ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study

[version 2; peer review: 2 approved, 1 approved with reservations]
Previously titled: Vitamin D binding protein gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study
PUBLISHED 21 May 2025
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Genomics and Genetics gateway.

Abstract

Background

Tuberculosis remains a significant global public health concern. Genetic variants influence the distribution of vitamin D in circulation, leading to vitamin D deficiency. The two extensively studied non-synonymous D-binding protein nucleotide polymorphisms rs7041 and rs4588 were found in different populations. These polymorphisms result into three different genotypes, Gc1F (rs7041(A)- rs4588(G)), Gc1S (rs7041(C)- rs4588(G)) and Gc2 (rs7041(A)- rs4588(T)). These genotypes have configurational changes that differ and therefore cause variation in the binding affinity of the vitamin D metabolite. This study aimed to compare the frequency distribution of vitamin D binding protein gene polymorphisms in patients with active Ugandan tuberculosis, individuals with latent tuberculosis infection, and those with no tuberculosis infection.

Methods

This pilot studyselected 102 samples, including 52 active tuberculosis patients, 23 latent tuberculosis individuals, and 27 individuals without tuberculosis infection, from a previous cross-sectional study. Vitamin D binding protein rs7041 and rs4588 SNPs were genotyped using Polymerase Chain Reaction and Sanger sequencing. Vitamin D binding protein gene polymorphisms were identified using BioEdit software. 7.2 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html)

Results

This study revealed no significant differences in DBP genetic polymorphisms among the study groups. The frequency distribution of the DBP gene has been reported to be 97% Gc1F, 2% Gc2, and 1% Gc1S. The frequency distribution among patients with TB was 96.2% for Gc1F, 0% for Gc1F, and 3.8% for Gc2. Among the LTBI cases, 95.7% were Gc1F, 4.3% were Gc1S, and 0%were Gc2. The Hardy-Weinberg equilibrium analysis was in equilibrium, D’= 0. P=0.2

Conclusions

The Gc1F genotype was predominantly found in the study population, with no difference in the frequency distribution according to TB status.

Keywords

Vitamin D, binding protein, gene, polymorphisms, Tuberculosis

Revised Amendments from Version 1

In the title we added the DBP SNPS to be more specific. In the abstract we added some details on the GCIF genotypes and their references. The recommendation was removed from the conclusion in the abstract. We have provided details of hypovitaminosis and sunshine exposure of the study population in the introduction section. In the methods section we have given details of the participant characteristics and enrolment period. The genotyping section was broken down in subsections to make it clearer for the readers. The name of the gene was italicised all through the article and the P values were lower cased. the statistical analysis section has an addition on why Fisher’s test was used. In the results section the social demographics section was reorganized for clarity. A section of the comparison of the DBP gene among male and female was added with Table 4 included. In the discussion a component the DBP genotypes and its affinity to vitamin D metabolite was added. More discussions on the comparison and contrast of our study have been added as well. The statement on minor alleles and their association to TB were removed, the recommendation was also removed from the conclusion.

To read any peer review reports and author responses for this article, follow the "read" links in the Open Peer Review table.

Introduction

Uganda remains among the high-burden TB/HIV countries reporting an incidence that ranges between 200-350 per 100 cases and a tuberculosis-HIV co-infection of 40%. Studies have reported vitamin D deficiency to be a risk factor for TB disease. Our previous study reported a high proportion of hypovitaminosis D among TB patients and household contacts, with the TB patients having significantly lower vitamin D levels compared to the household contacts.1 This study reported that 42% of the participants had a sun exposure of 1-7 hrs, but 52% did not have a diet with vitamin D. According to another study in Uganda, despite all-round sunshine, a high prevalence of vitamin D deficiency was reported among adult TB patient.2 Vitamin D Binding Protein (DBP), also known as group-specific component (Gc), is one of the most prevalent and significant carrier proteins of vitamin D metabolites, accounting for an estimated 85-90% of the total metabolite.36 The unbound fraction, which is the free fraction, was estimated to be less than 1%, whereas the albumin-bound fraction was approximately 10-15%.7 DBP, a member of the albumin family, is synthesized in the liver.8 This protein is considered responsible for vitamin D deficiency in target cells, as the bound fraction has a minimal impact on target cells.8,9 Other functions of DBP include actin scavenging, macrophage activation, and fatty acid transport.3

The highly polymorphic DBP gene is located at 4q12-q13, with over 120 variants.10 These genetic variations, affect the circulatory distribution of vitamin D, which leads to vitamin D deficiency.5 In various populations of the world, the two extensively studied non-synonymous DBP single nucleotide polymorphisms (SNPs) rs7041 and rs4588 exhibit variable distributions.4 These variations are located in exon 11, where 7041 encodes c.1296 T>G p.Asp416Glu, while rs4588 encodes c.1307 C>A p.Thr420Lys.11 These two variations give rise to three polymorphic isoforms, which are known to differ by lineage and include Gc1F, Gc1S and Gc2.12,13 The wild type of these SNPs is Gc1Fgenotype variations in the in Gc1F, D416E, and T420K result in, the Gc1S and Gc2 genotypes, respectively.14 Gc2 is found at locus rs4588 while Gc1F and Gc1S are found at locus rs7041.10 Previous studies have shown that people who have the rs7041 G allele as a substitute for the T allele and the rs4588 A allele instead of the C allele have higher levels of DBP and a higher affinity for vitamin D, consequently resulting in lower free and bioavailable vitamin D levels. Consequently, the DBP role controlling total, free, and bioavailable vitamin D is crucial in immunity and influences progression of disease.15

Studies have documented that vitamin D deficiency contributes to TB susceptibility, and individuals with deficiency are at a high risk of developing TB.16 Therefore, vitamin D status is implicated in the response to M. tuberculosis, and is genotype-dependent, varying across geographical areas.17

The wild-type Gc1F genotype is predominantly found in the African population, with a low frequency of Gc2 and Gc1S and is associated with low levels of vitamin D. This association is an effect of DBP concentration levels in different genetic variants. The Gc1F genotype has a low concentration of DBP with high affinity for vitamin D metabolites; consequently, low bioavailable vitamin D levels have been reported.18 Therefore, we performed a cross-sectional study to determine the frequency distribution of DBP gene polymorphisms among ATB patients, LTBI patients, and individuals without TB infection in a Ugandan population.

Methods

Study design and study setting

This pilot study was based on a previous cross-sectional study of 148 participants between the ages of 12-65 years, whose free, bioavailable, and Total vitamin D levels were measured, and a high proportion of hypovitaminosis D was reported in our previous publications.1 Of these, 102 samples were conveniently selected for genotying. The active TB patients were enrolled between July 2019 to August 2020 at Kiruddu Hospital. The LTBI individuals and healthy control samples were retrieved from the Kampala TB cohort. Details of this previous study have been reported elsewhere.19 This study was nested from a larger study that was conducted in accordance with the Declaration of Helsinki, and approval was granted by the Makerere University School of Biomedical Sciences Higher Degrees Research Ethics Committee (SBS HDREC)/#SBS-637 on 25th Jan 2019, Kiruddu Referral Hospital, and National Council of Science and Technology (HS2639) on the 31st October 2019. All experimental protocols were approved by Makerere University SBS HDREC (#SBS-637) and the National Council of Science and Technology (HS2639), as guided by the Helsinki Declaration. Written informed consent was obtained from active TB patients at Kiruddu Hospital for study participation. Informed consent was obtained from the KTB household contacts, and the parents or guardians consented on behalf of the minors.

Following the inclusion and exclusion criteria, the active TB patients who were positive on GeneXpert without deranged glucose and renal function tests were selected and 4 mls of whole blood was taken. The KTB PBMC samples of LTBI and individuals with no TB, with volumes between 0.2-1.5 mls were selected for genotyping of DBP gene polymorphisms. This was based on the availability of whole blood for ATB patients and peripheral blood mononuclear cells (PBMCs) for LTBI patients/individuals and those with no TB infection. After obtaining ethical approval and informed consent, Gen-expert-positive TB patients from Kiruddu Referral Hospital were enrolled, and samples of household contacts of LTBI Individuals with (QFN+ TST+) results and individuals with no TB infection who were (QFNTST-) from the Kampala TB (KTB) project were included in the study. Samples from patients with LTBI and those without TB infection were purposively selected. PBMC samples with adequate cells were selected for genotyping, and samples with fewer cells were excluded. Based on this, 46 samples were excluded because of inadequate sample volume and the number of cells available for successful genotyping. Individuals with an HIV+serostatus were not excluded from the study.

DBP gene genotyping

DNA extraction

The phenol-chloroform (PhCHCL3) method was used to extract DNA from whole blood samples of active TB patients, PBMCs fromLTBIpatients, and those with no TB infection.

Briefly 100 μl of 10% SDS were Dispensed in eppendorf tubes. 150μl of whole blood were then added and mixed by pipeting up and down. This was followed by incubation at 65°C for 10 min using a heat block. 100 μl of 3N Soduim Acetate were added and 5 vortexed vigorously. This was followed by addition of 700 μl of PhCHCL3. And 280 μl of PCR grade water. The tubes were inverted vigorously several times. they were then Centrifuged @ 13000 rpm for 30 min. 450 μl of the aqueous layer was Transferred to a new eppendorf tube. 1000 μl of absolute isopropanol (100%) was then added. DNA was precipitated at -80°C for 20min. this was followed by centrifuging at 14000 rpm for 30 minutes. The isopropanol was removed off leaving approx 50 μl. Add 700 μl of 70% isopropanol were added and Centrifuged @ 14000 rpm for 30 minutes. The 70% isopropanol was completely removed leaving the dry pellet. The DNA tubes were dried at 65°C. DNA was eluted in 100 μl of PCR H2O @ 65°C. It was then stored at – 80 °C for future use.

Agarose gel electrophoresis method

Agarose gel electrophoresis of human genomic DNA was performed using 1% agarose gel prepared by weighing and dissolving 1.5 g of agarose in 150 ml of 1x TAE (1% solution). The agarose was boiled thoroughly in a microwave oven for 3 minutes to allow thorough heating and mixing, and allowed to cool to 50°C at room temperature. 7.5 μl of 5 mg/ml ethidium bromide was added and mixed well by gentle agitation. The Agarose solution-ethidium bromide mixture was poured into an assembled gel casting tray with a comb attached and allowed to set at room temperature for approximately one hour. Upon setting, the gel was placed in to the electrophoretic tank and the combs vertically removed. 1x TAE buffer was poured in to the electrophoretic tank to just cover the gel. 5 μl of loading dye was added to 5 ul of each of the PCR product on the Para film, mixed and then loaded on to the wells in the gel.

While loading, the molecular weight marker was always loaded on the first lane and then the extracted human genomic DNA. The samples were run at 120 volts (constant voltages, variable current) for 30 mins. After 1 hr, the electrophoresis was stopped and the gel was carefully transferred to a UV trans illuminator for visualization.

PCR of DBP amplicons

Primers were purchased from Eurofins Genomics, Inc. Germany. The primer sequences were forward 5″AAATAATGAGCAAATGAAAGAAGAC3′ and reverse 5′ CAATAACAGCAAAGAAATGAGTAGA3′ with expected amplicons of approximately 483 bp. Mastermix preparation was performed from the pre-amplification room as follows: 25 μL of 2X Taq Master Mix, 2.5 μl of the reverse primer (6 pM) and 2.5 μl of forward primer (0.6 pM), and 15 μL of PCR water, making a volume of 45 μL for each reaction. Forty-five microliters of the master mix and 5 μL of DNA were added to each of the PCR tubes. Five microliters of PCR water was added to the negative control tube and transferred into the SimpliAmp Thermocycler for 40 cycles under the following programmed conditions: enzyme activation step 5 min at 95°C, denaturation for 20 s at 95°C, annealing for 45 s at 56°C, extension for 10 sat 72°C, Final Extension for 5 min at 72°C, and finally an infinite hold at 4°C. The amplicons were run on a 2% agarose gel, as previously described, and a product size of 483 bp was obtained ( Figure 1a and b).

Sanger sequencing

Under ambient conditions, the PCR products were sent for Sanger sequencing using the forward primer at ACGT in the United States of America. The ABI Big Dye Termination Kit (Applied Biosystems, USA) and the ABI prism 310 Genetic analyser (Applied Biosystems) was used. The sequenced chromatograms were obtained and cleaned up to remove low yield peaks. A BLAST query sequence was performed to confirm the DBP gene against that of the NCBI library. The gene products were named Homo sapiens Gc vitamin D binding protein (Gc), with sequence sizes between 414 bp and 448 bp with a percent identity of 98-99%. The DBP gene reference sequence (AH004448.2, Homo sapiens vitamin D-binding protein gene) was retrieved from the National Center for Biotechnology Information (NCBI). The raw DBP gene sequences from our analysis were aligned to the reference genome. Variant filtering was performed in which low-read regions and errors were identified. Coverage, quality scores, and proximity were also checked. Sites that differed from the reference genome and sequences were identified and sorted according to their nucleotide and amino acid composition. The detection of the presence of SNPs was performed by searching for the possible change in the codon GAT to GAG at position 416, representing the rs7041 variant, and ACG to AAG at position 420 for the rs4588 variant.

715ad98b-6c44-467e-8058-f94ec5fde79a_figure1.gif

Figure 1. a: Agarose gel electrophoresis of the 483 bp DBP gene PCR product representative of active TB patients. Lanes: L=100bp DNA ladder, NC= Negative control, 1- 10=samples from active TB patients. b: Agarose gel electrophoresis of the 483bp DBP gene PCR product representative of LTBI and those with no TB infection. Lanes: L=100bp DNA ladder, NC= Negative control, 1-10=samples from LTBI and those with no TB infection.

All the figures provided here are only found in a preprint and have not been published anywhere else. I therefore assume I do not need to request for copy right permissions.

Statistical analysis

The data were summarized using STATA software (Stata Corp. STATA 16.0, College Station, Texas, USA). Frequency and percentage (n [%]) were used to determine the frequency distribution of the DBP gene variants. Fisher’s exact test was used to compare the frequency of DBP among the study groups because of the sample size. A potential deviation from Hardy–Weinberg equilibrium was performed using the dnaSP software. V5 (http://www.ub.es/dnasp).

The p-value was considered significant at P < 0.05, with a 95% confidence interval.

Results

Socio-demographic description of study participants

A total of 102 participants were included, 52 were newly diagnosed ATB patients, 23 had LTBI and 27 had no TB infection with a median age of 28 years (IQR 12–65). The majority (44.6%) were aged between 19 and 30 years, and most were female (61.2%). Half of the participants (50.1%) had ATB. A small proportion of these were HIV-positive, 9 (18.4%). Table 1 shows the social, demographic, and clinical characteristics of the study participants and more details of the study participants have been described elsewhere.19

Table 1. Socio-demographic and clinical characteristics of study participants.

Participant characteristicFrequency n( %) Median (IQR)
Age (years)28 (12,65)
 18 and below19(18.4)
 19-3046(44.6)
 31-4022(21.3)
 Above 4015(14.5)
Sex
 Female63(61.2)
 Male40(38.8)
TB status
 No TB infection27(26.4)
 Latent TB infection23(22.5)
 Active TB52(50.1)
BCG scar
 No47(46.1)
 Yes55( 53.9)
Alcohol consumption
 No75(73.5)
 Yes27 (26.5)
Smoking
 No96(94.1)
 Yes6(5.9)
HIV status
 Negative83(81.4)
 Positive19(18.6)

Frequency distribution of the DBP rs7041 and rs4588 SNPs among active TB patients, LTBI, and those with no TB infection

A Gc1S reference sequence with the GAG codon at position 416 was retrieved from the NCBI database (Homo sapiens vitamin D-binding protein gene) for use. According to our search in BioEdit, all our sequences had the wild-type GAT codon at this position compared to the reference sequence. At position 420, all of our samples had an ACG codon, except for two samples that showed a conversion to AAG. Ninety-seven percent of the study population had rs7041 GAT and ACG for the rs4588 codons, 2% had GAT rs7041 and AAG rs4588, and 1% had rs7041 GAG and rs4588 ACG (Gc1S). Figure 2a-c show the details of this analysis and highlighted transformations. Therefore, the frequency distribution of the DBP genotypes in the study population was Gc1F, 97%; Gc, 2.2%; and Gc1S, 1%. The frequency distribution of the DBP genotypes among patients with TB was 96.2% Gc1f, 0% Gc1S, and 3.8% Gc2. Among the LTBI cases, 95.7% were Gc1F, 4.3% were Gc1S, and 0% were Gc2. For those without TB infection, the frequencies were Gc1F 100%, Gc1s 0% and 0% for Gc2. There was no statistically significant difference in the predominant Gc1F genotype among ATB patients, LTBI individuals, and those without TB infection (P=0.3). Notably, the participants with the Gc2 genotype were ATB patients with HIV coinfection. Furthermore, we also found that individuals with the Gc1S genotype had LTBI. The genotype and allele distributions of the study participants are shown in Table 2 and Table 3, respectively. The Hardy-Weinberg equilibrium analysis was in equilibrium, D’=0, P=0.2.

715ad98b-6c44-467e-8058-f94ec5fde79a_figure2.gif

Figure 2. a: A Sanger sequencing representative chromatogram of the GAT and ACG (Gc1F) genotype.

No conversion was observed in both SNPs rs7041and rs4588, The figure was generated using BioEdit 7.2 softwarehttp://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A. b: A Sanger sequencing representative chromatogram of the GAG and ACG (Gc1S) genotype. A conversion was observed in the rs7041 SNP GAT to GAG and no conversion noted in the rs4588 SNP. The figure was generated using. The figure was generated using BioEdit 7.2, http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A. c: A Sanger sequencing representative chromatogram of the GAT and AAG (Gc2)genotype. No conversion was observed in the rs7041 SNP and conversion is noted in the rs4588 SNP from ACG to AAG. The figure was generated using BioEdit 7.2 http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A.

Table 2. Genotype and allele distribution of the DBP gene among ATB patients, LTBI, and those without TB infection.

GENOTYPESALLELESActive TB patientsLTBIThose with no TB infection N Total/ P value
N= 52N=23N=27N=102
GCIFGC1F rs7041(A)- rs4588(G)50 (49%)22 (21.6%)27(26.4%)P=0.6
GCISGC1S rs7041(C)- rs4588(G)0 (0%)1(1%)0 (0%)
GC2GC2 rs7041(A)- rs4588(T))2 (2%)0(0%)0 (0)%

Table 3. Frequency distribution of DBP genotypes according to TB status.

DBP genotypesTB patients n %=52LTBI n %=23Those with no TB infection n %=27 P value
Gc1F50(96.2%)22(95.7%)27(100%)0.29
Gc1S0(0%)1(4.3%)0(0%)
Gc22 (3.8%)0(0%0(0%)

Comparison of Vitamin D Binding Protein (DBP) genotype distribution between female and male participants

The distribution of DBP genotypes (Gc1F, Gc1S, and Gc2) was similar between females and males, with no statistically significant difference observed (p=1.00). The Gc1F genotype was predominant in both sexes, being present in 96.8% of females and 97.5% of males (Table 4).

Table 4.

Distribution of DBP genotypes by gender

DBP genotypesFemale (n=62), n (%)Male (n=40), n (%) p-value
Gc1F60 (96.8)39 (97.5)1.00
Gc1S1 (1.6)0 (0.0)
Gc21 (1.6)1 (2.5)

Relatedness of the DBP reference gene sequence and study sequence data

A phylogenetic tree was constructed to determine the closeness of the sequences using the maximum likelihood method. The phylogenetic tree revealed a close relationship between the samples and the reference genes, as shown in Figure 3.

715ad98b-6c44-467e-8058-f94ec5fde79a_figure3.gif

Figure 3. Showing a phylogenetic tree indicating the relationship between the reference gene and sequence data, The figure was generated using BioEdit 7.2 http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A.

Discussion

DBP is highly polymorphic, with approximately 120 variants; however, the widely studied variants are the rs7041 and rs4588 SNPs from these three variant genotypes, Gc1F, Gc1S, and Gc2. These genotypes are the predominant source of diversity observed across different geographic locations and ethnicities. Well-documented reports have focused on multiracial populations and lack adequate information regarding homogeneous populations. Extensive research in population genetics has found that the frequency of the Gc1F genotype is predominantly found in Africans and African-Americans and that Gc2 is the lowest.20 Our study showed a frequency distribution of 97% of the Gc1F genotype, 2% of the Gc2 genotype, and 1% of the Gc1S genotype in the population. This is consistent with the genotype frequency distribution of African Black populations. This finding is comparable to that of two West African studies in Gambia, with a nearly homogeneous population like ours. They reported a frequency distribution of 86.0% and 83.3%, respectively, and another study from South Africa reported 80.0%.13,21,22 However, these studies had a larger sample size than the current study. Similarly, findings from a study among Black Americans and whites showed a frequency distribution of 92.7% for the Gc1F genotype among Blacks (2.1%) and Gc2 (2%). In contrast, the same study found a high-frequency distribution of Gc1S among the white population.20 In contrast, a study performed among the Eurasian population found the Gc1F genotype to be the lowest (13.7%) and the highest was Gc1S.18 Correspondingly, astudy from Finland reported a low frequency of Gc1F (3.7%).23 The above observations show that DBP polymorphisms are ethnically based; therefore, diverse effects on vitamin D metabolites are likely to be observed. This study did not find a statistically significantdifference in the frequency distribution of the Gc1F DBP genotype among the three study groups (P=0.3). This finding is similar to that of a study from Pakistan that reported a non-significant association of DBP with TB (P=0.3).24 However, we noted that the Gc2 genotype was only found among active TB patients with HIV coinfection. This finding is comparable to that of the previously mentioned South African study that reported an association between the Gc2 genotype and TB status among Asians.25 Furthermore, a recent study in China exploring vitamin D pathway gene polymorphisms found that the DBP Gc2 genotype was associated with progression to pulmonary TB.32 Moreover, in our study, the Gc1S genotype was detected in the LTBI group. Therefore, these findings suggest that the minor alleles in our population have a genetic association. The Gc1F genotype is predominant in the black population; therefore, it is worth mentioning that our population was consistent with the Hardy-Weinberg equilibrium, and the frequency distribution observed is possibly a representation of our study population. Consequently, in addition to genetic predisposition, environmental, social, and economic factors may play a major role in TB susceptibility in the population.

Regarding the HIV sub-analysis, no statistical significance was found among the genotypes and TB status. Similarly, from our previous study no significant difference was observed in vitamin D levels among the HIV and none HIV.26,27

Considering the analysis of sex and the DBP gene, no statistical difference was observed in the frequency distribution among male and female participants (P=0.07). This observation is similar to that of a study in India on TB patients.28

With reference to genetic polymorphisms and vitamin D metabolites, the Gc1F genotype is predicted to have high affinity for total vitamin D compared to others.29 In our study free and bioavailable vitamin D levels, the Gc1F and Gc1S were associated with higher free and bioavailable vitamin D levels compared to the Gc2 which had the lowest (Data not shown). This finding may be closely similar to a study that found higher levels in the same genotypes compared to Gc2, nonetheless, they measured total vitamin D not free and bioavailable levels.30 On the contrary, a study from Finland with adjustments parameters reported the Gc2 genotype to have the highest free and bioavailable vitamin D levels and the Gc1F the lowest.31 A study from Saudi Arabia among postmenopausal women reported similar findings of no association between the DBP gene polymorphism and free and bioavailable vitamin D levels.27 Furthermore, another study from the same region reported that free and bioavailable vitamin D levels differed according to minor and major rs7041 and rs4588 alleles.26

We acknowledge that the small sample size and homogeneous population of the current study could have contributed to the less significant effect size needed to detect minor alleles, as observed. Further research is warranted in a larger homogenous and heterogeneous population to increase the probability of detecting minor alleles in the population in order to adequately determine their functional significance and their role in TB pathogenesis. This is important for TB control and prevention. We did not eliminate HIV positive individuals during the selection of the study participants therefore do not know their impact as confounders although this did not reveal in the sub analysis. Therefore, future studies should consider larger sample sizes to increase the probability of detecting minor alleles in the population. The strength of this study is that it is the first to determine DBP gene polymorphisms in the Ugandan population of active TB patients, LTBI, and household contacts, providing an adequate representation of TB status.

Conclusion

The frequency distribution of the DBP and Gc1F genotypes was predominantly found in the study population, with no statistically significant difference among the ATB patients, LTBI patients, and those with no TB infection.

Ethical approval and informed consent

This study was nested from a larger study that was conducted in accordance with the Declaration of Helsinki, and approval was granted by the Makerere University School of Biomedical Sciences Higher Degrees Research Ethics Committee (SBS HDREC)/#SBS-637 on 25th Jan 2019, Kiruddu Referral Hospital, and National Council of Science and Technology (HS2639) on the 31st October 2019. All experimental protocols were approved by Makerere University SBS HDREC (#SBS-637) and the National Council of Science and Technology (HS2639), as guided by the Helsinki Declaration. Written informed consent was obtained from active TB patients at Kiruddu Hospital for study participation. Informed consent was obtained from the KTB household contacts, and the parents or guardians consented on behalf of the minors.

Authors’ contributions

Conceptualization: E.L.A., Data curation: E. L. A., Formal analysis: E. L. A., A. A., R.B. S. N., A. O., Funding Acquisition: E.L.A., D.P. K., Investigation: E.L.A., Project Administration: E.L.A., I.A.B., W.W., D.P.K., M.L.J., Methodology: E. L. A., A. A., R.B.S.N., A.O. K. B., Resources: E.L.A., I, A.B., A.A., R.B. S. N., Software: M. B., A.A. K. B. Supervision: W. W., D.P. K., I. A. B., M L. J., Validation: E.L.A., W. W., D.P. K., I. A. B., M L. J., Visualization: E.L.A., A.A.R.B. S. N., M.B., K.B., A.O., Writing – original draft: E. L. A., Writing – review & editing: All authors reviewed the manuscript.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 04 Feb 2025
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Ester AL, Moses JL, Akintola A et al. Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2025, 14:154 (https://doi.org/10.12688/f1000research.160839.2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 21 May 2025
Revised
Views
1
Cite
Reviewer Report 11 Dec 2025
Habtamu Milkias Wolde, School of Medicine, Department of Precision Medicine, SungKyunKwan University, Suwon, Seoul, South Korea 
Approved
VIEWS 1
Comment

This is an interesting study that investigates the distribution of Vitamin D binding protein gene polymorphism among patients with active TB, latent TB and individuals with no TB infection in Uganda. It’s known fact that ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Wolde HM. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2025, 14:154 (https://doi.org/10.5256/f1000research.182062.r434456)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
3
Cite
Reviewer Report 24 Jun 2025
Dina Keumala Sari, Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia 
Approved
VIEWS 3
I think this paper already fulfill the ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Sari DK. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2025, 14:154 (https://doi.org/10.5256/f1000research.182062.r386374)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 04 Feb 2025
Views
5
Cite
Reviewer Report 13 Mar 2025
Ramalingam Bethunaickan, ICMR-National Institute for Research in Tuberculosis, Chennai, India 
Approved with Reservations
VIEWS 5
The authors studied Vitamin D binding protein gene polymorphisms in Ugandan tuberculosis patients and household contacts and reported no significant differences in DBP genetic polymorphisms among the study groups. This study needs to address the following points for better clarity.
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Bethunaickan R. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2025, 14:154 (https://doi.org/10.5256/f1000research.176796.r369604)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
10
Cite
Reviewer Report 11 Mar 2025
Dina Keumala Sari, Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia 
Approved with Reservations
VIEWS 10
Title: please add specific with the reference SNPs that stated in this study to clear which gene that involved in this research.

Abstract:
In the introduction: please state about Gc1F genotype and its Reference SNPs.
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Sari DK. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2025, 14:154 (https://doi.org/10.5256/f1000research.176796.r369603)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 04 Feb 2025
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.