Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from <i>Pseudomonas aeruginosa</i>

Érica L. Fonseca; Ana Carolina Paulo Vicente

doi:10.12688/f1000research.2-99.v1

Home Browse Polycistronic transcription of fused cassettes and identification...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa

[version 1; peer review: 2 approved with reservations]

Érica L. Fonseca¹, Ana Carolina Paulo Vicente¹

PUBLISHED 28 Mar 2013

Author details Author details

¹ Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

OPEN PEER REVIEW

REVIEWER STATUS

Abstract

The gene cassettes found in class 1 integrons are generally promoterless units composed by an open reading frame (ORF), a short 5’ untranslated region (UTR) and a 3’ recombination site (attC). Fused gene cassettes are generated by partial or total loss of the attC from the first cassette in an array, creating a fusion with the ORF from the next cassette. These structures are rare and little is known about their mechanisms of mobilization and expression. The aim of this study was to evaluate the dynamic of mobilization and transcription of the gcu14-bla_GES-1/aacA4 gene cassette array, which harbours a fused gene cassette represented by bla_GES-1/aacA4. The cassette array was analyzed by Northern blot and real-time reverse transcription-polymerase chain reaction (RT-PCR) in order to assess the transcription mechanism of bla_GES-1/aacA4 fused cassette. Also, inverse polymerase chain reactions (PCR) were performed to detect the free circular forms of gcu14, bla_GES-1 and aacA4. The Northern blot and real time RT-PCR revealed a polycistronic transcription, in which the fused cassette bla_GES-1/aacA4 is transcribed as a unique gene, while gcu14 (with a canonical attC recombination site) has a monocistronic transcription. The gcu14 cassette, closer to the weak configuration of cassette promoter (Pc), had a higher transcription level than bla_GES-1/aacA4, indicating that the cassette position impacts the transcript amounts. The presence of ORF-11 at attI1, immediately preceding gcu14, and of a Shine-Dalgarno sequence upstream bla_GES-1/aacA4 composes a scenario for the occurrence of array translation. Inverse PCR generated amplicons corresponding to gcu14, gcu14-aacA4 and gcu14-bla_GES-1/aacA4 free circular forms, but not to bla_GES-1 and aacA4 alone, indicating that the GES-1 truncated attC is not substrate of integrase activity and that these genes are mobilized together as a unique cassette. This study was original in showing the transcription of fused cassettes and in correlating cassette position with transcription.

Keywords

DNA, mRNA, ribosomes

Corresponding author: Érica L. Fonseca

Competing interests: No competing interests were disclosed.

Grant information: This work was supported by the CNPq and FAPERJ fellowship and Oswaldo Cruz Institute Grant.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2013 Fonseca ÉL and Vicente ACP. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

How to cite: Fonseca ÉL and Vicente ACP. Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [version 1; peer review: 2 approved with reservations]. F1000Research 2013, 2:99 (https://doi.org/10.12688/f1000research.2-99.v1) First published: 28 Mar 2013, 2:99 (https://doi.org/10.12688/f1000research.2-99.v1) Latest published: 27 Nov 2015, 2:99 (https://doi.org/10.12688/f1000research.2-99.v3)

Introduction

Class 1 integrons are capable of inserting, excising and rearranging gene cassettes by a site-specific recombination mechanism. These assembly platforms can also act as expression systems due to the presence of a promoter region (Pc), which drives the expression of genes captured by integron¹. Moreover, naturally occurring integrons may have a second promoter (P2), which is activated by the insertion of three G residues between -35 and -10 hexamers¹. Gene cassettes are generally promoterless units associated with a recombination site (attC or 59-be), which confers the ability of each structure to be mobilized independently². In addition, attC sites regulate the translation of downstream cassettes due to their peculiar sequences composed by imperfect inverted repeats. The formation of stem-loop structures by attC sites prevents ribosome progression throughout mRNA, reflecting in a decreased expression of more distal genes regarding Pc³. Although rare, fused cassettes may be generated by partial or total loss of the first attC, retaining both complete coding regions and, therefore, creating permanent gene arrays comparable to bacterial operons⁴. The functionality of such structures has been indirectly inferred by the resistance profile of transformants carrying the fusion⁵; however, the transcription itself has never been verified.

This study showed the dynamics of fused cassette mobilization, the co-transcription of the gcu14-bla _GES-1/aacA4 cassette array and the effect of cassette position on transcription levels in Pseudomonas aeruginosa wild lineages carrying class 1 integrons. Moreover, the presence of translation signals in this gene cassette array was determined.

Material and methods

An unknown Open Reading Frame (ORF), gcu14, followed by the fused cassette bla_GES-1/aacA4, created by partial loss of GES-1 attC were present in integrons from clinical P. aeruginosa isolates (PS1 and PS26)⁶. Total RNA was extracted and purified according to the manufacturers instructions with the SV 96 Total RNA Isolation System (Promega). Northern blot using 7 μg of total RNA from PS1 and PS26 was performed in order to detect the transcript originated from gcu14-bla_GES-1/aacA4 cassette array. After electrophoresis in a denaturing-formaldehyde 1.5% agarose gel, the total RNA was transferred to the Hybond-N⁺ nylon membrane (GE Healthcare) by upward capillary transfer. An amplicon of 519bp corresponding to part of the bla_GES-1 gene was used as a probe (Table 1) in hybridization assay. The GES probe was labeled with the AlkPhos Direct Labelling kit (GE Healthcare) and hybridized with the target RNA immobilized on the Hybond-N⁺ membrane as recommended. The chemiluminescence was detected with the CDP-Star detection reagent (GE Healthcare) according to manufactures. Immediately after applying the detection reagents, the blot was drained, incubated five minutes at room temperature and exposed to the Hyperfilm ECL (GE Healthcare) for 60 minutes at room temperature.

Table 1. Primers used in conventional, inverse and real-time PCR reactions.

Primers for conventional PCR
Primer	Primer sequence (5' – 3')	Size (bp)	Target
Ges F Ges R	GCGTTTTGCAATGTGCTC CCAGTTTTCTCTCCAACAACC	519	Internal fragment of bla_GES gene
Primers for inverse PCR^a
Gcu14 FSQ Gcu14 RSQ	AGCAATCAACACACAGGGG CTCGCGTAAATGCACCGCTT	130	gcu14 circular form
GES FSQ GES RSQ	CAAGTTATTACACAACTCAT AGTGCGTGAATGAAGCGCAT	110	bla_GES-1 circular form
AACA4 FSQ AACA4 RSQ	GCCAGGCATTCGAGCGAACAC ATTTAGCCACTCACATAGAGC	188	aacA4 circular form
Primers and probes for real time PCR (TaqMan)
RpsL F RpsL R Probe	GCCTGCGCTGCAAAACT TTTCGGCGTGGTGGTGTAT TCGTGGCGTATGCACC	67	rpsL transcripts
Gcu14 F Gcu14 R Probe	CATGCGCTTCTTGGTTCGT ACGCCAGCTTGGATGCAA ATGCCACGAGACCTT	56	gcu14 transcripts
Ges F2 Ges R2 Probe	GTGCAGCTTAGCGACAATGG CACAGAGTCGCCAATTTTACGA AATTGCAGCAGGTCCGCC	99	bla_GES-1 transcripts
AacA4 F AacA4 R Probe	CAAGCGTTTTAGCGCAAGAGT TCGGCTCTCCATTCAGCATTG CCGTCACTCCATACATTG	59	aacA4 transcripts
Ges F3 AacA4 R2 Probe	TCCTGAGCACGGACAAATAG TCATAGAGCATCGCAAGGTC TTCCGTCACACTGCGCCTCA	134	Polycistronic transcripts

^a Gcu RSQ – AACA4 FSQ and GES RSQ – AACA4 FSQ were used in combination to obtain the full length and the bla_GES-1/aacA4 fused cassette circular forms, respectively.

In order to verify whether the relative position of gene cassettes on the variable region plays a role in transcription level, real-time RT-PCR reactions using the TaqMan System (Applied Biosystems) were performed with primers and probes detailed in Table 1. The single-copy ribosomal rpsL gene of the P. aeruginosa chromosome was amplified by PCR (Table 1) and used as a reference gene for normalization. The relative quantification (RQ) results were presented as ratios of gene transcription between the target gene (cassettes) and the reference gene (rpsL), which were obtained according to the following equation: RQ=2^-ΔCT, where CT is the value corresponding to the crossing point of the amplification curve with the threshold and ΔCT=CT target gene minus CT reference gene. The effect of cassette position on gene transcription was considered significant when the ratios obtained between RQ values (RQ value of cassette 1/RQ value of cassette 2) were ≥2.0, taking into account the standard deviation intervals.

In order to induce cassette excision from integrons, PS1 and PS26 strains⁶ were submitted to thermal stress during the log growth phase to induce integrase activity. Cells were grown on Luria-Bertani (LB) broth medium (OXOID) at 37ºC for two hours. subsequently, the bacterial cultures were submitted to a heat shock at 4ºC for 30 minutes and immediately incubated at 42ºC for another 30 minutes. Briefly, the total DNA from PS1 and PS26 cultured under thermal stress were obtained with the Wizard Genomic DNA purification kit (Promega) following manufacturer recommendations and used as templates in inverse PCR reactions. The inverse PCR was performed with primers facing outwards towards the ends of gcu14, bla_GES-1 and aacA4 so that only circular gene cassette configurations would be amplified. The reactions target the circular forms of gcu14, bla_GES-1, aacA4 and bla_GES-1/aacA4 fusion by using the primers and combinations described in Table 1. The inverse PCR was performed using Platinum Taq DNA Polymerase reagents (Invitrogen), and the following components were added to a sterile 0.2-mL tube: 5 µL of 10X PCR buffer (1X final concentration); 1 µL of 10mM dNTP mixture (0.2 mM each); 1.5 µL of 50mM MgCl₂ (1.5 mM final concentration); 2 µL of 15 µM of each primer (30 µM each); 100 ng of template DNA; 0.3 µL of Platinum Taq DNA Polymerase (1U final concentration). The tubes were incubated in the Eppendorf MasterCycler (Eppendorf) at 94°C for 2 minutes and PCR amplification was performed in 40 cycles consisting of: 94°C for 30 seconds; 55 °C for 30 seconds; and 72°C for 3 minutes. The amplicons generated with the inverse PCR were purified using Wizard SV Gel and PCR Clean-Up system kit (Promega) and directly sequenced on both strands. Sequencing reactions were performed with Big Dye Terminator RR Mix (Applied Biosystems) in an ABI 3730 XL DNA Analyzer (Applied Biosystems). Nucleotide sequences were compared to those available in the GenBank database accessible on the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov). All primers used in PCR, sequencing and real time RT-PCR are described in Table 1.

Analyses in silico were performed to search for a potential promoter for gcu14 gene cassette. The 5’UTR from gcu14 were submitted to the promoter predictor programs Neural Network for Promoter Prediction version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/index.html) and BPROM (SoftBerry, http://linux1.softberry.com/berry.phtml). Results with the highest scores were selected as candidates for a putative promoter.

Results and discussion

The integrons analyzed in this study harbored a rare weak Pc configuration (PcW_TGN-10), which presents a C to G mutation 2 bp upstream of the −10 hexamer that causes an abrupt decrease in promoter strength as reported previously⁷. Considering that transcription initiates from the Pc promoter placed upstream the gcu14-bla_GES-1/aacA4 cassette array, both monocistronic and full length polycistronic transcripts could be identified. In fact, Northern blot and hybridization assays revealed a unique signal of approximately 2,300 bases which corresponds to the co-transcription of the entire array (gcu14-bla_GES-1/aacA4 ) (Figure 1). This result is in agreement with previous work in which the occurrence of transcripts containing more than one gene cassette was observed by Northern blot analysis¹. Moreover, this finding gives support to the lack of attC function in terminating transcription of downstream gene cassettes as demonstrated previously³.

Figure 1. Northern blot analysis of gcu14-bla_GES-1/aacA4 gene cassette array from P. aerginosaclass 1 integron.

The full length transcript (2,300 bases), corresponding to the entire gene cassette array, hybridized with the GES probe (arrow). The fragment sizes of the RNA marker (Promega) used in RNA electrophoresis are indicated.

This fusion retained both entire coding regions and suffered partial loss of 91 bp at the GES-1 attC site (DQ236170)⁶. Previous studies demonstrated that the attC region flanked by Left Hand (LH) and Right Hand (RH) domains, which is an imperfect inverted repeat and is missing in the bla_GES-1 recombination site, is crucial for cassette mobilization⁸. Taking into account that the region responsible for stem-loop formation was missing in GES-1 attC and the participation of this site in terminating translation³, our findings indirectly suggested that bla_GES-1 and aacA4 translation is occurring in a unique step.

Gene cassettes can be found inserted in integrons or in other secondary sites or free in the cytoplasm as a closed circle, in which the 5’ end (5’ UTR) and the attC recombination site are covalently linked⁹. As demonstrated previously, several stress conditions could evoke the activation of the SOS response resulting in integron-integrase expression¹⁰. Therefore, under stress, the integrase activity increases, favoring the occurrence of integration/excision/rearrangements events. Since the excision event depends on the recognition of the LH and RH domains of the attC site, and that these regions are missing in GES-1 attC, it is expected that the bla_GES-1/aacA4 excision occurs only at the aacA4 attC site, and that this structure is excised together as a unique cassette.

Positive results were obtained for the gcu14, gcu14-aacA4 and gcu14-bla_GES-1/aacA4 circular forms, but not for bla_GES-1 and aacA4 alone, showing that the GES-1 attC is not functional and that the fused gene cassette is excised as a unique cassette. Sequencing assessed the recombination point where excision occurred, confirming the occurrence of free circular forms. The lack of activity of a truncated attC had also been observed before when associated with aadA10¹¹. However, Ramirez and colleagues¹² showed that the integrase was able to recognize and mediate excision of a truncated site associated to aadA1, indicating that the genetic context of such truncated sites could influence their role in IntI1 recognition and mobilization.

The relative quantification performed by real time RT-PCR revealed that PS1 and PS26 presented very similar RQ values for gcu14-bla_GES-1/aacA4 transcription (Figure 2). This result was expected since integrons from these two strains have the same backbone, including the Pc promoter, and are at the same genetic environment⁶.

Figure 2. Transcription level of gcu14/bla_GES-1/aacA4 gene cassette array.

The relative quantification values obtained by real time RT-PCR are indicated for each gene cassette and for the fusion bla_GES-1/aacA4 when considered as a unique gene.

gcu14, the first cassette in integrons with the weak PcW_TGN-10 configuration, presented approximately two-fold higher transcription when compared to bla_GES-1 and aacA4 separately or when the fused cassette bla_GES-1/aacA4 was considered (Figure 2). The same RQ value obtained for bla_GES-1, aacA4 and the fusion reveals that these two ORFs are transcribed as a unique gene. The lower transcript amount of bla_GES-1/aacA4 compared to gcu14 lies on the distance between these gene cassettes and Pc, which is one of the determinants influencing cassette transcription^1,10, and it shows the effect of cassette position on expression levels.

A putative promoter for gcu14 (-35 TTGATG [17 bp] -10 TGTTAC) was found 45 bp upstream from its start codon. Therefore, the increased gcu14 transcription could have resulted from a synergistic effect of this putative promoter with Pc. Considering that this putative promoter was found at attI1, which is highly conserved among class 1 integrons, it can be suggested that such a promoter is able to drive transcription of any cassette placed in the first integron position. Moreover, the ORF-11, which enhances the translation efficiency of downstream TIR (translation initiation region)-deficient cassettes inserted in integrons¹³, was found at the attI1 region preceding the TIR-deficient gcu14 gene cassette. This ORF contained its own Shine-Dalgarno (SD) sequence placed 8 bp upstream of the ATG codon. The ribosome at the ORF-11 stop codon could therefore be carried along the mRNA by lateral diffusion, reinitiating translation at the gcu14 start codon. A potential SD sequence was identified 10 bp upstream of the fused cassette bla_GES-1/aacA4. In addition, the loss of the GES-1 attC region, which is involved in stem-loop formation, may enhance the chances of aacA4 translation, since this attC no longer constitutes a physical barrier to ribosome progression³. This deletion also then brings the second gene (aacA4) closer to Pc¹⁴. Together, these findings create a scenario for the occurrence of gcu14-bla_GES-1/aacA4 expression in PS1 and PS26, which then provides a possible explanation for their resistance profile to β-lactams and aminoglycosides that has been observed elsewhere⁶.

Conclusions

Fused cassettes have been found in class 1 integrons^{5,11,12,15–18} ; however, the transcription of such structures has never been addressed. This work showed the transcription pattern of a fused cassette as a polycistronic mRNA and that these unusual structures are excised as a unique cassette.

Nucleotide sequence accession number

The sequence of the cassette array composed by the fusion has been deposited in the GenBank database under accession number DQ236170.

Author contributions

ELF and ACPV conceived the study and designed the experiments. ELF carried out the research and prepared the first draft of the manuscript. All authors were involved in the revision of the draft manuscript and have agreed to the final content.

Competing interests

No relevant competing interests were disclosed.

Grant information

This work was supported by the CNPq and FAPERJ fellowship and Oswaldo Cruz Institute Grant.

Acknowledgements

We thank those involved in PDTIS platform to enable us to do the sequencing and real-time relative quantification analysis work.

References

1. Collis CM, Hall RM: Expression of antibiotic resistance genes in the integrated cassettes of integrons. Antimicrob Agents Chemother. 1995; 39: 155–162.
2. Collis CM, Hall RM: Site-specific deletion and rearrangement of integron insert genes catalyzed by the integron DNA integrase. J Bacteriol. 1992; 174: 1574–1585.
3. Jacquier H, Zaoui C, Sanson-le Pors MJ, et al:Translation regulation of integrons gene cassette expression by the attC sites. Mol Microbiol. 2009; 72: 1475–1486.
4. Recchia GD, Hall RM: Gene cassettes: a new class of mobile element. Microbiology. 1995; 141: 3015–3027.
5. Mendes RE, Toleman MA, Ribeiro J, et al:Integron carrying a novel metallo-β-lactamase gene, blaIMP-16, and a fused form of aminoglycoside-resistant gene aac(6')-30/aac(6')-Ib': report from the SENTRY Antimicrobial Surveillance Program. Antimicrob Agents Chemother. 2004; 48: 4693–4702.
6. da Fonseca EL, Vieira VV, Cipriano R, et al:Emergence of blaGES-5 in clinical colistin-only-sensitive (COS) Pseudomonas aeruginosa strain in Brazil. J Antimicrob Chemother. 2007; 59: 576–577.
7. Jové T, Da Re S, Denis F, et al:Inverse correlation between promoter strength and excision activity in class 1 integrons. PLoS Genet. 2010; 6: e1000793.
8. Stokes HW, O'Gorman DB, Recchia GD, et al:Structure and function of 59-base element recombination sites associated with mobile gene cassettes. Mol Microbiol. 1997; 26: 731–745.
9. Recchia GD, Hall RM: Plasmid evolution by acquisition of mobile gene cassettes: plasmid pIE723 contains the aadB gene cassette precisely inserted at a secondary site in the incQ plasmid RSF1010. Mol Microbiol. 1995; 15: 179–187.
10. Hocquet D, Llanes C, Thouverez M, et al:Evidence for induction of integron-based antibiotic resistance by the SOS response in a clinical setting. PLOS Pathog. 2012; 8: e1002778.
11. Partridge SR, Collis CM, Hall RM: Class 1 integron containing a new gene cassette, aadA10, associated with Tn1404 from R151. Antimicrob Agents Chemother. 2002; 46: 2400–2408.
12. Ramirez MS, Parenteau TR, Centron D, et al:Functional characterization of Tn1331gene cassettes. J Antimicrob Chemother. 2008; 62: 669–673.
13. Hanau-Berçot B, Podglajen I, Casin I, et al:An intrinsic control element for translational initiation in class 1 integrons. Mol Microbiol. 2002; 44: 119–130.
14. Partridge SR, Tsafnat G, Coeira E, et al:Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev. 2009; 33: 757–784.
15. Poirel L, Le Thomas I, Naas T, et al:Biochemical sequence analyses of GES-1, a novel class A extended-spectrum β-lactamase, and the class 1 integron In52 from Klebsiella pneumoniae. Antimicrob Agents Chemother. 2000; 44: 622–632.
16. Céntron D, Roy PH: Presence of a group II intron in a multiresistant Serratia marcescens strain that harbors three integrons and a novel gene fusion. Antimicrob Agents Chemother. 2002; 46: 1402–1409.
17. Dubois V, Poirel L, Marie C, et al:Molecular characterization of a novel class 1 integron containing bla(GES-1) and a fused product of aac3-Ib/aac6'-Ib' gene cassettes in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2002; 46: 638–645.
18. Walsh TR, Toleman MA, Hryniewicz W, et al:Evolution of an integron carrying blaVIM-2 in Eastern Europe: report from SENTRY antimicrobial surveillance program. J Antimicrob Chemother. 2003; 52: 116–119.

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 1)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 2)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 3)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 4)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 5)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 6)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 7)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 8)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 9)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 10)

Appendex 1: This result shows that the entire array gcu14-GES-1/aacA4 was mobilized together. This is evidence that GES1 and aacA4 are excised in the circular form as a unique cassette, showing that the trucanted attC from GES-1 is not functional and that recombination occurs in the aacA4 attC. (Sheet 11)

Comments on this article Comments (3)

Version 3

VERSION 3 PUBLISHED 27 Nov 2015

Revised

Comment

Version 1

VERSION 1 PUBLISHED 28 Mar 2013

Discussion is closed on this version, please comment on the latest version above.

Author Response 07 Sep 2015

Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

07 Sep 2015

Author Response
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:
- The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has
... Continue reading
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:
The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has been shown to increase (instead of 'decrease', first part of the Results section).
Response: This sentence was removed.

I have not checked which IntI1 had been used for the excision assay, usually these are made with the most efficient "PcW" IntI1 (IntI1R32_H39); note that in our PLoS Genetics paper (Jove et al. 2010) we evidenced the IntI1 "PcWTGN-10" (IntIP32_H39) were much less efficient for excision of gene cassettes, which could had been taken into account in your discussion.
Response: As properly noticed by you, our Pc configuration is the weak one, and this was changed in the text. However, we agree that including this discussion we will improve our manuscript (lines 182 and 184).

The hypothesis of a synergistic effect between the Pc and P(gcu14) tandem promoters does not fit the observed phenotypes: since the resulting level of transcription observed for the downstream genes is lower I suggest that some transcriptional interferences occur rather than synergistic interactions. By the way in absence of any experimental evidence for the functionality of the gcu14 promoter, such hypothesis is overstated. It would have been interesting to check the level of transcription of the blaGES-1,aacA4 gene cassette when gcu14 is deleted.
Response: we totally agree with this observation, in fact our conclusion is overstated since no experimental assay was performed to test the promoter synergy. Therefore, we remove this part from the text. We also agree that would be interesting to verify the expression of the fused cassette in the absence of gcu14, however it was not the focus of this paper.

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G mutation that converts a weak "PcW" promoter into a stronger "PcWTGN-10" as stated in the paper. Consequently you should write "the weak PcW configuration" instead of "weak PcWTGN-10". Also it means that its own IntI1 integrase is likely to be optimally efficient.
Response: Dr. Jové is absolutely right, the DQ236170 accession number presented the PcW configuration and not the PcWTGN-10 as stated in the manuscript, we apologize about this mistake. This was corrected in the text.

- Then, the sequence of the class 1 integron as deposited in the Genbank does not display the complete array of gene cassette (the end of the attCaacA4 is not available) which means that it is ambigous whether there is a downstream third gene cassette or not. Consistently this array of gene cassette, although a novel one, has not been numbered in the INTEGRALL database (http://integrall.bio.ua.pt/?acc=DQ236170)
Response: We know that aacA4 was the last cassette in the array because this variable region was obtained using primers annealing in the attI1 and in the beginning of qacE∆1 from 3’CS. It is true that the aacA4 attC is not completed in the GenBank accession number DQ236170. Therefore, spite of the incomplete attC sequence we are sure that the aacA4 is the last cassette from this array.

- Lastly, as an element of reply to the reviewer Dr Bercot, I would like to notify that the so-called gcu14 GC has not been reported in other reports except in an environmental strain of Citrobacter (and the sequence is not 100% identical, Genbank FM998050).
Response: thanks for this observation. It was included in the text.
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:
The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has been shown to increase (instead of 'decrease', first part of the Results section).
Response: This sentence was removed.

I have not checked which IntI1 had been used for the excision assay, usually these are made with the most efficient "PcW" IntI1 (IntI1R32_H39); note that in our PLoS Genetics paper (Jove et al. 2010) we evidenced the IntI1 "PcWTGN-10" (IntIP32_H39) were much less efficient for excision of gene cassettes, which could had been taken into account in your discussion.
Response: As properly noticed by you, our Pc configuration is the weak one, and this was changed in the text. However, we agree that including this discussion we will improve our manuscript (lines 182 and 184).

The hypothesis of a synergistic effect between the Pc and P(gcu14) tandem promoters does not fit the observed phenotypes: since the resulting level of transcription observed for the downstream genes is lower I suggest that some transcriptional interferences occur rather than synergistic interactions. By the way in absence of any experimental evidence for the functionality of the gcu14 promoter, such hypothesis is overstated. It would have been interesting to check the level of transcription of the blaGES-1,aacA4 gene cassette when gcu14 is deleted.
Response: we totally agree with this observation, in fact our conclusion is overstated since no experimental assay was performed to test the promoter synergy. Therefore, we remove this part from the text. We also agree that would be interesting to verify the expression of the fused cassette in the absence of gcu14, however it was not the focus of this paper.

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G mutation that converts a weak "PcW" promoter into a stronger "PcWTGN-10" as stated in the paper. Consequently you should write "the weak PcW configuration" instead of "weak PcWTGN-10". Also it means that its own IntI1 integrase is likely to be optimally efficient.
Response: Dr. Jové is absolutely right, the DQ236170 accession number presented the PcW configuration and not the PcWTGN-10 as stated in the manuscript, we apologize about this mistake. This was corrected in the text.

- Then, the sequence of the class 1 integron as deposited in the Genbank does not display the complete array of gene cassette (the end of the attCaacA4 is not available) which means that it is ambigous whether there is a downstream third gene cassette or not. Consistently this array of gene cassette, although a novel one, has not been numbered in the INTEGRALL database (http://integrall.bio.ua.pt/?acc=DQ236170)
Response: We know that aacA4 was the last cassette in the array because this variable region was obtained using primers annealing in the attI1 and in the beginning of qacE∆1 from 3’CS. It is true that the aacA4 attC is not completed in the GenBank accession number DQ236170. Therefore, spite of the incomplete attC sequence we are sure that the aacA4 is the last cassette from this array.

- Lastly, as an element of reply to the reviewer Dr Bercot, I would like to notify that the so-called gcu14 GC has not been reported in other reports except in an environmental strain of Citrobacter (and the sequence is not 100% identical, Genbank FM998050).
Response: thanks for this observation. It was included in the text.
Competing Interests: There is no competing of interests Close
Report a concern
Reader Comment 23 May 2013

Thomas Jové, LGPB, Belgium

23 May 2013

Reader Comment

Dear authors,

I would like to add some further comments:

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G ... Continue reading Dear authors,

I would like to add some further comments:

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G mutation that converts a weak "PcW" promoter into a stronger "PcWTGN-10" as stated in the paper. Consequently you should write "the weak PcW configuration" instead of "weak PcWTGN-10". Also it means that its own IntI1 integrase is likely to be optimally efficient.

- Then, the sequence of the class 1 integron as deposited in the Genbank does not display the complete array of gene cassette (the end of the attCaacA4 is not available) which means that it is ambigous whether there is a downstream third gene cassette or not. Consistently this array of gene cassette, although a novel one, has not been numbered in the INTEGRALL database (http://integrall.bio.ua.pt/?acc=DQ236170)

- Lastly, as an element of reply to the reviewer Dr Bercot, I would like to notify that the so-called gcu14 GC has not been reported in other reports except in an environmental strain of Citrobacter (and the sequence is not 100% identical, Genbank FM998050).
Dear authors,

I would like to add some further comments:

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G mutation that converts a weak "PcW" promoter into a stronger "PcWTGN-10" as stated in the paper. Consequently you should write "the weak PcW configuration" instead of "weak PcWTGN-10". Also it means that its own IntI1 integrase is likely to be optimally efficient.

- Then, the sequence of the class 1 integron as deposited in the Genbank does not display the complete array of gene cassette (the end of the attCaacA4 is not available) which means that it is ambigous whether there is a downstream third gene cassette or not. Consistently this array of gene cassette, although a novel one, has not been numbered in the INTEGRALL database (http://integrall.bio.ua.pt/?acc=DQ236170)

- Lastly, as an element of reply to the reviewer Dr Bercot, I would like to notify that the so-called gcu14 GC has not been reported in other reports except in an environmental strain of Citrobacter (and the sequence is not 100% identical, Genbank FM998050).
Competing Interests: None Close
Report a concern
Reader Comment 17 May 2013

Thomas Jové, LGPB, Belgium

17 May 2013

Reader Comment
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:

The C to G mutations that converts the usual weak PcW variant into PcWTGN-10
... Continue reading
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:

The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has been shown to increase (instead of 'decrease', first part of the Results section).
I have not checked which IntI1 had been used for the excision assay, usually these are made with the most efficient "PcW" IntI1 (IntI1R32_H39); note that in our PLoS Genetics paper (Jove et al. 2010) we evidenced the IntI1 "PcWTGN-10" (IntIP32_H39) were much less efficient for excision of gene cassettes, which could had been taken into account in your discussion.
The hypothesis of a synergistic effect between the Pc and P(gcu14) tandem promoters does not fit the observed phenotypes: since the resulting level of transcription observed for the downstream genes is lower I suggest that some transcriptional interferences occur rather than synergistic interactions. By the way in absence of any experimental evidence for the functionality of the gcu14 promoter, such hypothesis is overstated. It would have been interesting to check the level of transcription of the blaGES-1,aacA4 gene cassette when gcu14 is deleted.
Some years ago Jacquier et al. (2009) published data suggesting that attC sites rather influence the level of translation between each gene cassette while the level of transcription was unaffected.
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:

The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has been shown to increase (instead of 'decrease', first part of the Results section).
I have not checked which IntI1 had been used for the excision assay, usually these are made with the most efficient "PcW" IntI1 (IntI1R32_H39); note that in our PLoS Genetics paper (Jove et al. 2010) we evidenced the IntI1 "PcWTGN-10" (IntIP32_H39) were much less efficient for excision of gene cassettes, which could had been taken into account in your discussion.
The hypothesis of a synergistic effect between the Pc and P(gcu14) tandem promoters does not fit the observed phenotypes: since the resulting level of transcription observed for the downstream genes is lower I suggest that some transcriptional interferences occur rather than synergistic interactions. By the way in absence of any experimental evidence for the functionality of the gcu14 promoter, such hypothesis is overstated. It would have been interesting to check the level of transcription of the blaGES-1,aacA4 gene cassette when gcu14 is deleted.
Some years ago Jacquier et al. (2009) published data suggesting that attC sites rather influence the level of translation between each gene cassette while the level of transcription was unaffected.
Competing Interests: None Close
Report a concern
Discussion is closed on this version, please comment on the latest version above.

Author details Author details

¹ Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

Competing interests

No competing interests were disclosed.

Grant information

This work was supported by the CNPq and FAPERJ fellowship and Oswaldo Cruz Institute Grant.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (3)

version 3

Revised

Published: 27 Nov 2015, 2:99

https://doi.org/10.12688/f1000research.2-99.v3

version 2

Revised

Published: 07 Sep 2015, 2:99

https://doi.org/10.12688/f1000research.2-99.v2

version 1

Published: 28 Mar 2013, 2:99

https://doi.org/10.12688/f1000research.2-99.v1

© 2013 Fonseca ÉL and Vicente ACP. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Fonseca ÉL and Vicente ACP. Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [version 1; peer review: 2 approved with reservations]. F1000Research 2013, 2:99 (https://doi.org/10.12688/f1000research.2-99.v1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 28 Mar 2013

Views

Reviewer Report 21 May 2013

Béatrice Berçot, Service de Bactériologie-Virologie, Hôpital de Bicêtre, Paris, France

Approved with Reservations

https://doi.org/10.5256/f1000research.903.r961

This work is conducted to address the transcription of the fused gene cassette bla_GES-1/aacA4. This arrangement is rare but not exceptional in a class 1 integron. In this work, the experimentation confirmed that the three gene cassettes harbored in this class 1 integron were expressed together from a unique polycistronic transcript.

It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that the Pseudomonas isolates harbored another class 1 integron containing the gcu14 gene followed by the aacA4 gene?

The authors have to provide in the paper the classical length of the bla_GES-1 attC site, which is 110bp and contained the 1L, 2L, 2R and 1R sequences-shown in bold.

TTGACGCCC GTCTAAC AATTC GTTCAAGC CGACGTTGCTTCGTGGCGGCGCTTGCGTGCTACGCTAAGCTTCGCACGCCGCTTGCCACTGCGCACCGCG GCTTAAC TCAGGC GTTAGNC

In the Pseudomonas SP26 and PS1 isolates, the bla_{GES- 1} attC site is reduced to the 6 bp of 1 L box.

TTGACGCCC GTCTAA AACAAAGTTAGGCATCACAAAGTACAGCATC GTG

So, the distance from of the stop of bla_GES-1 to the start codon of the aacA4 gene is 46bp. The translational start codon of aacA4 gene is erroneous in the Genbank data base (DC236170). Indeed, it has been determined by N-terminal amino acid sequencing to be a GTG (in italic in the sequence above) and the beginning of the cassette was 24 bp before [Hanau-Bercot B. et al., 2002].
-Could the Genbank annotation be modified as explained above?
-The Appendex is not necessary and should be deleted.
-In the sentence page 4, line 13, “The single copy of rpsL gene of Pseudomonas...”, should be replaced by “the rpsL gene of Pseudomonas (see Bodilis et al., 2012)
-In the conclusion, page 6, change “never” to “rarely”.

Competing Interests: No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 07 Sep 2015

Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

07 Sep 2015

Author Response

It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that ... Continue reading It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that the Pseudomonas isolates harbored another class 1 integron containing the gcu14 gene followed by the aacA4 gene?
Response: Yes, the presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

The authors have to provide in the paper the classical length of the bla_GES-1 attC site, which is 110bp and contained the 1L, 2L, 2R and 1R sequences-shown in bold.
Response: A figure showing the truncated and the complete canonical attC from GES1 was included in the new version.

So, the distance from of the stop of blaGES-1 to the start codon of the aacA4 gene is 46bp. The translational start codon of aacA4 gene is erroneous in the Genbank data base (DC236170). Indeed, it has been determined by N-terminal amino acid sequencing to be a GTG (in italic in the sequence above) and the beginning of the cassette was 24 bp before [Hanau-Bercot B. et al., 2002].
-Could the Genbank annotation be modified as explained above?
Response: We performed this modification and the updated sequence regarding the beginning of aacA4 gene is already accessible on GenBank database under the same accession number (DQ236170).

-The Appendex is not necessary and should be deleted.
Response: The appendix is only for helping referees in their evaluation. It will not be published.

-In the sentence page 4, line 13, “The single copy of rpsL gene of Pseudomonas...”, should be replaced by “the rpsL gene of Pseudomonas (see Bodilis et al., 2012).
Response: this was modified in the new version of the manuscript.

In the conclusion, page 6, change “never” to “rarely”.
Response: this was modified in the new version of the manuscript.
It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that the Pseudomonas isolates harbored another class 1 integron containing the gcu14 gene followed by the aacA4 gene?
Response: Yes, the presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

The authors have to provide in the paper the classical length of the bla_GES-1 attC site, which is 110bp and contained the 1L, 2L, 2R and 1R sequences-shown in bold.
Response: A figure showing the truncated and the complete canonical attC from GES1 was included in the new version.

So, the distance from of the stop of blaGES-1 to the start codon of the aacA4 gene is 46bp. The translational start codon of aacA4 gene is erroneous in the Genbank data base (DC236170). Indeed, it has been determined by N-terminal amino acid sequencing to be a GTG (in italic in the sequence above) and the beginning of the cassette was 24 bp before [Hanau-Bercot B. et al., 2002].
-Could the Genbank annotation be modified as explained above?
Response: We performed this modification and the updated sequence regarding the beginning of aacA4 gene is already accessible on GenBank database under the same accession number (DQ236170).

-The Appendex is not necessary and should be deleted.
Response: The appendix is only for helping referees in their evaluation. It will not be published.

-In the sentence page 4, line 13, “The single copy of rpsL gene of Pseudomonas...”, should be replaced by “the rpsL gene of Pseudomonas (see Bodilis et al., 2012).
Response: this was modified in the new version of the manuscript.

In the conclusion, page 6, change “never” to “rarely”.
Response: this was modified in the new version of the manuscript.
Competing Interests: There is no competing interests Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 07 Sep 2015

Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

07 Sep 2015

Author Response

It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that ... Continue reading It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that the Pseudomonas isolates harbored another class 1 integron containing the gcu14 gene followed by the aacA4 gene?
Response: Yes, the presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

The authors have to provide in the paper the classical length of the bla_GES-1 attC site, which is 110bp and contained the 1L, 2L, 2R and 1R sequences-shown in bold.
Response: A figure showing the truncated and the complete canonical attC from GES1 was included in the new version.

So, the distance from of the stop of blaGES-1 to the start codon of the aacA4 gene is 46bp. The translational start codon of aacA4 gene is erroneous in the Genbank data base (DC236170). Indeed, it has been determined by N-terminal amino acid sequencing to be a GTG (in italic in the sequence above) and the beginning of the cassette was 24 bp before [Hanau-Bercot B. et al., 2002].
-Could the Genbank annotation be modified as explained above?
Response: We performed this modification and the updated sequence regarding the beginning of aacA4 gene is already accessible on GenBank database under the same accession number (DQ236170).

-The Appendex is not necessary and should be deleted.
Response: The appendix is only for helping referees in their evaluation. It will not be published.

-In the sentence page 4, line 13, “The single copy of rpsL gene of Pseudomonas...”, should be replaced by “the rpsL gene of Pseudomonas (see Bodilis et al., 2012).
Response: this was modified in the new version of the manuscript.

In the conclusion, page 6, change “never” to “rarely”.
Response: this was modified in the new version of the manuscript.
It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that the Pseudomonas isolates harbored another class 1 integron containing the gcu14 gene followed by the aacA4 gene?
Response: Yes, the presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

The authors have to provide in the paper the classical length of the bla_GES-1 attC site, which is 110bp and contained the 1L, 2L, 2R and 1R sequences-shown in bold.
Response: A figure showing the truncated and the complete canonical attC from GES1 was included in the new version.

So, the distance from of the stop of blaGES-1 to the start codon of the aacA4 gene is 46bp. The translational start codon of aacA4 gene is erroneous in the Genbank data base (DC236170). Indeed, it has been determined by N-terminal amino acid sequencing to be a GTG (in italic in the sequence above) and the beginning of the cassette was 24 bp before [Hanau-Bercot B. et al., 2002].
-Could the Genbank annotation be modified as explained above?
Response: We performed this modification and the updated sequence regarding the beginning of aacA4 gene is already accessible on GenBank database under the same accession number (DQ236170).

-The Appendex is not necessary and should be deleted.
Response: The appendix is only for helping referees in their evaluation. It will not be published.

-In the sentence page 4, line 13, “The single copy of rpsL gene of Pseudomonas...”, should be replaced by “the rpsL gene of Pseudomonas (see Bodilis et al., 2012).
Response: this was modified in the new version of the manuscript.

In the conclusion, page 6, change “never” to “rarely”.
Response: this was modified in the new version of the manuscript.
Competing Interests: There is no competing interests Close
Report a concern

Views

Reviewer Report 02 May 2013

Sally Partridge, Sydney West Area Health Service, Sydney, NSW, Australia

Approved with Reservations

https://doi.org/10.5256/f1000research.903.r920

This paper looks at expression of genes in a gene cassette array that includes a fused cassette and at the excision of cassette from this array. Polycistronic transcripts from cassette arrays and the excision of other fused cassettes have previously been noted by others, as cited in this paper. The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to make it possible to assess whether they support the conclusions drawn in the paper.

Some reorganisation (moving some information in the Results and Discussion to the Introduction) would help to make the paper easier to follow and the Conclusions section is very short and could be expanded. The English could also be improved and the manuscript checked for typos etc.
A few specific points also need correcting or clarifying:

Abstract Line 5- fused cassettes do not always have fused orfs (e.g. aacA1/orfG)
Abstract 6th Line from end and Results and Discussion p. 5 1st Line of 2nd paragraph – what is in the gcu14-aacA4 circular form? Should this be blaGES-1/aacA4?
Materials and Methods Line 1 – this needs rewording to explain that gcu is a gene cassette of unknown function.
Results and Discussion p. 4 – the fusion here is the type where part of the blaGES-14 attC site is replaced by part of the attI1 site (see ref. 14). The LH and RH domains are part of the attC site, rather than flanking it. The 5′ UTR contains 6 bp of the attC site.
Results and Discussion p. 5 – most of the 1L core site and the 1R core site of the blaGES attC site are present.
Results and Discussion p. 6 – the deletion of part of the attC site doesn’t bring the aacA4 gene much closer to Pc and ref. 14 makes slightly different point (that expression of the downstream cassette may be enhanced).

Formatting “14” of gcu14 and “A4” of aacA4 should be in italics.Transposon, gene and species names etc are not correctly formatted in the references.

Competing Interests: No competing interests were disclosed.

CITE

Report a concern

Author Response 07 Sep 2015

Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

07 Sep 2015

Author Response

The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to ... Continue reading The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to make it possible to assess whether they support the conclusions drawn in the paper.
Response: The sequence resulted from inverse PCR product, showing the circular form of the gcu14-blaGES-1-aacA4 array, was submitted to GenBank under accession number KT336477. This information was included in the text. Moreover, we provided a new figure showing a schematic representation of primer targeting sites used in inverse PCR in order to make easier for the reviewers comprehend our strategy and results.

Some reorganisation (moving some information in the Results and Discussion to the Introduction) would help to make the paper easier to follow and the Conclusions section is very short and could be expanded. The English could also be improved and the manuscript checked for typos etc.
Response: We agree that some points from results and discussion section would be more adequate in the introduction section, and they were moved in the new version of the manuscript (Page 3, lines 59-60 and 65-70; page 4, lines 71-76 in the new version).
The English was reviewed by a native spoken-English, and the conclusion was expanded.

A few specific points also need correcting or clarifying:

Abstract Line 5- fused cassettes do not always have fused orfs (e.g. aacA1/orfG)
Response: We agree and it was modified: We affirmed that only in some cases fused orfs can be created.

Abstract 6th Line from end and Results and Discussion p. 5 1st Line of 2nd paragraph – what is in the gcu14-aacA4 circular form? Should this be blaGES-1/aacA4?
Response: The presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

     Materials and Methods Line 1 – this needs rewording to explain that gcu is a gene cassette of unknown function.
Response: It was included in the text.

    Results and Discussion p. 4 – the fusion here is the type where part of the blaGES-1 attC site is replaced by part of the attI1 site (see ref. 14). The LH and RH domains are part of the attC site, rather than flanking it. The 5′ UTR contains 6 bp of the attC site.
Response: We change the text emphasizing that the attC was replaced by part of attI1.
The referee is right; LH and RH domains are part of the attC site, rather than flanking it. This general idea concerning attC site and its domains was modified throughout the text.

     Results and Discussion p. 5 – most of the 1L core site and the 1R core site of the blaGES attC site are present.
Response: In fact, only the 1L core site is present in the truncated attC. We included a figure (figure 2) in this new version showing this.

     Results and Discussion p. 6 – the deletion of part of the attC site doesn’t bring the aacA4 gene much closer to Pc and ref. 14 makes slightly different point (that expression of the downstream cassette may be enhanced).
Response: The referee is right. This statement was removed.

Formatting “14” of gcu14 and “A4” of aacA4 should be in italics. Transposon, gene and species names etc are not correctly formatted in the references.
Response: All formatting errors were properly corrected.
The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to make it possible to assess whether they support the conclusions drawn in the paper.
Response: The sequence resulted from inverse PCR product, showing the circular form of the gcu14-blaGES-1-aacA4 array, was submitted to GenBank under accession number KT336477. This information was included in the text. Moreover, we provided a new figure showing a schematic representation of primer targeting sites used in inverse PCR in order to make easier for the reviewers comprehend our strategy and results.

Some reorganisation (moving some information in the Results and Discussion to the Introduction) would help to make the paper easier to follow and the Conclusions section is very short and could be expanded. The English could also be improved and the manuscript checked for typos etc.
Response: We agree that some points from results and discussion section would be more adequate in the introduction section, and they were moved in the new version of the manuscript (Page 3, lines 59-60 and 65-70; page 4, lines 71-76 in the new version).
The English was reviewed by a native spoken-English, and the conclusion was expanded.

A few specific points also need correcting or clarifying:

Abstract Line 5- fused cassettes do not always have fused orfs (e.g. aacA1/orfG)
Response: We agree and it was modified: We affirmed that only in some cases fused orfs can be created.

Abstract 6th Line from end and Results and Discussion p. 5 1st Line of 2nd paragraph – what is in the gcu14-aacA4 circular form? Should this be blaGES-1/aacA4?
Response: The presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

     Materials and Methods Line 1 – this needs rewording to explain that gcu is a gene cassette of unknown function.
Response: It was included in the text.

    Results and Discussion p. 4 – the fusion here is the type where part of the blaGES-1 attC site is replaced by part of the attI1 site (see ref. 14). The LH and RH domains are part of the attC site, rather than flanking it. The 5′ UTR contains 6 bp of the attC site.
Response: We change the text emphasizing that the attC was replaced by part of attI1.
The referee is right; LH and RH domains are part of the attC site, rather than flanking it. This general idea concerning attC site and its domains was modified throughout the text.

     Results and Discussion p. 5 – most of the 1L core site and the 1R core site of the blaGES attC site are present.
Response: In fact, only the 1L core site is present in the truncated attC. We included a figure (figure 2) in this new version showing this.

     Results and Discussion p. 6 – the deletion of part of the attC site doesn’t bring the aacA4 gene much closer to Pc and ref. 14 makes slightly different point (that expression of the downstream cassette may be enhanced).
Response: The referee is right. This statement was removed.

Formatting “14” of gcu14 and “A4” of aacA4 should be in italics. Transposon, gene and species names etc are not correctly formatted in the references.
Response: All formatting errors were properly corrected.
Competing Interests: There is no competing interests Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 07 Sep 2015

Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

07 Sep 2015

Author Response

The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to ... Continue reading The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to make it possible to assess whether they support the conclusions drawn in the paper.
Response: The sequence resulted from inverse PCR product, showing the circular form of the gcu14-blaGES-1-aacA4 array, was submitted to GenBank under accession number KT336477. This information was included in the text. Moreover, we provided a new figure showing a schematic representation of primer targeting sites used in inverse PCR in order to make easier for the reviewers comprehend our strategy and results.

Some reorganisation (moving some information in the Results and Discussion to the Introduction) would help to make the paper easier to follow and the Conclusions section is very short and could be expanded. The English could also be improved and the manuscript checked for typos etc.
Response: We agree that some points from results and discussion section would be more adequate in the introduction section, and they were moved in the new version of the manuscript (Page 3, lines 59-60 and 65-70; page 4, lines 71-76 in the new version).
The English was reviewed by a native spoken-English, and the conclusion was expanded.

A few specific points also need correcting or clarifying:

Abstract Line 5- fused cassettes do not always have fused orfs (e.g. aacA1/orfG)
Response: We agree and it was modified: We affirmed that only in some cases fused orfs can be created.

Abstract 6th Line from end and Results and Discussion p. 5 1st Line of 2nd paragraph – what is in the gcu14-aacA4 circular form? Should this be blaGES-1/aacA4?
Response: The presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

     Materials and Methods Line 1 – this needs rewording to explain that gcu is a gene cassette of unknown function.
Response: It was included in the text.

    Results and Discussion p. 4 – the fusion here is the type where part of the blaGES-1 attC site is replaced by part of the attI1 site (see ref. 14). The LH and RH domains are part of the attC site, rather than flanking it. The 5′ UTR contains 6 bp of the attC site.
Response: We change the text emphasizing that the attC was replaced by part of attI1.
The referee is right; LH and RH domains are part of the attC site, rather than flanking it. This general idea concerning attC site and its domains was modified throughout the text.

     Results and Discussion p. 5 – most of the 1L core site and the 1R core site of the blaGES attC site are present.
Response: In fact, only the 1L core site is present in the truncated attC. We included a figure (figure 2) in this new version showing this.

     Results and Discussion p. 6 – the deletion of part of the attC site doesn’t bring the aacA4 gene much closer to Pc and ref. 14 makes slightly different point (that expression of the downstream cassette may be enhanced).
Response: The referee is right. This statement was removed.

Formatting “14” of gcu14 and “A4” of aacA4 should be in italics. Transposon, gene and species names etc are not correctly formatted in the references.
Response: All formatting errors were properly corrected.
The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to make it possible to assess whether they support the conclusions drawn in the paper.
Response: The sequence resulted from inverse PCR product, showing the circular form of the gcu14-blaGES-1-aacA4 array, was submitted to GenBank under accession number KT336477. This information was included in the text. Moreover, we provided a new figure showing a schematic representation of primer targeting sites used in inverse PCR in order to make easier for the reviewers comprehend our strategy and results.

Some reorganisation (moving some information in the Results and Discussion to the Introduction) would help to make the paper easier to follow and the Conclusions section is very short and could be expanded. The English could also be improved and the manuscript checked for typos etc.
Response: We agree that some points from results and discussion section would be more adequate in the introduction section, and they were moved in the new version of the manuscript (Page 3, lines 59-60 and 65-70; page 4, lines 71-76 in the new version).
The English was reviewed by a native spoken-English, and the conclusion was expanded.

A few specific points also need correcting or clarifying:

Abstract Line 5- fused cassettes do not always have fused orfs (e.g. aacA1/orfG)
Response: We agree and it was modified: We affirmed that only in some cases fused orfs can be created.

Abstract 6th Line from end and Results and Discussion p. 5 1st Line of 2nd paragraph – what is in the gcu14-aacA4 circular form? Should this be blaGES-1/aacA4?
Response: The presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

     Materials and Methods Line 1 – this needs rewording to explain that gcu is a gene cassette of unknown function.
Response: It was included in the text.

    Results and Discussion p. 4 – the fusion here is the type where part of the blaGES-1 attC site is replaced by part of the attI1 site (see ref. 14). The LH and RH domains are part of the attC site, rather than flanking it. The 5′ UTR contains 6 bp of the attC site.
Response: We change the text emphasizing that the attC was replaced by part of attI1.
The referee is right; LH and RH domains are part of the attC site, rather than flanking it. This general idea concerning attC site and its domains was modified throughout the text.

     Results and Discussion p. 5 – most of the 1L core site and the 1R core site of the blaGES attC site are present.
Response: In fact, only the 1L core site is present in the truncated attC. We included a figure (figure 2) in this new version showing this.

     Results and Discussion p. 6 – the deletion of part of the attC site doesn’t bring the aacA4 gene much closer to Pc and ref. 14 makes slightly different point (that expression of the downstream cassette may be enhanced).
Response: The referee is right. This statement was removed.

Formatting “14” of gcu14 and “A4” of aacA4 should be in italics. Transposon, gene and species names etc are not correctly formatted in the references.
Response: All formatting errors were properly corrected.
Competing Interests: There is no competing interests Close
Report a concern

Comments on this article Comments (3)

Version 3

VERSION 3 PUBLISHED 27 Nov 2015

Revised

Comment

Version 1

VERSION 1 PUBLISHED 28 Mar 2013

Discussion is closed on this version, please comment on the latest version above.

Author Response 07 Sep 2015

Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

07 Sep 2015

Author Response
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:
- The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has
... Continue reading
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:
The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has been shown to increase (instead of 'decrease', first part of the Results section).
Response: This sentence was removed.

I have not checked which IntI1 had been used for the excision assay, usually these are made with the most efficient "PcW" IntI1 (IntI1R32_H39); note that in our PLoS Genetics paper (Jove et al. 2010) we evidenced the IntI1 "PcWTGN-10" (IntIP32_H39) were much less efficient for excision of gene cassettes, which could had been taken into account in your discussion.
Response: As properly noticed by you, our Pc configuration is the weak one, and this was changed in the text. However, we agree that including this discussion we will improve our manuscript (lines 182 and 184).

The hypothesis of a synergistic effect between the Pc and P(gcu14) tandem promoters does not fit the observed phenotypes: since the resulting level of transcription observed for the downstream genes is lower I suggest that some transcriptional interferences occur rather than synergistic interactions. By the way in absence of any experimental evidence for the functionality of the gcu14 promoter, such hypothesis is overstated. It would have been interesting to check the level of transcription of the blaGES-1,aacA4 gene cassette when gcu14 is deleted.
Response: we totally agree with this observation, in fact our conclusion is overstated since no experimental assay was performed to test the promoter synergy. Therefore, we remove this part from the text. We also agree that would be interesting to verify the expression of the fused cassette in the absence of gcu14, however it was not the focus of this paper.

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G mutation that converts a weak "PcW" promoter into a stronger "PcWTGN-10" as stated in the paper. Consequently you should write "the weak PcW configuration" instead of "weak PcWTGN-10". Also it means that its own IntI1 integrase is likely to be optimally efficient.
Response: Dr. Jové is absolutely right, the DQ236170 accession number presented the PcW configuration and not the PcWTGN-10 as stated in the manuscript, we apologize about this mistake. This was corrected in the text.

- Then, the sequence of the class 1 integron as deposited in the Genbank does not display the complete array of gene cassette (the end of the attCaacA4 is not available) which means that it is ambigous whether there is a downstream third gene cassette or not. Consistently this array of gene cassette, although a novel one, has not been numbered in the INTEGRALL database (http://integrall.bio.ua.pt/?acc=DQ236170)
Response: We know that aacA4 was the last cassette in the array because this variable region was obtained using primers annealing in the attI1 and in the beginning of qacE∆1 from 3’CS. It is true that the aacA4 attC is not completed in the GenBank accession number DQ236170. Therefore, spite of the incomplete attC sequence we are sure that the aacA4 is the last cassette from this array.

- Lastly, as an element of reply to the reviewer Dr Bercot, I would like to notify that the so-called gcu14 GC has not been reported in other reports except in an environmental strain of Citrobacter (and the sequence is not 100% identical, Genbank FM998050).
Response: thanks for this observation. It was included in the text.
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:
The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has been shown to increase (instead of 'decrease', first part of the Results section).
Response: This sentence was removed.

I have not checked which IntI1 had been used for the excision assay, usually these are made with the most efficient "PcW" IntI1 (IntI1R32_H39); note that in our PLoS Genetics paper (Jove et al. 2010) we evidenced the IntI1 "PcWTGN-10" (IntIP32_H39) were much less efficient for excision of gene cassettes, which could had been taken into account in your discussion.
Response: As properly noticed by you, our Pc configuration is the weak one, and this was changed in the text. However, we agree that including this discussion we will improve our manuscript (lines 182 and 184).

The hypothesis of a synergistic effect between the Pc and P(gcu14) tandem promoters does not fit the observed phenotypes: since the resulting level of transcription observed for the downstream genes is lower I suggest that some transcriptional interferences occur rather than synergistic interactions. By the way in absence of any experimental evidence for the functionality of the gcu14 promoter, such hypothesis is overstated. It would have been interesting to check the level of transcription of the blaGES-1,aacA4 gene cassette when gcu14 is deleted.
Response: we totally agree with this observation, in fact our conclusion is overstated since no experimental assay was performed to test the promoter synergy. Therefore, we remove this part from the text. We also agree that would be interesting to verify the expression of the fused cassette in the absence of gcu14, however it was not the focus of this paper.

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G mutation that converts a weak "PcW" promoter into a stronger "PcWTGN-10" as stated in the paper. Consequently you should write "the weak PcW configuration" instead of "weak PcWTGN-10". Also it means that its own IntI1 integrase is likely to be optimally efficient.
Response: Dr. Jové is absolutely right, the DQ236170 accession number presented the PcW configuration and not the PcWTGN-10 as stated in the manuscript, we apologize about this mistake. This was corrected in the text.

- Then, the sequence of the class 1 integron as deposited in the Genbank does not display the complete array of gene cassette (the end of the attCaacA4 is not available) which means that it is ambigous whether there is a downstream third gene cassette or not. Consistently this array of gene cassette, although a novel one, has not been numbered in the INTEGRALL database (http://integrall.bio.ua.pt/?acc=DQ236170)
Response: We know that aacA4 was the last cassette in the array because this variable region was obtained using primers annealing in the attI1 and in the beginning of qacE∆1 from 3’CS. It is true that the aacA4 attC is not completed in the GenBank accession number DQ236170. Therefore, spite of the incomplete attC sequence we are sure that the aacA4 is the last cassette from this array.

- Lastly, as an element of reply to the reviewer Dr Bercot, I would like to notify that the so-called gcu14 GC has not been reported in other reports except in an environmental strain of Citrobacter (and the sequence is not 100% identical, Genbank FM998050).
Response: thanks for this observation. It was included in the text.
Competing Interests: There is no competing of interests Close
Report a concern
Reader Comment 23 May 2013

Thomas Jové, LGPB, Belgium

23 May 2013

Reader Comment

Dear authors,

I would like to add some further comments:

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G ... Continue reading Dear authors,

I would like to add some further comments:

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G mutation that converts a weak "PcW" promoter into a stronger "PcWTGN-10" as stated in the paper. Consequently you should write "the weak PcW configuration" instead of "weak PcWTGN-10". Also it means that its own IntI1 integrase is likely to be optimally efficient.

- Then, the sequence of the class 1 integron as deposited in the Genbank does not display the complete array of gene cassette (the end of the attCaacA4 is not available) which means that it is ambigous whether there is a downstream third gene cassette or not. Consistently this array of gene cassette, although a novel one, has not been numbered in the INTEGRALL database (http://integrall.bio.ua.pt/?acc=DQ236170)

- Lastly, as an element of reply to the reviewer Dr Bercot, I would like to notify that the so-called gcu14 GC has not been reported in other reports except in an environmental strain of Citrobacter (and the sequence is not 100% identical, Genbank FM998050).
Dear authors,

I would like to add some further comments:

- First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G mutation that converts a weak "PcW" promoter into a stronger "PcWTGN-10" as stated in the paper. Consequently you should write "the weak PcW configuration" instead of "weak PcWTGN-10". Also it means that its own IntI1 integrase is likely to be optimally efficient.

- Then, the sequence of the class 1 integron as deposited in the Genbank does not display the complete array of gene cassette (the end of the attCaacA4 is not available) which means that it is ambigous whether there is a downstream third gene cassette or not. Consistently this array of gene cassette, although a novel one, has not been numbered in the INTEGRALL database (http://integrall.bio.ua.pt/?acc=DQ236170)

- Lastly, as an element of reply to the reviewer Dr Bercot, I would like to notify that the so-called gcu14 GC has not been reported in other reports except in an environmental strain of Citrobacter (and the sequence is not 100% identical, Genbank FM998050).
Competing Interests: None Close
Report a concern
Reader Comment 17 May 2013

Thomas Jové, LGPB, Belgium

17 May 2013

Reader Comment
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:

The C to G mutations that converts the usual weak PcW variant into PcWTGN-10
... Continue reading
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:

The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has been shown to increase (instead of 'decrease', first part of the Results section).
I have not checked which IntI1 had been used for the excision assay, usually these are made with the most efficient "PcW" IntI1 (IntI1R32_H39); note that in our PLoS Genetics paper (Jove et al. 2010) we evidenced the IntI1 "PcWTGN-10" (IntIP32_H39) were much less efficient for excision of gene cassettes, which could had been taken into account in your discussion.
The hypothesis of a synergistic effect between the Pc and P(gcu14) tandem promoters does not fit the observed phenotypes: since the resulting level of transcription observed for the downstream genes is lower I suggest that some transcriptional interferences occur rather than synergistic interactions. By the way in absence of any experimental evidence for the functionality of the gcu14 promoter, such hypothesis is overstated. It would have been interesting to check the level of transcription of the blaGES-1,aacA4 gene cassette when gcu14 is deleted.
Some years ago Jacquier et al. (2009) published data suggesting that attC sites rather influence the level of translation between each gene cassette while the level of transcription was unaffected.
Dear Authors,

Besides the comments already made by the reviewers, I would like to specify some points:

The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has been shown to increase (instead of 'decrease', first part of the Results section).
I have not checked which IntI1 had been used for the excision assay, usually these are made with the most efficient "PcW" IntI1 (IntI1R32_H39); note that in our PLoS Genetics paper (Jove et al. 2010) we evidenced the IntI1 "PcWTGN-10" (IntIP32_H39) were much less efficient for excision of gene cassettes, which could had been taken into account in your discussion.
The hypothesis of a synergistic effect between the Pc and P(gcu14) tandem promoters does not fit the observed phenotypes: since the resulting level of transcription observed for the downstream genes is lower I suggest that some transcriptional interferences occur rather than synergistic interactions. By the way in absence of any experimental evidence for the functionality of the gcu14 promoter, such hypothesis is overstated. It would have been interesting to check the level of transcription of the blaGES-1,aacA4 gene cassette when gcu14 is deleted.
Some years ago Jacquier et al. (2009) published data suggesting that attC sites rather influence the level of translation between each gene cassette while the level of transcription was unaffected.
Competing Interests: None Close
Report a concern
Discussion is closed on this version, please comment on the latest version above.

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 3 (revision) 27 Nov 15	read
Version 2 (revision) 07 Sep 15	read	read
Version 1 28 Mar 13	read	read

Sally Partridge, Sydney West Area Health Service, Sydney, NSW, Australia
Béatrice Berçot, Hôpital de Bicêtre, Paris, France

Comments on this article

All Comments(3)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

12 Views

30 Nov 2015 | for Version 3

Sally Partridge, Sydney West Area Health Service, Sydney, NSW, Australia

12 Views Cite this report Responses(0)

Approved

The grey shading to indicate the attC site should not start until the start of 1L and the portion derived from attI1 is still not indicated.

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

21 Views

18 Nov 2015 | for Version 2

Sally Partridge, Sydney West Area Health Service, Sydney, NSW, Australia

21 Views Cite this report Responses(1)

Approved With Reservations

This manuscript has been improved and the points I raised have been addressed, but I have some comments about the new Fig. 2:

The underlined uppercase letters indicating the blaGES-1 coding region should extend until the stop codon at position 914.
ttagat of the IR site shown for the complete blaGES-1 attC is really part of the adjacent 3'-CS in AF355189 (most of the 1R core site belonging to the blaGES cassette (TTAGAC) is found at the start of the linear cassette). I would suggest ending this sequence after the first g of this site.
The partial 1L of the truncated blaGES cassette (924-9), the nucleotides derived from the attI1 site (930-6) and 1R of the aacA4 cassette (937-42) should be indicated. I would suggest ending the sequence of the truncated cassette after 1R of aacA4, as the alignment of the complete attC with the start of the aacA4 cassette beyond this point is not really useful.

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (1)

Author Response

27 Nov 2015

Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

Reviewer: The underlined uppercase letters indicating the blaGES-1 coding region should extend until the stop codon at position 914.

Response: Reviewer is right. This was corrected in the figure. Actually, the figure was modified in order to make clearer the differences between the canonical GES-1 attC and the truncated GES-1 attC found in this study.

Reviewer: ttagat of the IR site shown for the complete blaGES-1 attC is really part of the adjacent 3'-CS in AF355189 (most of the 1R core site belonging to the blaGES cassette (TTAGAC) is found at the start of the linear cassette). I would suggest ending this sequence after the first g of this site.
Response: We agree and this was corrected in the new figure.

Reviewer: The partial 1L of the truncated blaGES cassette (924-9), the nucleotides derived from the attI1 site (930-6) and 1R of the aacA4 cassette (937-42) should be indicated. I would suggest ending the sequence of the truncated cassette after 1R of aacA4, as the alignment of the complete attC with the start of the aacA4 cassette beyond this point is not really useful.

Response: We agree and this was modified in the new figure.

View more View less

Competing Interests

There is no competing interests

Back to all reports

Reviewer Report

12 Views

28 Sep 2015 | for Version 2

Béatrice Berçot, Service de Bactériologie-Virologie, Hôpital de Bicêtre, Paris, France

12 Views Cite this report Responses(0)

Approved

I have read the updated paper which is clear and well written. Little is known in transcription of fused cassettes and these experimental data highlighted that the two genes are cotranscripted and mobilized together. The author answered all my request and I have not supplementary remarks

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

25 Views

21 May 2013 | for Version 1

Béatrice Berçot, Service de Bactériologie-Virologie, Hôpital de Bicêtre, Paris, France

25 Views Cite this report Responses(1)

Approved With Reservations

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (1)

Author Response

07 Sep 2015

Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that the Pseudomonas isolates harbored another class 1 integron containing the gcu14 gene followed by the aacA4 gene?
Response: Yes, the presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

The authors have to provide in the paper the classical length of the bla_GES-1 attC site, which is 110bp and contained the 1L, 2L, 2R and 1R sequences-shown in bold.
Response: A figure showing the truncated and the complete canonical attC from GES1 was included in the new version.

So, the distance from of the stop of blaGES-1 to the start codon of the aacA4 gene is 46bp. The translational start codon of aacA4 gene is erroneous in the Genbank data base (DC236170). Indeed, it has been determined by N-terminal amino acid sequencing to be a GTG (in italic in the sequence above) and the beginning of the cassette was 24 bp before [Hanau-Bercot B. et al., 2002].
-Could the Genbank annotation be modified as explained above?
Response: We performed this modification and the updated sequence regarding the beginning of aacA4 gene is already accessible on GenBank database under the same accession number (DQ236170).

-The Appendex is not necessary and should be deleted.
Response: The appendix is only for helping referees in their evaluation. It will not be published.

-In the sentence page 4, line 13, “The single copy of rpsL gene of Pseudomonas...”, should be replaced by “the rpsL gene of Pseudomonas (see Bodilis et al., 2012).
Response: this was modified in the new version of the manuscript.

In the conclusion, page 6, change “never” to “rarely”.
Response: this was modified in the new version of the manuscript.

View more View less

Competing Interests

There is no competing interests

Back to all reports

Reviewer Report

32 Views

02 May 2013 | for Version 1

Sally Partridge, Sydney West Area Health Service, Sydney, NSW, Australia

32 Views Cite this report Responses(1)

Approved With Reservations

Abstract Line 5- fused cassettes do not always have fused orfs (e.g. aacA1/orfG)
Abstract 6th Line from end and Results and Discussion p. 5 1st Line of 2nd paragraph – what is in the gcu14-aacA4 circular form? Should this be blaGES-1/aacA4?
Materials and Methods Line 1 – this needs rewording to explain that gcu is a gene cassette of unknown function.
Results and Discussion p. 4 – the fusion here is the type where part of the blaGES-14 attC site is replaced by part of the attI1 site (see ref. 14). The LH and RH domains are part of the attC site, rather than flanking it. The 5′ UTR contains 6 bp of the attC site.
Results and Discussion p. 5 – most of the 1L core site and the 1R core site of the blaGES attC site are present.
Results and Discussion p. 6 – the deletion of part of the attC site doesn’t bring the aacA4 gene much closer to Pc and ref. 14 makes slightly different point (that expression of the downstream cassette may be enhanced).

Formatting “14” of gcu14 and “A4” of aacA4 should be in italics.Transposon, gene and species names etc are not correctly formatted in the references.

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (1)

Author Response

07 Sep 2015

Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil

The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to make it possible to assess whether they support the conclusions drawn in the paper.
Response: The sequence resulted from inverse PCR product, showing the circular form of the gcu14-blaGES-1-aacA4 array, was submitted to GenBank under accession number KT336477. This information was included in the text. Moreover, we provided a new figure showing a schematic representation of primer targeting sites used in inverse PCR in order to make easier for the reviewers comprehend our strategy and results.

Some reorganisation (moving some information in the Results and Discussion to the Introduction) would help to make the paper easier to follow and the Conclusions section is very short and could be expanded. The English could also be improved and the manuscript checked for typos etc.
Response: We agree that some points from results and discussion section would be more adequate in the introduction section, and they were moved in the new version of the manuscript (Page 3, lines 59-60 and 65-70; page 4, lines 71-76 in the new version).
The English was reviewed by a native spoken-English, and the conclusion was expanded.

A few specific points also need correcting or clarifying:

Abstract Line 5- fused cassettes do not always have fused orfs (e.g. aacA1/orfG)
Response: We agree and it was modified: We affirmed that only in some cases fused orfs can be created.

Abstract 6th Line from end and Results and Discussion p. 5 1st Line of 2nd paragraph – what is in the gcu14-aacA4 circular form? Should this be blaGES-1/aacA4?
Response: The presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).

     Materials and Methods Line 1 – this needs rewording to explain that gcu is a gene cassette of unknown function.
Response: It was included in the text.

    Results and Discussion p. 4 – the fusion here is the type where part of the blaGES-1 attC site is replaced by part of the attI1 site (see ref. 14). The LH and RH domains are part of the attC site, rather than flanking it. The 5′ UTR contains 6 bp of the attC site.
Response: We change the text emphasizing that the attC was replaced by part of attI1.
The referee is right; LH and RH domains are part of the attC site, rather than flanking it. This general idea concerning attC site and its domains was modified throughout the text.

     Results and Discussion p. 5 – most of the 1L core site and the 1R core site of the blaGES attC site are present.
Response: In fact, only the 1L core site is present in the truncated attC. We included a figure (figure 2) in this new version showing this.

     Results and Discussion p. 6 – the deletion of part of the attC site doesn’t bring the aacA4 gene much closer to Pc and ref. 14 makes slightly different point (that expression of the downstream cassette may be enhanced).
Response: The referee is right. This statement was removed.

Formatting “14” of gcu14 and “A4” of aacA4 should be in italics. Transposon, gene and species names etc are not correctly formatted in the references.
Response: All formatting errors were properly corrected.

View more View less

Competing Interests

There is no competing interests

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Collis CM, Hall RM: Expression of antibiotic resistance genes in the integrated cassettes of integrons. Antimicrob Agents Chemother. 1995; 39: 155–162.

[2] 2. Collis CM, Hall RM: Site-specific deletion and rearrangement of integron insert genes catalyzed by the integron DNA integrase. J Bacteriol. 1992; 174: 1574–1585.

[3] 3. Jacquier H, Zaoui C, Sanson-le Pors MJ, et al:Translation regulation of integrons gene cassette expression by the attC sites. Mol Microbiol. 2009; 72: 1475–1486.

[4] 4. Recchia GD, Hall RM: Gene cassettes: a new class of mobile element. Microbiology. 1995; 141: 3015–3027.

[5] 5. Mendes RE, Toleman MA, Ribeiro J, et al:Integron carrying a novel metallo-β-lactamase gene, blaIMP-16, and a fused form of aminoglycoside-resistant gene aac(6')-30/aac(6')-Ib': report from the SENTRY Antimicrobial Surveillance Program. Antimicrob Agents Chemother. 2004; 48: 4693–4702.

[6] 6. da Fonseca EL, Vieira VV, Cipriano R, et al:Emergence of blaGES-5 in clinical colistin-only-sensitive (COS) Pseudomonas aeruginosa strain in Brazil. J Antimicrob Chemother. 2007; 59: 576–577.

[7] 7. Jové T, Da Re S, Denis F, et al:Inverse correlation between promoter strength and excision activity in class 1 integrons. PLoS Genet. 2010; 6: e1000793.

[8] 8. Stokes HW, O'Gorman DB, Recchia GD, et al:Structure and function of 59-base element recombination sites associated with mobile gene cassettes. Mol Microbiol. 1997; 26: 731–745.

[9] 9. Recchia GD, Hall RM: Plasmid evolution by acquisition of mobile gene cassettes: plasmid pIE723 contains the aadB gene cassette precisely inserted at a secondary site in the incQ plasmid RSF1010. Mol Microbiol. 1995; 15: 179–187.

[10] 10. Hocquet D, Llanes C, Thouverez M, et al:Evidence for induction of integron-based antibiotic resistance by the SOS response in a clinical setting. PLOS Pathog. 2012; 8: e1002778.

[11] 11. Partridge SR, Collis CM, Hall RM: Class 1 integron containing a new gene cassette, aadA10, associated with Tn1404 from R151. Antimicrob Agents Chemother. 2002; 46: 2400–2408.

[12] 12. Ramirez MS, Parenteau TR, Centron D, et al:Functional characterization of Tn1331gene cassettes. J Antimicrob Chemother. 2008; 62: 669–673.

[13] 13. Hanau-Berçot B, Podglajen I, Casin I, et al:An intrinsic control element for translational initiation in class 1 integrons. Mol Microbiol. 2002; 44: 119–130.

[14] 14. Partridge SR, Tsafnat G, Coeira E, et al:Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev. 2009; 33: 757–784.

[15] 15. Poirel L, Le Thomas I, Naas T, et al:Biochemical sequence analyses of GES-1, a novel class A extended-spectrum β-lactamase, and the class 1 integron In52 from Klebsiella pneumoniae. Antimicrob Agents Chemother. 2000; 44: 622–632.

[16] 16. Céntron D, Roy PH: Presence of a group II intron in a multiresistant Serratia marcescens strain that harbors three integrons and a novel gene fusion. Antimicrob Agents Chemother. 2002; 46: 1402–1409.

[17] 17. Dubois V, Poirel L, Marie C, et al:Molecular characterization of a novel class 1 integron containing bla(GES-1) and a fused product of aac3-Ib/aac6'-Ib' gene cassettes in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2002; 46: 638–645.

[18] 18. Walsh TR, Toleman MA, Hryniewicz W, et al:Evolution of an integron carrying blaVIM-2 in Eastern Europe: report from SENTRY antimicrobial surveillance program. J Antimicrob Chemother. 2003; 52: 116–119.

Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa

Abstract

Keywords

Introduction

Material and methods

Table 1. Primers used in conventional, inverse and real-time PCR reactions.

Results and discussion

Figure 1. Northern blot analysis of gcu14-blaGES-1/aacA4 gene cassette array from P. aerginosaclass 1 integron.

Figure 2. Transcription level of gcu14/blaGES-1/aacA4 gene cassette array.

Conclusions

Nucleotide sequence accession number

Author contributions

Competing interests

Grant information

Acknowledgements

References

Comments on this article Comments (3)

Open Peer Review

Comments on this article Comments (3)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated

Figure 1. Northern blot analysis of gcu14-bla_GES-1/aacA4 gene cassette array from P. aerginosaclass 1 integron.

Figure 2. Transcription level of gcu14/bla_GES-1/aacA4 gene cassette array.