ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa

[version 2; peer review: 1 approved, 1 approved with reservations]
PUBLISHED 07 Sep 2015
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

The gene cassettes found in class 1 integrons are generally promoterless units composed by an open reading frame (ORF), a short 5’ untranslated region (UTR) and a 3’ recombination site (attC). Fused gene cassettes are generated by partial or total loss of the attC from the first cassette in an array, creating, in some cases, a fusion with the ORF from the next cassette. These structures are rare and little is known about their mechanisms of mobilization and expression. The aim of this study was to evaluate the dynamic of mobilization and transcription of the gcu14-blaGES-1/aacA4 gene cassette array, which harbours a fused gene cassette represented by blaGES-1/aacA4. The cassette array was analyzed by Northern blot and real-time reverse transcription-polymerase chain reaction (RT-PCR) in order to assess the transcription mechanism of blaGES-1/aacA4 fused cassette. Also, inverse polymerase chain reactions (PCR) were performed to detect the free circular forms of gcu14, blaGES-1 and aacA4. The Northern blot and real time RT-PCR revealed a polycistronic transcription, in which the fused cassette blaGES-1/aacA4 is transcribed as a unique gene, while gcu14 (with a canonical attC recombination site) has a monocistronic transcription. The gcu14 cassette, closer to the weak configuration of cassette promoter (PcW), had a higher transcription level than blaGES-1/aacA4, indicating that the cassette position affects the transcript amounts. The presence of ORF-11 at attI1, immediately preceding gcu14, and of a Shine-Dalgarno sequence upstream blaGES-1/aacA4 composes a scenario for the occurrence of array translation. Inverse PCR generated amplicons corresponding to gcu14, gcu14-aacA4 and gcu14-blaGES-1/aacA4 free circular forms, but not to blaGES-1 and aacA4 alone, indicating that the GES-1 truncated attC is not substrate of integrase activity and that these genes are mobilized together as a unique cassette. This study was original in showing the transcription of fused cassettes and in correlating cassette position with transcription.

Keywords

gene cassette, clase 1 integrons, fused gene cassette, transcription

Revised Amendments from Version 1

Doubts and questions made by reviewers have been answered in the comments section, and whenever possible an explanation was made in the manuscript in order to make it clear to readers.

  • A new figure (Figure 2) was provided showing the alignment of canonical and truncates GES-1 attC site as requested by Dr. Berçot.
     
  • We contacted the GenBank staff in order to alter the start codon of aacA4 gene cassette, which was erroneous annotated in the original DQ236170 accession number, as noticed by Dr. Berçot. The correct gene annotation has already been performed and the GenBank accession number provided in the second version of the manuscript is already updated.
     
  • As requested by Dr. Partridge, the sequence showing that the  free circular form was composed by the entire gene cassette arrangement was properly annotated and submitted to GenBank under the accession number KT336477. As such, we have removed this information from the appendices. In order to help and guide reviewers and readers, a new figure (figure 3) showing the inverse PCR approach and the sequence resulted from it was provided.
     
  • As suggested By Dr. Partridge, some parts of the results and discussion was moved to the introduction section, as highlighted, and the conclusion section was expanded.​
     
  • Since new and more informative data concerning the presence and configuration of cassette circular forms (Figure 3 and the releasing of the deposited senquence KT336477) were provided in the second version, the presentation of figshare widget would not be necessary anymore, and it was removed from this second version.

See the authors' detailed response to the review by Béatrice Berçot
See the authors' detailed response to the review by Sally Partridge

Introduction

Class 1 integrons are capable of inserting, excising and rearranging gene cassettes by a site-specific recombination mechanism. These assembly platforms can also act as expression systems due to the presence of a promoter region (Pc), which drives the expression of genes captured by integron1. Moreover, naturally occurring integrons may have a second promoter (P2), which is activated by the insertion of three G residues between -35 and -10 hexamers1. Gene cassettes are generally promoterless units associated with a recombination site (attC or 59-be), which confers the ability of each structure to be mobilized independently2, and the Left Hand (LH – 1L and 2L core sites) and Right Hand (RH – 1R and 2R core sites) domains from attC sites are crucial for this mobilization3. Studies focusing on gene cassette translation in the context of integrons are rare, however, it was recently showed that attC sites regulate the translation of downstream cassettes due to their peculiar sequences composed by imperfect inverted repeats that form stem-loop structures. These secondary structures prevent ribosome progression throughout mRNA, reflecting in a decreased expression of more distal genes regarding Pc4. Conversely, TIR (Translation Initiation Region)-deficient gene cassettes could have their expression promoted by the presence of ORF-115. This ORF, when present, is found at the attI site preceding the gene cassette array. It codes for 11 amino acids and harbours its own Shine-Dalgarno (SD) sequence. Therefore, the ORF-11 recruits the ribosomes and, through an event of coupled translation, the subsequent TIR-deficient gene cassette could be expressed4,5. Gene cassettes can be found inserted in integrons or in other secondary sites, or free in the cytoplasm as a closed circle, in which the 5’ end (5’ UTR) and the attC recombination site are covalently linked6.

As demonstrated previously, several stress conditions could evoke the activation of the SOS response resulting in integron-integrase expression7. Therefore, under stress, the integrase activity increases, favoring the occurrence of integration/excision/rearrangements events.

Although rare, fused cassettes may be generated by partial or total loss of the first attC, retaining both complete coding regions and, therefore, creating permanent gene arrays comparable to bacterial operons8. The functionality of such structures has been indirectly inferred by the resistance profile of transformants carrying the fusion9; however, the transcription itself has never been verified.

This study showed the dynamics of fused cassette mobilization, the co-transcription of the gcu14-blaGES-1/aacA4 cassette array and the effect of cassette position on transcription levels in Pseudomonas aeruginosa wild lineages carrying class 1 integrons. Moreover, the presence of translation signals in this gene cassette array was determined.

Material and methods

An unknown Open Reading Frame (ORF), gcu14 (gene cassette of unknown function), followed by the fused cassette blaGES-1/aacA4, created by partial loss of GES-1 attC were present in integrons from clinical P. aeruginosa isolates (PS1 and PS26)10. Total RNA was extracted and purified according to the manufacturer’s instructions with the SV 96 Total RNA Isolation System (Promega). Northern blot using 7 μg of total RNA from PS1 and PS26 was performed in order to detect the transcript originated from gcu14-blaGES-1/aacA4 cassette array. After electrophoresis in a denaturing-formaldehyde 1.5% agarose gel, the total RNA was transferred to the Hybond-N+ nylon membrane (GE Healthcare) by upward capillary transfer. An amplicon of 519bp corresponding to part of the blaGES-1 gene was used as a probe (Table 1) in hybridization assay. The GES probe was labeled with the AlkPhos Direct Labelling kit (GE Healthcare) and hybridized with the target RNA immobilized on the Hybond-N+ membrane as recommended. The chemiluminescence was detected with the CDP-Star detection reagent (GE Healthcare) according to manufactures. Immediately after applying the detection reagents, the blot was drained, incubated five minutes at room temperature and exposed to the Hyperfilm ECL (GE Healthcare) for 60 minutes at room temperature.

Table 1. Primers used in conventional, inverse and real-time PCR reactions.

PrimerPrimer sequence (5' – 3')Size (bp)Target
Primers for conventional PCR
Ges F
Ges R
GCGTTTTGCAATGTGCTC
CCAGTTTTCTCTCCAACAACC
519Internal fragment of
blaGES gene
Primers for inverse PCR
Gcu14 FSQ
Gcu14 RSQ
AGCAATCAACACACAGGGG
CTCGCGTAAATGCACCGCTT
130gcu14 circular form
GES FSQ
GES RSQ
CAAGTTATTACACAACTCAT
AGTGCGTGAATGAAGCGCAT
110blaGES-1 circular form
AACA4 FSQ
AACA4 RSQ
GCCAGGCATTCGAGCGAACAC
ATTTAGCCACTCACATAGAGC
188aacA4 circular form
Primers and probes for real time PCR (TaqMan)
RpsL F
RpsL R
Probe
GCCTGCGCTGCAAAACT
TTTCGGCGTGGTGGTGTAT
TCGTGGCGTATGCACC
67rpsL transcripts
Gcu14 F
Gcu14 R
Probe
CATGCGCTTCTTGGTTCGT
ACGCCAGCTTGGATGCAA
ATGCCACGAGACCTT
56gcu14 transcripts
Ges F2
Ges R2
Probe
GTGCAGCTTAGCGACAATGG
CACAGAGTCGCCAATTTTACGA
AATTGCAGCAGGTCCGCC
99blaGES-1 transcripts
AacA4 F
AacA4 R
Probe
CAAGCGTTTTAGCGCAAGAGT
TCGGCTCTCCATTCAGCATTG
CCGTCACTCCATACATTG
59aacA4 transcripts
Ges F3
AacA4 R2
Probe
TCCTGAGCACGGACAAATAG
TCATAGAGCATCGCAAGGTC
TTCCGTCACACTGCGCCTCA
134Polycistronic transcripts

In order to verify whether the relative position of gene cassettes on the variable region plays a role in transcription level, real-time RT-PCR reactions using the TaqMan System (Applied Biosystems) were performed with primers and probes detailed in Table 1. The rpsL gene of the P. aeruginosa chromosome was amplified by PCR (Table 1) and used as a reference gene for normalization. The relative quantification (RQ) results were presented as ratios of gene transcription between the target gene (cassettes) and the reference gene (rpsL), which were obtained according to the following equation: RQ=2-ΔCT, where CT is the value corresponding to the crossing point of the amplification curve with the threshold and ΔCT=CT target gene minus CT reference gene. The effect of cassette position on gene transcription was considered significant when the ratios obtained between RQ values (RQ value of cassette 1/RQ value of cassette 2) were ≥2.0, taking into account the standard deviation intervals.

In order to induce cassette excision from integrons, PS1 and PS26 strains10 were submitted to thermal stress during the log growth phase to induce integrase activity. Cells were grown on Luria-Bertani (LB) broth medium (OXOID) at 37°C for two hours. Subsequently, the bacterial cultures were submitted to a heat shock at 4°C for 30 minutes and immediately incubated at 42°C for another 30 minutes. Briefly, the total DNA from PS1 and PS26 cultured under thermal stress were obtained with the Wizard Genomic DNA purification kit (Promega) following manufacturer recommendations and used as templates in inverse PCR reactions. The inverse PCR was performed with primers facing outwards towards the ends of gcu14, blaGES-1 and aacA4 so that only circular gene cassette configurations would be amplified. The reactions targeting the circular forms of gcu14, blaGES-1, aacA4 and blaGES-1/aacA4 fusion was performed with primers and combinations described in Table 1. The inverse PCR was performed using Platinum Taq DNA Polymerase reagents (Invitrogen), and the following components were added to a sterile 0.2-mL tube: 5 µL of 10X PCR buffer (1X final concentration); 1 µL of 10mM dNTP mixture (0.2 mM each); 1.5 µL of 50mM MgCl2 (1.5 mM final concentration); 2 µL of 15 µM of each primer (30 µM each); 100 ng of template DNA; 0.3 µL of Platinum Taq DNA Polymerase (1U final concentration). The tubes were incubated in the Eppendorf MasterCycler (Eppendorf) at 94°C for 2 minutes and PCR amplification was performed in 40 cycles consisting of: 94°C for 30 seconds; 55°C for 30 seconds; and 72°C for 3 minutes. The amplicons generated with the inverse PCR were purified using Wizard SV Gel and PCR Clean-Up system kit (Promega) and directly sequenced on both strands. Sequencing reactions were performed with Big Dye Terminator RR Mix (Applied Biosystems) in an ABI 3730 XL DNA Analyzer (Applied Biosystems). Nucleotide sequences were compared to those available in the GenBank database accessible on the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov). All primers used in PCR, sequencing and real time RT-PCR are described in Table 1.

Analyses in silico were performed to search for a potential promoter for gcu14 gene cassette. The 5’UTR from gcu14 were submitted to the promoter predictor programs Neural Network for Promoter Prediction version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/index.html) and BPROM (SoftBerry, http://linux1.softberry.com/berry.phtml). Results with the highest scores were selected as candidates for a putative promoter.

Results and discussion

The integrons analysed in this study harbored the weak Pc configuration (PcW)11, and they carry the gcu14 as the first gene cassette (see reference 12 for nomenclature), which has not been reported so far. Considering that transcription initiates from the Pc promoter placed upstream the cassette array, both monocistronic and full length polycistronic transcripts could be identified. In fact, Northern blot and hybridization assays revealed a unique signal of approximately 2,300 bases, which corresponds to the co-transcription of the entire array (gcu14-blaGES-1/aacA4) (Figure 1). This result is in agreement with previous work in which the occurrence of transcripts containing more than one gene cassette was observed by Northern blot analysis1. Moreover, this finding gives support to the lack of attC function in terminating transcription of downstream gene cassettes as demonstrated previously4.

0d4eefaf-21b0-43d8-850c-ea1d50f0735f_figure1.gif

Figure 1. Northern blot analysis of gcu14-blaGES-1/aacA4 gene cassette array from P. aerginosa class 1 integron.

The full length transcript (2,300 bases), corresponding to the entire gene cassette array, hybridized with the GES probe (arrow). The fragment sizes of the RNA marker (Promega) used in RNA electrophoresis are indicated.

This fusion retained both entire coding regions and, due to a possible erroneous recombination event, the blaGES-1 attC site was replaced by part of the attI1 site (DQ236170)10, reducing it to the 6bp from the 1L core site (Figure 2). Taking into account that the region responsible for stem-loop formation was missing in GES-1 attC and the participation of this site in terminating translation4, our findings indirectly suggested that blaGES-1 and aacA4 translation is occurring in a unique step.

0d4eefaf-21b0-43d8-850c-ea1d50f0735f_figure2.gif

Figure 2. Alignment of the truncated and the complete/canonical blaGES-1 attC sites.

Underlined capital letters represent the blaGEs-1 coding region. The attC site is indicated in lower case; the core sites 1L, 2L, 2R and 1R are in boldface and underlined.

The strains were submitted to thermal stress conditions in order to verify the dynamics of mobilization of gcu14-blaGES-1/aacA4 gene cassettes. Since the excision event depends on the recognition of the LH and RH domains of the attC site, and that the 2L core site and the entire RH domain are missing in GES-1 attC (Figure 2), it is expected that the blaGES-1/aacA4 excision occurs only at the aacA4 attC site, and that this structure is excised together as a unique cassette.

Positive results were obtained for the gcu14, gcu14-aacA4 and gcu14-blaGES-1/aacA4 circular forms, but not for blaGES-1 and aacA4 alone. This finding indicates that the GES-1 attC is not functional and that the fused gene cassette is excised as a unique cassette. Moreover, the presence of gcu14-aacA4 circular form suggests that this strain carries a second integron containing this gene cassette arrangement. Sequencing assessed the recombination point where excision occurred, confirming the occurrence of free circular forms (Figure 3). This is in agreement with the presence of the PcW configuration, in which the corresponding intI1 gene codes for a high efficient integrase11. The lack of activity of a truncated attC had also been observed before when associated with aadA1013. However, Ramirez and colleagues14 showed that the integrase was able to recognize and mediate excision of a truncated site associated to aadA1, indicating that the genetic context of such truncated sites could influence their role in IntI1 recognition and mobilization.

0d4eefaf-21b0-43d8-850c-ea1d50f0735f_figure3.gif

Figure 3. Schematic representation of the free circular form cassette array resulted from the inverse PCR assay.

(A) inserted/linearized form of integron harbouring the fused cassettes. Arrows show the gene transcription orientation. Thin arrows represent the annealing sites of the inverse PCR and sequencing primers whose generated product corresponded to the cassette circular form illustrated in (B). (B) Illustration of the free circular form of gene cassettes represented in (A). Thin arrows show the primers used to obtain the inverse PCR product (GES FSQ and GES RSQ) and the primers used in sequencing (AACA4 FSQ and GES RSQ) that revealed the excision in block of the entire gene cassette arrangement (gcu14-blaGES-1/aacA4) from integron (red curved line).

The relative quantification performed by real time RT-PCR revealed that PS1 and PS26 presented very similar RQ values for gcu14-blaGES-1/aacA4 transcription (Figure 4). This result was expected since integrons from these two strains have the same backbone, including the Pc promoter, and are at the same genetic environment10.

0d4eefaf-21b0-43d8-850c-ea1d50f0735f_figure4.gif

Figure 4. Transcription level of gcu14-blaGES-1/aacA4 gene cassette array.

The relative quantification values obtained by real time RT-PCR are indicated for each gene cassette and for the fusion blaGES-1/aacA4 when considered as a unique gene.

gcu14, the first cassette in integrons with the weak PcW configuration, presented approximately two-fold higher transcription when compared to blaGES-1 and aacA4 separately or when the fused cassette blaGES-1/aacA4 was considered (Figure 4). The same RQ value obtained for blaGES-1, aacA4 and the fusion reveals that these two ORFs are transcribed as a unique gene. The lower transcript amount of blaGES-1/aacA4 compared to gcu14 lies on the distance between these gene cassettes and Pc, which is one of the determinants influencing cassette transcription1,7, and it shows the effect of cassette position on expression levels.

A putative promoter for gcu14 (-35 TTGATG [17 bp] -10 TGTTAC) was found 45 bp upstream from its start codon, which has the potential to influence transcription. Moreover, the ORF-11, which enhances the translation efficiency of downstream TIR-deficient cassettes inserted in integrons5, was found at the attI1 region preceding the TIR-deficient gcu14 gene cassette. This ORF contained its own Shine-Dalgarno (SD) sequence placed 8 bp upstream of the ATG codon. The ribosome at the ORF-11 stop codon could, therefore, be carried along the mRNA by lateral diffusion, reinitiating translation at the gcu14 start codon. A potential SD sequence was identified 10 bp upstream of the fused cassette blaGES-1/aacA4. In addition, the loss of the GES-1 attC region, which is involved in stem-loop formation, may enhance the chances of aacA4 translation, since this attC, reduced to the 6bp of the 1L core site, no longer constitutes a physical barrier to ribosome progression4. Together, these findings create a scenario for the occurrence of gcu14-blaGES-1/aacA4 expression in PS1 and PS26, which then provides a possible explanation for their resistance profile to β-lactams and aminoglycosides that has been observed elsewhere10.

Conclusions

Fused cassettes have been found in class 1 integrons9,1318; however, the transcription of such structures has rarely been addressed. This work showed the transcription pattern of a fused cassette as a polycistronic mRNA and that these unusual structures are excised as a unique cassette. The mobilization in block of the entire gcu14-blaGES-1/aacA4 array together with its active transcription, and the presence of translational signatures demonstrate the potential for dissemination and expression of multidrug resistance, in a one-step fashion, to other bacteria. Therefore, such events could represent a threat to public health and to the establishment of efficient antibiotic regiments.

Nucleotide sequence accession number

The sequence of the cassette array composed by the fusion has been deposited in the GenBank database under accession number DQ236170. The sequence obtained from the inverse PCR amplicon, showing the circular form gene organization, was submitted to GenBank under accession number KT336477.

Data availability

Figshare: Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa doi: http://dx.doi.org/10.6084/m9.figshare.65171719

Comments on this article Comments (3)

Version 3
VERSION 3 PUBLISHED 27 Nov 2015
Revised
Version 1
VERSION 1 PUBLISHED 28 Mar 2013
Discussion is closed on this version, please comment on the latest version above.
  • Author Response 07 Sep 2015
    Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil
    07 Sep 2015
    Author Response
    Dear Authors,

    Besides the comments already made by the reviewers, I would like to specify some points:
    • The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has
    ... Continue reading
  • Reader Comment 23 May 2013
    Thomas Jové, LGPB, Belgium
    23 May 2013
    Reader Comment
    Dear authors,

    I would like to add some further comments:

    - First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G ... Continue reading
  • Reader Comment 17 May 2013
    Thomas Jové, LGPB, Belgium
    17 May 2013
    Reader Comment
    Dear Authors,

    Besides the comments already made by the reviewers, I would like to specify some points:

    • The C to G mutations that converts the usual weak PcW variant into PcWTGN-10
    ... Continue reading
  • Discussion is closed on this version, please comment on the latest version above.
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Fonseca ÉL and Vicente ACP. Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [version 2; peer review: 1 approved, 1 approved with reservations]. F1000Research 2015, 2:99 (https://doi.org/10.12688/f1000research.2-99.v2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 07 Sep 2015
Revised
Views
23
Cite
Reviewer Report 18 Nov 2015
Sally Partridge, Sydney West Area Health Service, Sydney, NSW, Australia 
Approved with Reservations
VIEWS 23
This manuscript has been improved and the points I raised have been addressed, but I have some comments about the new Fig. 2:
  1. The underlined uppercase letters indicating the blaGES-1 coding region should extend until the stop codon at position 914.
     
  2. ttagat
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Partridge S. Reviewer Report For: Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [version 2; peer review: 1 approved, 1 approved with reservations]. F1000Research 2015, 2:99 (https://doi.org/10.5256/f1000research.3720.r10226)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 27 Nov 2015
    Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil
    27 Nov 2015
    Author Response
    Reviewer: The underlined uppercase letters indicating the blaGES-1 coding region should extend until the stop codon at position 914.
     
    Response: Reviewer is right. This was corrected in the figure. Actually, the ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 27 Nov 2015
    Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil
    27 Nov 2015
    Author Response
    Reviewer: The underlined uppercase letters indicating the blaGES-1 coding region should extend until the stop codon at position 914.
     
    Response: Reviewer is right. This was corrected in the figure. Actually, the ... Continue reading
Views
17
Cite
Reviewer Report 28 Sep 2015
Béatrice Berçot, Service de Bactériologie-Virologie, Hôpital de Bicêtre, Paris, France 
Approved
VIEWS 17
I have read the updated paper which is clear and well written. Little is known in transcription of fused cassettes and these experimental data highlighted that the two genes are cotranscripted and mobilized together. The author answered all my request and I ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Berçot B. Reviewer Report For: Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [version 2; peer review: 1 approved, 1 approved with reservations]. F1000Research 2015, 2:99 (https://doi.org/10.5256/f1000research.3720.r10563)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 28 Mar 2013
Views
28
Cite
Reviewer Report 21 May 2013
Béatrice Berçot, Service de Bactériologie-Virologie, Hôpital de Bicêtre, Paris, France 
Approved with Reservations
VIEWS 28
This work is conducted to address the transcription of the fused gene cassette blaGES-1/aacA4. This arrangement is rare but not exceptional in a class 1 integron. In this work, the experimentation confirmed that the three gene cassettes harbored in this ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Berçot B. Reviewer Report For: Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [version 2; peer review: 1 approved, 1 approved with reservations]. F1000Research 2015, 2:99 (https://doi.org/10.5256/f1000research.903.r961)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 07 Sep 2015
    Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil
    07 Sep 2015
    Author Response
    It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 07 Sep 2015
    Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil
    07 Sep 2015
    Author Response
    It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that ... Continue reading
Views
33
Cite
Reviewer Report 02 May 2013
Sally Partridge, Sydney West Area Health Service, Sydney, NSW, Australia 
Approved with Reservations
VIEWS 33
This paper looks at expression of genes in a gene cassette array that includes a fused cassette and at the excision of cassette from this array. Polycistronic transcripts from cassette arrays and the excision of other fused cassettes have previously ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Partridge S. Reviewer Report For: Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [version 2; peer review: 1 approved, 1 approved with reservations]. F1000Research 2015, 2:99 (https://doi.org/10.5256/f1000research.903.r920)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 07 Sep 2015
    Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil
    07 Sep 2015
    Author Response
    The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 07 Sep 2015
    Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil
    07 Sep 2015
    Author Response
    The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to ... Continue reading

Comments on this article Comments (3)

Version 3
VERSION 3 PUBLISHED 27 Nov 2015
Revised
Version 1
VERSION 1 PUBLISHED 28 Mar 2013
Discussion is closed on this version, please comment on the latest version above.
  • Author Response 07 Sep 2015
    Erica Fonseca, Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil
    07 Sep 2015
    Author Response
    Dear Authors,

    Besides the comments already made by the reviewers, I would like to specify some points:
    • The C to G mutations that converts the usual weak PcW variant into PcWTGN-10 has
    ... Continue reading
  • Reader Comment 23 May 2013
    Thomas Jové, LGPB, Belgium
    23 May 2013
    Reader Comment
    Dear authors,

    I would like to add some further comments:

    - First, the class 1 integron sequence of the PS1 strain in Genbank DQ236170 does not display the rare C to G ... Continue reading
  • Reader Comment 17 May 2013
    Thomas Jové, LGPB, Belgium
    17 May 2013
    Reader Comment
    Dear Authors,

    Besides the comments already made by the reviewers, I would like to specify some points:

    • The C to G mutations that converts the usual weak PcW variant into PcWTGN-10
    ... Continue reading
  • Discussion is closed on this version, please comment on the latest version above.
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.