altitudes ranging from between 90-1475 masl, which was generally lower than that of the Harzianum clade. Isolates of the T20 group (T. brevicompactum) were primarily located in lowland plains (at 80 masl), rather than in higher mountain region, whereas T. longibrachiatum was primarily found in mid-hill regions, with altitudes ranging from 1300-1500 masl ( Table 2).57 However, morphological characteristics alone proved insufficient for distinguishing between the various Trichoderma isolates. Therefore, molecular identification was required to differentiate among complex and overlapping Trichoderma isolates.

Table 2. Details of selected Trichoderma isolates from different altitudinal regions with their corresponding geographic locations, isolate names and GenBank accession numbers.

SpeciesIsolateGPS locationAltitude (masl)DistrictGen bank Accession No.
ITStef-1α
T. afroharzianum ST326.54N 87.12E80SunsariOR140790OR567133
T. afroharzianum ST626.7N 87.28E95SunsariOR140791OR567134
T. afroharzianum ST1026.58N 87.18E113SunsariOR140792OR567135
T. afroharzianum MT426.6N 87.32E82MorangOR140793OR567136
T. afroharzianum MT1126.46N 87.34E100MorangOR140794OR567137
T. afroharzianum MT3026.48N 87.27E80MorangOR140795OR567138
T. afroharzianum BaT527.69N 85.25E1360KathmanduOR140796OR567139
T. afroharzianum BaT927.69N85.25E1312Kathmandu- OR567140
T. afroharzianum NaT227.65N 85.51E1605KavrepalanchokOR140797OR567141
T. afroharzianum PT1327.59N 85.51E1510Kavrepalanchok- OR567142
T. afroharzianum SolT24b27.44N 86.59E1800SolukhumbuOR140798OR567143
T. lentiforme ST4926.69N 87.09E80SunsariOR140799OR567144
T. inhamatum MT826.56N 87.49E127MorangOR140800OR567145
T. camerunense PanT127.63N 85.55E975KavrepalanchokOR1407801OR567146
T. asperellum ST2026.65N 87.28E113SunsariOR1407802OR567147
T. asperellum ST4326.55N 87.12E92SunsariOR1407803OR567148
T. asperellum MT926.66N 87.6E100MorangOR1407804OR567149
T. asperellum KT1327.66N 85.29E1413KathmanduOR1407805OR567150
T. asperellum ToT727.75N 85.34E1339KathmanduOR1407806OR567151
T. asperellum ToT827.77N 85.33E1339KathmanduOR1407807OR567152
T. asperelloides PanT227.63N 85.61E925KavrepalanchokOR1407808OR567153
T. asperelloides KT1127.68N 85.27E1370Kathmandu- OR567154
T. atroviride SaT427.64N 85.48E1475Kavrepalanchok- OR567155
T. brevicompactum MT1526.49N 87.29E80MorangOR140809OR567156
T. azevedoi MT526.49N 87.29E100MorangOR140810OR567157
T. harzianum DT727.68N 85.93E2500SindhupalchokOR140811-
T. afroharzianum SolT2127.54N 86.57E2300SolukhumbuOR140812-
T. asperellum KT627.68N 85.27E1335KathmanduOR140813-
T. asperellum NaT727.65N85.51E1624KavrepalanchokOR140814-
T. asperellum SolT6b27.52N 86.58E2365SolukhumbuOR140815-
T. koningii DT2227.68N 85.93E2500SindhupalchokOR140816-
T. longibrachiatum ToT1127.75N 85.33E1349KathmanduOR140817-
T. longibrachiatum PT1127.59N 85.51E1520KavrepalanchokOR140818OR567158

Molecular characterization and phylogenetic studies of Trichoderma isolates

Trichoderma isolates were further identified using molecular sequencing data of ITS rRNA and tef-1α genes. Out of 33 strains, PCR and bidirectional sequencing were successfully completed for 29 presumptive isolates by ITS oligonucleotide barcode identification (OR140790-OR140818) and for only of 26 isolates using tef-1α (OR567133-OR567158). The average consensus sequence length for tef-1α was 663 bp, while for the ITS rRNA, it was 646 bp. Nucleotide BLAST analysis and pairwise alignments of the ITS rRNA and tef-1α sequences identified the Trichoderma isolates as belonging to T. harzianum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. atroviride, T. asperellum, T. asperelloides, T. brevicompactum, T. koningii and T. longibrachiatum which shared 97-100% identity match with published sequences in the NCBI database.

The phylogenetic tree ( Figure 4) based on ITS rRNA unambiguously identified 11 species among the 29 isolates, based on their clustering with reference taxa. The isolates identified in the analysis included T. harzianum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. asperellum, T. asperelloides, T. brevicompactum, T. koningii and T. longibrachiatum. Although the ITS rRNA tree could not clearly delimit the species resolution of the isolates MT8, ST49, MT5, and PanT1, however there were clear and distinct resolution of other isolates ( Figure 4). The phylogenetic tree ( Figure 5) obtained from the tef-1α region identified 10 species among the 26 isolates, which included T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. atroviride, T. asperellum, T. asperelloides, T. longibrachiatum and T. brevicompactum. The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp), produced four distinct, well supported clades with bootstrap values higher than 70%: Harzianum, Viride, Longibrachiatum and Brevicompactum clades ( Figure 6).

ae36fe4f-b4ab-4ec5-bcf4-5d0728b08c8d_figure4.gif

Figure 4. Phylogenetic tree of 29 Trichoderma isolates based on ITS rRNA sequences.

ae36fe4f-b4ab-4ec5-bcf4-5d0728b08c8d_figure5.gif

Figure 5. Phylogenetic tree of 26 Trichoderma isolates based on tef -1α gene sequences.

ae36fe4f-b4ab-4ec5-bcf4-5d0728b08c8d_figure6.gif

Figure 6. Phylogenetic tree of 22 Trichoderma isolates based on tef-1α -ITS gene sequences.

Thus, based on above three phylogenetic trees, four clades were identified: Harzianum, Viride, Brevicompactum and Longibrachiatum clades. Eighty-five isolates belonged to the Harzianum clade, consisting of T. afroharzianum (64 isolates), T. harzianum (3 isolates), T. lentiforme (1 isolate), T. camerunense (11 isolates T. inhamatum (5 isolates), and T. azevedoi (1 isolate). The Viride clade included 67 isolates, comprising species such as T. asperellum (57 isolates), T. asperelloides (6 isolates), T. atroviride (1 isolate), and T. koningii (3 isolates). The Longibrachiatum clade comprised 11 isolates, all belonging to the T. longibrachiatum. The Brevicompactum clade consisted of 4 isolates, all of which were identified as T. brevicompactum ( Table 3).57 Among these, T. afroharzianum was the most abundant species in this study, followed by T. asperellum.

Table 3. List of total number of Trichoderma isolates used for morphological characterization.

S. No.Code groupNo. of isolates present in code groupName of all isolates in code groupNumber of representative isolates takenIsolates name taken for molecular characterization Species name
1T13ToT8, NaT6, ST181ToT8T. asperellum
2T21ST491ST49T. lentiforme
3T33ST7, BaT5, MT391BaT5T. afroharzianum
4T45SaT7, ToT7, SolT3, SolT25, ST39a1ToT7T. asperelloides
5T56ST38, PanT4, PT11, ToT9, PT14, ST8a1PT11T. longibrachiatum
6T63LaT9, DT7, SolT101DT7T. harzianum
7T714NaT2, MT31, SaT6, NaT1, NaT5, ST2 NaT3, MT33, ST49a, SolT12a, ST9, SaT2, MT18, MT52NaT2, MT5T. afroharzianum, T. azevedoi
8T85ToT6, SolT26a, ST11, MT8, ToT42MT8T. inhamatum
9T911ST40, MT28, MT29, DT19, SolT6a, ST13, PanT1, DolT14, ToT1, ST27, KT21PanT1T. camerunense
10T107KT1, ST5, ST46, KT7, ST8b, ST39b, ST431ST43T. asperellum
11T1131MT2, MT3, BKT4, MT46, BktT8, MT13, SaT1, ToT5, ST24, ST21, BaT9, SaT9, ST25, SolT14a, ST28, MT1, MT4, MT6, PT4, ST22, MT11, MT49, MT30, MT12, ST10, ST23, MT23, SolT21, MT37, MT19, MT486SolT21, ST10, MT30, MT4, BaT9, MT11T. afroharzianum
12T123ST1, PT6, DT221DT22T. koningii
13T131SaT41SaT4T. atroviride
14T141SolT24b1SolT24bT. afroharzianum
15T151PanT21PanT2T. asperelloides
16T161MT91MT9T. asperellum
17T175PanT6, ST48, ST38, ST19, ToT111ToT11T. longibrachiatum
18T187PT13, DT24, DT31, DT26, SolT22, ST50, ST151PT13T. afroharzianum
19T196LaT3, ST12, KT12, ST6, ST4, ST231ST6T. afroharzianum
20T204MT10, MT14, MT17, MT151MT15T. brevicompactum
21T2127BaT6, BaT12, ST26, LaT11, DT10, BaT3, MT44, PanT5, DT20, DT11, LaT4, PT5, NaT9, DT39, SolT7, MT24, SolT26b, DolT3, SaT3, ST20, SolT15, DolT23, BktT1, KT11, PanT9, SolT12b, DolT23ST20, KT11T. asperellum
22T226ST47, KT4, NaT7, SolT18, ST35, PanT81NaT7T. asperellum
23T2312MT21, KT6, SolT6b, BktT5, BktT11, ST34, BktT3, DolT18, SolT13, SolT12c, BaT11, LaT122KT6, SolT6bT. asperellum
24T243BaT1, ST3, MT411ST3T. afroharzianum
25T251KT131KT13T. asperellum
TotalN = 25N = 167N = 33

Analysis of the diversity among Trichoderma species

Table 4 shows Simpson’s biodiversity index (D), Shannon’s biodiversity index (H), evenness (J), and the abundance index (E) for various agricultural fields in different ecological zones. The highest species diversity and evennesswere recorded in the high mountain region, with Shannon’s index (H) of 1.724, evenness (J) of 0.84 and Simpson’s index (D) of 0.28). Following this the hilly region which exhibited the Shannon’s index of 1.563, eveness of 0.7 and Simpson’s index of 0.28. In contrast, the plain region had the lowest species diversity with Shannon’s and Simpson’s diversity indices and evenness estimated to be H = 1.515, J=0.66, D = 0.33. The species abundance values were E = 2.11 for the plain, E = 1.95 for mid-hill and E = 1.99 for the high mountain region. The dominance values (Y) of T. afroharzianum T. asperellum, T. camerunense and T. longibrachiatum were 0.04, 0.03, 0.01, and 0.01 respectively and they were classified as the principal species. On average, the diversity values for Trichoderma species were H = 1.61, D = 0.29, J = 0.74, and E= 2.02 ( Table 4). Simpson’s index (1-D) and the evenness index were close to 1 in all regions except for the plain region, indicating a very high diversity of Trichoderma species in the major agricultural areas of Nepal. The number of species and isolates, as well as the dominant species of Trichoderma, varied geographically ( Table 5) revealing that the mid hill and high mountain regions have a high diversity of Trichoderma species.

Table 4. Univariate diversity indices of Trichoderma isolates from different altitudinal region of Nepal.

Ecological indicesEcological regions
PlainMid-hill High mountain Average
Simpson’s index (D)0.33 (1-D = 0.67)0.28 (1-D = 0.72)0.28 (1-D = 0.72)0.29
Shannon’s index (H)1.5151.5631.7241.61
Pielou's evenness (J)0.660.720.840.74
Abundance index (E)2.111.951.992.02

Table 5. Details of Trichoderma isolates from different altitudinal regions.

Trichoderma SpeciesNumber of Trichoderma isolates
PlainMid-hill High altitude Total
Trichoderma arfoharzianum 3818864
Trichoderma asperellum 15261657
Trichoderma camerunense 53311
Trichoderma longibrachiatum 46111
Trichoderma asperelloides 1326
Trichoderma inhamatum 2215
Trichoderma brevicompactum 4004
Trichoderma harzianum 0123
Trichoderma koningii 1113
Trichoderma lentiforme 1001
Trichoderma azevedoi 1001
Trichoderma atroviride 0101
Total726134167

Discussion

The remarkable biodiversity found in Nepal can be attributed directly to its unique geographical position, which spans a broad spectrum of altitudinal variances and a wide array of climatic conditions. Consequently, Nepal holds a significant position as one of the world’s important biodiversity hotspots. The fungal genus Trichoderma has been extensively studied for its diverse metabolites and their applications in agriculture, industry and health.6 Its ability to establish beneficial interactions with plants and produce bioactive compounds makes it a valuable resource for sustainable and eco-friendly solutions in multiple sectors.27,28,58 However, there have been very few studies on the diversity of Trichoderma species in Nepal compared to other parts of the world.10,15,37

In the present study, the isolates of Trichoderma (n = 167) isolated from soils of different ecological zones were categorized into three clades based on their morphological characterization: Harzianum, Viride and Longibrachiatum. However, some isolates were challenging to differentiate and were not assigned to any specific clade (T20). Our observations in terms of morphological characterization align with the previous studies on these species.40,59 The use of a single method for identifying Trichoderma species can present challenges and potential issues. To address this concern, Bissett proposed integration of both morphological and molecular studies.60 This combined approach allows for a more comprehensive and accurate species-level classification within Trichoderma spp. In our study, species were identified following previous studies that utilized ITS and tef-1α sequencing.61 Using molecular approaches, we were able to clearly identify some cryptic species, and we also distinguished isolates that could not be identified solely based on morphological features.

Trichoderma species are typically identified through gene sequence analysis, with the generally accepted practice being the use of two gene sequences. However, recent studies suggest that the identification of new Trichoderma species may require the analysis of at least three DNA gene sequences.62,63 In this particular study, 33 Trichoderma isolates were selected from a pool of 167 isolates isolated from soil samples that were collected from various regions of Nepal. To identify these isolates, we analyzed two DNA gene sequences: the ITS rRNA and the tef-1α genes. This analysis involved comparing the obtained sequences with those available in the NCBI database using BLASTn analysis. It has been observed that relying solely on individual gene sequences, such as ITS rRNA or tef-1α , is insufficient for accurately distinguishing all Trichoderma species.

The phylogenetic analysis using ITS rRNA and tef-1α regions revealed significant insights into the diversity and taxonomy of Trichoderma isolates. The ITS tree identified 11 species among 29 isolates, clustering most with reference taxa; however, it could not resolve species for four isolates (MT8, ST49, MT5, and PanT1), indicating its limitations for closely related species. In contrast, the tef-1α tree identified 10 species among 26 isolates, offering better resolution, particularly for closely related taxa such as T. atroviride and T. asperelloides. The maximum likelihood tree, based on a concatenated dataset (ITS + tef-1α), provided the most robust results, forming four well-supported clades: Harzianum, Viride, Longibrachiatum, and Brevicompactum. This approach demonstrated the enhanced resolution achieved by integrating multiple markers, confirming species boundaries and phylogenetic relationships. These findings emphasize the complementary roles of ITS and tef-1α in species identification and highlight the importance of combined datasets for accurate classification. Future work can expand on these results using whole-genome sequencing to further refine taxonomy and explore functional diversity.

As a result, we used a combination of ITS rRNA and tef-1α gene sequences, for a more comprehensive understanding of Trichoderma species distribution. In BLASTn searches, ITS sequences did not provide sufficient resolution of Trichoderma phylogeny for some species, such as the T. harzianum complex. However, the concatenated dataset (ITS-tef-1α ) produced four well-supported clades. The resulting tree grouped together the same or closely related species into distinct clades. The comparison of test and conference taxa aligned with earlier reports.12,64,65 The findings revealed similarities among Trichoderma species, with the out-group sequence of Fusarium oxysporum forming dissimilar clusters. Although tef-1α sequencing provided a clear picture of Trichoderma phylogeny, the predominant species complex (T. harzianum complex) comprises multiple cryptic species.66,67 The T. harzianum complex has undergone significant revision in recent times, resulting in the classification of T. harzianum into 14 distinct species.68,69

In this research, we conducted a comprehensive examination of the diversity of indigenous Trichoderma species found in the rhizospheric soil across different districts of Nepal, taking into account variations in altitude. We assessed Trichoderma species diversity, which is defined as the product of the evenness and the number of species, using the Shannon biodiversity index -H.53 To evaluate the dominance of individual species, we calculated Simpson’s diversity index,52 which indicates the probability that two randomly selected species from a given ecosystem will belong to different categories. We also used Margalef’s abundance index to assess species richness and the Pielou index to determine the evenness of the Trichoderma population. The diversity and occurrence of Trichoderma species reported from different agroclimatic zones of Nepal, namely, the plain (80-141 masl), mid-hill (1284-1650 masl), and high mountain (1800-2500 masl) regions, clearly indicate that climatic topography and soil type are major factors influencing the distribution of Trichoderma species.

The present study aimed to assess the suitably of several widely used diversity indices for various types of statistical analyses. We conducted both simple and multifaceted statistical analyses to determine if certain indices were better suited for specific types of analyses. Notably, Simpson’s index(1-D) and the evenness index approached 1 in the mid-hill and high mountain regions, except in the plain region. This observation suggests a remarkably high diversity of Trichoderma species in the major agricultural areas of Nepal, particularly in the mid-hill and high mountain regions. This is obvious that mountains and hills have high climatic diversity due to latitudinal variation compared to plain and harbor higher diversity of Trichoderma species compared to plain.

These findings underscore the substantial diversity of Trichoderma species in these specific regions. Interestingly, Shannon’s index yielded quite similar values (~1.5) in the plain and mid-hill regions, which could be attributed to the extensive disturbance caused by human activities in both regions. The results of this study indicate that Trichoderma spp. diversity and habitat preference can serve as natural indicators of rhizosphere soil health. Moreover, our findings align with the research conducted by Ma51 in Chinese grasslands of China and Mulatu70 in Ethiopian coffee ecosystems. This diversity analysis of Trichoderma strains will facilitate the improved identification of Trichoderma species with biocontrol mechanisms, which can, in turn, contribute to the development of suitable bioformulations in sustainable agriculture.

The number of Trichoderma species and isolates, as well as the dominant species, varied significantly across different geographical regions. The plain region (80-141 masl) encompasses two districts, Sunsari and Morang. In this region, we identified a total of six different species of Trichoderma: T. afroharzianum, T. lentiforme, T. inhamatum, T. asperellum, T. brevicompactum and T. azevedoi. We found a total of 72 isolates in the plain region, with T. afroharzianum (38 isolates) being the dominant species. The mid-hill region (1284-1650 masl) includes four main districts: Kathmandu, Lalitpur, Bhaktapur, and Kavrepalnchok. Here we identified six different types of Trichoderma species: T. afroharzianum, T. camerunense, T . longibrachiatum, T. asperellum, T. asperelloides and T. atroviride with total of 61 isolates. In the mid-hill region, T. asperellum (26 isolates) was the dominant species. The high mountain region (1800-2500 masl) comprises two districts, Solukhumbu and Sindhupalchok. In this region, we found only four Trichoderma species: T. harzianum, T. afroharzianum, T. asperellum and T. koningii, with a total of 34 isolates. In this region, T. asperellum (16 isolates) was the dominant species. The presence of these Trichoderma species in the rhizospheric soils of vegetables in Nepal can be attributed to the diverse ecological substrates and climate conditions in the country’s vegetable crop growing areas. Our results suggest that these areas provide an optimal environment for the survival and colonization of a diverse group of Trichoderma species. Trichoderma afroharzianum (39.0%) was found to be the most widely distributed and abundant species in our study. The occurrence of Trichoderma species is influenced by various factors, including metabolic diversity, reproductive capabilities, substrate availability and the competitive abilities of Trichoderma isolates in natural ecosystems.

In the present, we identified nine new country record of Trichoderma species: T. afroharzianum T. harzianum, T. lentiforme, T. inhamatum, T. camerunense, T. atroviride, T. brevicompactum, T. longibrachiatum and T. azevedoi. However, these species have previously been described in regions across the world, including America,67,71,72Asia,10,15,16Africa9,33,70and European Mediterranean countries.24,44 During this study, we reisolated some species, including T. asperellum, T. asperelloides and T. koningii, along with nine additional species. However, two previously reported species, T. rugulosum and T. lixii were not found in this study.10,37 The Harzianum clade contained economically important species such as T. harzianum, T. afroharzianum, T. camerenunse, T. lentiforme and T. inhamatum, which are used in agriculture as biological control agents. The Viride clade included T. asperellum, T. asperelloides, T. koningii and T. atroviride. The Longibrachiatum clade consisted of T. longibrachiatum, while the Brevicompactum clade with T. brevicompactum. T. longibrachiatum has high optimal and maximum growth temperatures and exhibits yellow reverse pigmentation due to the production of secondary metabolites such as pyrone. T. brevicompactum is utilized in the production of various antimicrobial substances, offering significant agricultural, health, and environmental benefits.

In this study, we obtained isolates of T. harzianum, T. afroharzianum, T. inhamatum, T. lentiforme, T. azevedoi, T. camerunense, T. asperellum, T. asperelloides, T. atroviride, T. koningii, T. longibrachiatum, and T. brevicompactum from various crop ecosystems. Notably, T. afroharzianum and T. asperellum were most widely distributed species in our study. However, previous studies in crop ecosystems in Nepal have reported T. asperellum and T. asperelloides as the most widely distributed species of this genus.37 It is worth noting that among these reported species, only T. asperellum, T. asperelloides and T. koningii have been previously documented in Nepal.10,37

Conclusion

This study presents novel findings regarding the presence of Trichoderma species in the Himalayan foothills of Nepal at different altitudes in previously unexplored geographic regions. However, it is important to note that our observations provide only a limited glimpse into the overall diversity of Trichoderma in Nepal. Despite being recognized as a biodiversity hotspot, fungal diversity in this region remains poorly understood. To gain a more comprehensive understanding, further investigations involving the isolation of Trichoderma from various substrates like forest areas and high-altitude areas in Nepal are highly recommended. Such endeavors are likely to unveil a multitude of additional species, some of which may be previously unknown. These new discovered taxa hold significant potential for various biotechnological applications and can contribute to further advancements in this field.

Author information

Authors and Affiliations

Puja Jaiswal

Central Department of Zoology, Tribhuvan University, Kirtipur, Nepal

Ram B. Khadka and Suraj Baidya

National Plant Pathology Research Center, Nepal Agricultural Research Council, Khumaltar, Nepal

Aashaq Hussain Bhat

Department of Bioscience, University Centre for Research and Development, Chandigarh

University, Punjab, India

Arvind Kumar Keshari

Department of Zoology, Patan Multiple Campus, Tribhuvan University, Lalitpur, Nepal

Author’s contributions

Puja Jaiswal conceptualized, did data curation, formal analysis, investigation, methodology, validation and writing original draft. Ram Bahadur Khadka worked on conceptualization, formal analysis, investigation, methodology, project administration, resources, supervision, and validation of the study. Suraj Baidya helped with writing, review and editing the manuscript. Aashaq Hussain Bhat did formal analysis, validation and writing, review and editing the manuscript. Arvind Kumar Keshari conceptualization, project administration, resources, supervision, validation, writing, review and editing the manuscript. All authors read and agree to the final draft of the paper.

Ethics and consent

The present study didn’t involve the use of human and animals so ethical approval and consent were not required.

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 24 Sep 2024
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Jaiswal P, Khadka RB, Hussain Bhat A et al. Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 2; peer review: 1 approved, 2 approved with reservations]. F1000Research 2025, 13:1088 (https://doi.org/10.12688/f1000research.153701.2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 09 Jan 2025
Revised
Views
9
Cite
Reviewer Report 27 Jan 2025
Yunus Korkom, Aydın Adnan Menderes University, Aydin, Turkey 
Approved
VIEWS 9
I have no new ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Korkom Y. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 2; peer review: 1 approved, 2 approved with reservations]. F1000Research 2025, 13:1088 (https://doi.org/10.5256/f1000research.176431.r357675)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
12
Cite
Reviewer Report 24 Jan 2025
Eder Marques, Federal University of Goiás, Campus Samambaia, Goiânia, Brazil 
Approved with Reservations
VIEWS 12
The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study.

Abstract – diversify repeated keywords

Introduction
Some references do not relate to ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Marques E. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 2; peer review: 1 approved, 2 approved with reservations]. F1000Research 2025, 13:1088 (https://doi.org/10.5256/f1000research.176431.r359924)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 05 Mar 2025
    Ram Khadka, National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal
    05 Mar 2025
    Author Response
    Reviewer 3
    The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study.
    Response: We sincerely appreciate your time and effort in ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 05 Mar 2025
    Ram Khadka, National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal
    05 Mar 2025
    Author Response
    Reviewer 3
    The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study.
    Response: We sincerely appreciate your time and effort in ... Continue reading
Version 1
VERSION 1
PUBLISHED 24 Sep 2024
Views
14
Cite
Reviewer Report 25 Nov 2024
Raja Asad Ali Khan, School of Breeding and Multiplication (Sanya Institute of Breeding and Multiplication), Hainan University, YaZhou, China 
Approved with Reservations
VIEWS 14
The manuscript provides insights into the diversity of Trichoderma species in agricultural zones across Nepal, integrating morphological and molecular approaches. The research is robust and presents significant findings with potential applications in sustainable agriculture. However, a few minor revisions are ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Khan RAA. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 2; peer review: 1 approved, 2 approved with reservations]. F1000Research 2025, 13:1088 (https://doi.org/10.5256/f1000research.168625.r331288)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 09 Jan 2025
    Ram Khadka, National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal
    09 Jan 2025
    Author Response
    Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context.
    Response: We really appreciate your valuable time to read and provide ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 09 Jan 2025
    Ram Khadka, National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal
    09 Jan 2025
    Author Response
    Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context.
    Response: We really appreciate your valuable time to read and provide ... Continue reading
Views
22
Cite
Reviewer Report 04 Oct 2024
Yunus Korkom, Aydın Adnan Menderes University, Aydin, Turkey 
Approved with Reservations
VIEWS 22
Dear Author,
The article is well written. But it would be even better with some suggestions below.
Best regards,

Comments
Introduction
“These surveys have been conducted in various locations, including Russia and the ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Korkom Y. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 2; peer review: 1 approved, 2 approved with reservations]. F1000Research 2025, 13:1088 (https://doi.org/10.5256/f1000research.168625.r327961)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 09 Jan 2025
    Ram Khadka, National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal
    09 Jan 2025
    Author Response
    Comments
    Introduction
    “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas,10,11 China,12,13 South-East Asia,14 India,15 Egypt,16 Iran,17 Philippines,18 Europe,19 Canary Islands,20 Sardinia21and South America.22”
    The following studies conducted in Turkey can be added here. ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 09 Jan 2025
    Ram Khadka, National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal
    09 Jan 2025
    Author Response
    Comments
    Introduction
    “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas,10,11 China,12,13 South-East Asia,14 India,15 Egypt,16 Iran,17 Philippines,18 Europe,19 Canary Islands,20 Sardinia21and South America.22”
    The following studies conducted in Turkey can be added here. ... Continue reading

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 24 Sep 2024
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.