ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Note
Revised

Role of bacteriophages in STEC infections: new implications for the design of prophylactic and treatment approaches

[version 2; peer review: 2 approved, 1 approved with reservations]
PUBLISHED 26 Aug 2014
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Shiga toxin (Stx) is considered the main virulence factor in Shiga toxin-producing Escherichia coli (STEC) infections. Previously we reported the expression of biologically active Stx by eukaryotic cells in vitro and in vivo following transfection with plasmids encoding Stx under control of the native bacterial promoter1,2. Since stx genes are present in the genome of lysogenic bacteriophages, here we evaluated the relevance of bacteriophages during STEC infection. We used the non-pathogenic E. coli C600 strain carrying a lysogenic 933W mutant bacteriophage in which the stx operon was replaced by a gene encoding the green fluorescent protein (GFP). Tracking GFP expression using an In Vivo Imaging System (IVIS), we detected fluorescence in liver, kidney, and intestine of mice infected with the recombinant E. coli strain after treatment with ciprofloxacin, which induces the lytic replication and release of bacteriophages. In addition, we showed that chitosan, a linear polysaccharide composed of d-glucosamine residues and with a number of commercial and biomedical uses, had strong anti-bacteriophage effects, as demonstrated at in vitro and in vivo conditions. These findings bring promising perspectives for the prevention and treatment of haemolytic uremic syndrome (HUS) cases.

Revised Amendments from Version 1

In this version we have addressed the reviewers’ questions, have slightly modified Figures 1 and 2, and have added additional authors as they performed the new experiments

See the authors' detailed response to the review by Mikael Skurnik
See the authors' detailed response to the review by Raúl Raya

Introduction

Infections by Shiga toxin-producing Escherichia coli (STEC) strains are a serious public health concern, resulting in diarrhea, hemorrhagic colitis, and haemolytic uremic syndrome (HUS).

Stx is the main virulence factor in STEC strains. The stx gene is present in the genome of prophages, which are similar to the bacteriophage lambda found in the lysogenic form of various E. coli strains. Previously we reported that the native promoter of the Stx-encoding gene can drive expression of the toxin in eukaryotic cells in both in vivo and in vitro conditions1,2.

Many questions remain unanswered with regard to the mechanism by which STEC infection causes HUS. In particular, we are interested in understanding how Stx enters the systemic circulation and why only very small numbers of bacteria are sufficient to induce HUS in humans3.

Based on our previous observations that the native stx gene promoter is active in host cells, we seek to understand the role bacteriophages play in the pathogenesis of STEC strains. Recently, it was reported that bacteriophages carrying the stx gene are required for the development of HUS in the murine model4. Our hypothesis is that eukaryotic host cells are transduced with and/or infected by Stx-encoding bacteriophages, leading to in vivo dissemination after entry in. This would also explain why very small numbers of bacteria are sufficient to cause HUS.

In order to test whether bacteriophages are responsible for the induction of HUS, we used an anti-bacteriophage agent to inactivate them. Chitosan, a linear polysaccharide polymer obtained after the deacetylation of chitin, the structural element in the exoskeleton of crustaceans, possesses strong antimicrobial activity against several pathogenic microorganisms5. Its antiviral activity was reported on the bacteriophage c2, which infects Lactococcus strains, and on bacteriophage MS2, which infects E. coli6, without significantly affecting the growth of the bacterial strains7. In order to test our hypothesis, which would make Stx-encoding bacteriophages a new target for prevention and treatment of STEC infections; we used chitosan as an anti-bacteriophage agent both in vitro and in vivo.

For that purpose we employed recombinant phages in which the Stx-encoding genes were replaced by the gene encoding the green fluorescent protein (GFP). The results demonstrated that STEC phages can systemically disseminate in different mouse tissues and organs after delivery directly into the stomach of mice. In addition, with the present results we demonstrated that chitosan has strong inhibitory effects on STEC bacteriophage as demonstrated under in vitro and in vivo conditions.

Materials and methods

Strains

The E. coli C600ΔTOX:GFP strain is a lysogenized C600 strain carrying the 933W bacteriophage in which the stx gene was replaced by the gfp sequence (ϕΔTOX:GFP)8. The bacterial strain was generously provided by Dr. Alison Weiss. The enterohemorrhagic E. coli (EHEC) EDL933W strain (ATCC 43895) is lysogenic for the wild-type bacteriophage from which ϕΔTOX:GFP was obtained. E. coli Y 1090 strain was used in the bacteriophage titration assay (ATCC 37197).

Transduction of eukaryotic cells

BHK-21 cells (Syrian hamster kidney fibroblasts from the American Type Culture Collection) cells were grown on 12-well plates (Nunc) in complete medium (10% fetal bovine serum in DMEM medium, Gibco, USA) for use in the transduction assay. Phages (ϕΔTOX:GFP), at a multiplicity of infection (M.O.I) equal to 1, were added to BHK-21 cells spread the day before on 12 wells plate (Nunc). BHK-21 cells were counted with a Neubauer camera, and the bacteriophage titers were measured as described below. Transduction of BHK-21 cells was enhanced by centrifugation at 1,000 × g for 10 min at room temperature as previously reported1. After incubation at 37°C for 3 hours, the phage-containing medium was removed. Cells were washed twice with phosphate buffered saline (PBS) and then incubated in complete medium (DMEM, Gibco, USA). Twenty four hours post-transduction, cells were washed with PBS, harvested by Trypsin-EDTA incubation and centrifuged at 2,655 × g for 15 minutes. DNA was harvested from pellets after incubation for 5 minutes at 98°C in lysis solution (Tris pH8 50 mM, SDS 2%, Triton-X100 5%) and the harvested DNA was used for PCR. Primers: Up-R 5´CCGCTCGAGACTAGTGCAAAAGCGAGCCTGGTAAATAAATATG3´; Up-D 5´GGAATTCCATATGCTCGTTGAGGCATATGAAAATCAGAC3´. The reaction was run in a Eppendorf Termocycler at an initial 92°C for 120 seconds and then at 92°C for 20 seconds and 60°C for 20 seconds and 72°C for 120 seconds for 35 cycles using primers giving a fragment of 1310 bp on the upstream region of gfp gene into the bacteriophage genome.

Bacteriophage induction

The E. coli C600ΔTOX:GFP strain was grown in Luria Broth (LB) plus 10 mM CaCl2 and chloroamphenicol (Sigma) (15 μg/ml final concentration) overnight (ON) at 37°C under agitation. The ON culture was diluted to OD600nm = 0.1 in LB plus 10 mM CaCl2 and chloramphenicol (Sigma) (15 μg/ml final concentration). Induction was carried out by adding ciprofloxacin to a final concentration of 40 ng/ml9. Bacteria were incubated for 6 hours at 37°C under agitation. Cultures were then centrifuged at 5000 rpm for 15 minutes. The bacteriophage-containing supernatant was filtered with 0.2 μm filters and kept at 4°C until the titration assay was performed.

Titration assay

E. coli strain (ATCC 37197) was grown in LB plus ampicillin overnight at 37°C under agitation. The culture was diluted 1:100 in LB plus ampicillin and incubated for 2 additional hours at 37°C under agitation. At the end of the incubation, 500 μl samples of the E. coli strain were incubated with 5, 50 and 100 μl of a suspension containing bacteriophages for 30 minutes at room temperature. At the end of this incubation, 3 ml of Top Agar (Tryptone 1%; NaCl 0.5%; Agar 0.7%) plus CaCl2 (10 mM final concentration) was added, and plated on LB-Amp agar plates. Plates were incubated at 37°C and lysis plaques were visually counted.

Bacteriophage inactivation assay

The ϕΔTOX:GFP phage was incubated with chitosan (Sigma 448877) at a final concentration of 5 mg/ml in phosphate buffer 10 mM, at Ph = 7 for 10 minutes at room temperature, and the bacteriophage titers were measured as described in titration assay section. Chitosan was also used in the bacteriophage induction assay described above. Chitosan was added 2 and 4 hours post-induction and bacteriophage titers were analyzed at 6 hours post-induction.

Mice

BALB/c and DBA-2 mice were bred in-house at the animal facility of the Microbiology Department of the Sao Paulo University, Brazil. The protocol was approved by the Ethics Committee on Animal Experiments of the Institute of Biomedical Sciences (Protocol number 106), University of São Paulo. Male mice aged 6 weeks (18 to 20 g) were used for the In Vivo Imaging System (IVIS). Immature male and female DBA-2 mice (17–21 days of age, approximately 8–11 g body weight) were used immediately after weaning for the infection assays with EDL933W strain (n = 4). Mice were maintained under a 12-hour light-dark cycle at 22 ± 2°C and fed a standard diet and water ad libitum.

Ethics statement

The experimental protocol of this study followed the ethical principles for animal experimentation adopted by the Brazilian College of Animal Experimentation (COBEA) and was approved by the Ethics Committee on Animal Experiments of the Institute of Biomedical Sciences (Protocol number 106), University of São Paulo, in accordance with the principles set forth in the Guide for the Care and Use of Laboratory Animals (National Institutes of Health, 1985).

EHEC infection

Immature male and female DBA-2 mice (17–21 days of age, approximately 8–11 g body weight) were used immediately after weaning for the infection assays (n = 4). E. coli EDL933W strain was used for the mouse infection experiments following the protocol previously reported by Brando and collaborators9. Briefly, the E. coli EDL933W strain was grown in Tryptic Soy Broth (TSB, DIFCO, BD) overnight at 37°C. The culture was centrifuged at 14,000 rpm for 15 minutes and the bacterial pellet washed twice in phosphate buffered saline (PBS). Bacterial cells were suspended to a final concentration of 3 × 1013 CFU/ml. The bacterial suspension (100 μl) was delivered directly into the stomach of mice after 8 hours of food starvation, via a gavage needle. After 4 hours of ingesting the bacterial suspension, mice were given food and water. Control animals received 100 μl of sterile PBS. Survival was observed for one week. Both groups were composed by 4 animals.

In vivo chitosan protective effects

Immature male and female DBA-2 were infected with the E. coli EDL933W strain, as described above, and treated with 100 μl of a chitosan solution at a concentration of 5 mg/ml (500 μg of chitosan per mouse) orally administered 2 hours after infection and survival was recorded. Chitosan effects were also measured. -month old BALB/c mice orally infected with the E. coli C600ϕΔTOX:GFP strain. In vivo bacteriophage induction was carried out with ciprofloxacin as previously described by Zhang and collaborators9. Two 2 hours after induction with ciprofloxacin, 100 μl of the chitosan solution was administered orally to the mice and GFP dissemination by IVIS was analyzed.

In Vivo Imaging System (IVIS)

Two-month old BALB/c mice were orally infected with the E. coli C600:ϕΔTOX-GFP strain. Briefly, bacterial cells cultivated overnight in LB medium were washed with phosphate buffered saline (PBS), centrifuged again and suspended in a 20% sucrose to have a concentration of 1 × 1010 CFU. Mice were inoculated orally with 109 bacterial cells and in vivo bacteriophage excision was carried out as described by Zhang and collaborators9. Mice were submitted to euthanasia with CO2 inhalation 24 hours later. Blood, spleens, kidneys, lungs, brains, intestines, hearts and livers were harvested by surgical removal and kept in PBS solution for evaluation of GFP expression. GFP was excited at 465nm and detected at 510nm. Mice were analysed in a living Imaging 4.3.1 Calipter model (Life Sciences).

Statistical analysis

Statistical significance between treatments and controls was analyzed using the Prism 5.0 software (GraphPad Software), and the corresponding P values are indicated in the figures. Data correspond to means ± standard errors of the means (SEM) for individual mice. Statistical differences were determined using the one-way analysis of variance (ANOVA).

Results

Induction of ϕΔTOX:GFP by ciprofloxacin and chitosan anti-bacteriophage effects

Lytic induction was triggered in the E. coli C600ΔTOX:GFP strain using ciprofloxacin9. We observed a significant decrease in the optical density of the bacterial culture after addition of the antibiotic and the release of phages into the culture supernatant (Figure 1, panel A and B). The bacteriophage titers were determined at different time points after lytic induction and a significant increase in the number of viable bacteriophages was observed after induction (Figure 1, panel B). The effect of chitosan as an anti-bacteriophage agent was also examined. To this aim, we added chitosan to the bacterial culture 2 or 4 hours post-induction and we observed the complete inactivation of the ϕΔTOX:GFP without measurable toxic effects to the bacterial strain (Figure 1, panels A and B).

1e456d93-26da-417e-a08c-4c70d3b789c9_figure1.gif

Figure 1. Induction of ϕΔTOX:GFP by ciprofloxacin and effect of chitosan in vitro.

A. Growth curve: the E. coli C600ΔTOX:GFP strain was induced with ciprofloxacin and the optical density was measured at 600nm at 0, 2, 4 and 6 hours after induction. Non-induced culture of E. coli C600ΔTOX:GFP strain was used as control. Chitosan was added at 2 or 4 hours after induction. B. Bacteriophage ϕΔTOX:GFP titers: bacteriophage titers were determined at 0, 2, 4 and 6 hours post-induction. Chitosan was added at 2 or 4 h post-induction. *p<0.05.

Transduction of mammalian cells with ϕΔTOX:GFP

We previously reported the capacity of ϕΔTOX:GFP to transduce macrophages in vitro. To further evaluate the ability of chitosan to inhibit bacteriophage transduction, BHK-21 cells were transduced for 3 hours with ϕΔTOX:GFP, ϕΔTOX:GFP plus chitosan or ϕΔTOX:GFP previously treated with DNAse. Addition of DNAse would eliminate any free bacteriophage DNA in the bacterial lysates. As shown in Figure 2, ϕΔTOX:GFP DNA was detected by PCR in exposed mammalian cells, confirming that the virus was proficient to transduce this cell line. Similar results were also obtained in cells exposed to bacteriophages treated with DNAse (Figure 2). However, no phage DNA was detected when BHK-21 cells were infected with ϕΔTOX:GFP incubated with chitosan, confirming the inactivating action of chitosan on ϕΔTOX:GFP (Figure 2).

1e456d93-26da-417e-a08c-4c70d3b789c9_figure2.gif

Figure 2. Detection of ϕΔTOX:GFP DNA in transfected mammalian cells.

A. PCR on DNA extracted from BHK-21 cells: 24 hours after transduction, BHK-21 cells were washed and treated with Trypsin-EDTA solution. DNA was extracted and PCR was performed. Lane 1: Cells transfected with ϕΔTOX:GFP. Lane 2: Cells transfected with ϕΔTOX:GFP previously treated with chitosan. Lane 3: Cells transfected with ϕΔTOX:GFP previously treated with DNAse. Lane 4. Untreated cells. Lane 5. Positive PCR control (ϕΔTOX:GFP DNA). Lane 6. Negative PCR control. Lane 7. 1 kb ladder (Invitrogen).

GFP detection in mice inoculated with the lysogenic E. coli C600ΔTOX:GFP strain

To demonstrate the in vivo dissemination of ϕΔTOX:GFP, mice were infected with the lysogenic E. coli C600ΔTOX:GFP strain followed by gastrointestinal administration of ciprofloxacin. In order to evaluate the effect of chitosan in vivo, a group of mice was administered with chitosan 2 hours post-induction and a control group of uninfected mice was evaluated for auto-fluorescence background control in each organ. One day after infection, organs were harvested and examined for GFP expression. As shown in Figure 3, GFP was detected in the intestine, liver and, to a lesser extent, kidney of mice orally infected with the lysogenic E. coli C600ΔTOX:GFP strain and treated with ciprofloxacin. Remarkably, administration of chitosan 2 hours after infection caused a sharp decrease in GFP detection in organs of orally infected mice (Figure 3, panels A and B). Moreover, positive detection of phages was observed in intestine homogenates and blood samples of infected mice after ciprofloxacin induction (data not shown). These results indirectly demonstrate that ϕΔTOX:GFP is released by the lysogenic bacterial E. coli strain and systemically spread and transduce cells in different mouse organs and tissues after oral infection and lytic induction. Another possibility is that, the bacteriophage could be taken by pinocytosis by eukaryotic cells, and, once inside the cell, GFP or Stx2 are expressed.

1e456d93-26da-417e-a08c-4c70d3b789c9_figure3.gif

Figure 3. Detection of in vivo GFP expression in mice infected with the lysogenic E. coli C600ΔTOX:GFP strain using In Vivo Imaging System (IVIS).

A. IVIS Representative image: ciprofloxacin was administered 2 hours post-infection to induce ϕΔTOX:GFP in vivo. Mice were treated with chitosan 2 hours after bacteriophage induction. All mice were sacrificed 24 hours post-infection and brains, hearts, lungs, livers, spleens, kidneys and intestines were harvested and analyzed by IVIS. Fluorescence intensity was recorded as photons/sec/cm2, and the signal intensity represents the amount of GFP present. B. Graphic of fluorescence intensity on GFP-positive organs. Four animals per group were analyzed and the fluorescence intensity was quantified using Living Imaging 4.3.1 in Calipter Life Sciences.

Effect of chitosan on the mortality of mice orally inoculated with the EHEC EDL933W strain

In order to evaluate the in vivo effect of chitosan during the infection process, mice were intragastrically infected with a wild-type EHEC EDL933W strain, based on the model described by Brando and collaborators10. Another mouse group was also treated with chitosan, intragastrically administered 2 hours post-infection, and survival was followed for one week. Partial protection was observed in mice treated with chitosan as demonstrated by the delay in the death time (Figure 4). Mice infected with the EHEC EDL933W strain died 72 hours post-infection while mice infected with the same strain and subsequently treated with chitosan died 168 hours after infection.

1e456d93-26da-417e-a08c-4c70d3b789c9_figure4.gif

Figure 4. Treatment with chitosan delays death of mice infected with the EHEC EDL933W strain.

Mice were infected orally with the EHEC EDL933W strain. Controls did not receive chitosan (dots and broken line) and the experimental group received chitosan 2 hours post-infection (square and fill line). Survival rates were followed for one week.

Figure 1B
Time (hours)Non-InducedInducedChitosan 2 hs post-inductionChitosan 4 hs post-induction
000000000
200244018802100189019202020
400562056400058006200
Dataset 1.Induction of ϕΔTOX:GFP strain by ciprofloxacin and chitosan effect.
Induction of ϕΔTOX:GFP by ciprofloxacin and effect of chitosan in vitro. A. Growth curve: the E. coli C600DTOX:GFP strain was induced with ciprofloxacin and the optical density was measured at 600 nm at 0, 2, 4 and 6 hours after induction. Non-induced culture of E. coli C600DTOX:GFP strain was used as control. Chitosan was added at 2 or 4 hours after induction. B. Bacteriophage ϕΔTOX:GFP titers: bacteriophage titers were determined at 0, 2, 4 and 6 hours post-induction. Chitosan was added at 2 or 4 h post-induction. *p<0.05.

Discussion

Lambda bacteriophages are used as carriers in gene transfer and vaccine delivery experiments based on the capacity to in vivo transduce mammalian cells11. Tyler and collaborators recently showed that prophage induction is required for renal disease and lethality in the EHEC mouse model, suggesting that free bacteriophages encoding Stx may play a direct role in the disease4. Our results give a further support to that hypothesis and help understand why only small numbers of bacteria are usually capable to induce HUS in humans3. If bacteriophages are induced in the gastrointestinal tract, infect different host cells, and promote Stx expression, a reduced number of bacteria would suffice to cause significant damage.

In previous reports, we showed that the native phage promoter controlling Stx expression is active in eukaryotic cells both in vitro1 and in vivo2 conditions. Based on these results, we sought to evaluate whether bacteriophages could be considered a target for treating STEC infections. To this aim, we used GFP as an in vitro and in vivo reporter of phage dissemination based on a lysogenic E. coli C600ΔTOX:GFP strain and following bacteriophage induction. GFP expression was observed in liver, intestine and kidney of mice orally infected with the lysogenic strain and subsequently exposed to phage inducing conditions by oral administration with ciprofloxacin. Of particular relevance was the observation that chitosan, a natural polysaccharide polycationic polymer, exerted a direct inactivation effect on ϕΔTOX:GFP in vitro and drastically reduced the detection of fluorescence in mice orally infected with the lysogenic E. coli C600ΔTOX:GFP strain. Our findings indicate that chitosan possesses strong anti-bacteriophage effects in vitro and probably also in vivo, as demonstrated with the lysogenic E. coli C600ΔTOX:GFP strain. This positively charged polymeric polysaccharide has been reported to inhibit other bacteriophages and probably acts through electrostatic interactions with negatively charged capsid proteins6. Based on these effects we propose that chitosan could be a viable alternative for the treatment of STEC infections. Chitosan is already used in food and medicine, and it is harmless to humans, making it a cheap and safe option for this application.

The same chitosan protective effects were also observed in vivo based on mice infected with the wild-type EHEC EDL933W strain which is lysogenic for the same bacteriophage used to generate the E. coli C600ΔTOX:GFP strain. The fact that only partial protection was observed in mice infected with the E. coli C600ΔTOX:GFP strain and subsequently treated with chitosan may be due to the short half-life of the compound12.

Altogether, these findings suggest a paradigm change on the role of bacteriophages in STEC infections, indicating that these bacteriophages have a pivotal role on the development of HUS. The present observations further suggest that prophylaxis and treatment of human bacterial infections carrying virulence factors on lysogenic bacteriophages could require targeting of the bacteriophages instead of, or as well as, the bacteria and toxins involved.

Data availability

F1000Research: Dataset 1. Induction of ϕΔTOX:GFP strain by ciprofloxacin and chitosan effect, 10.5256/f1000research.3718.d3426913

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 18 Mar 2014
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Amorim JH, Del Cogliano ME, Fernandez-Brando RJ et al. Role of bacteriophages in STEC infections: new implications for the design of prophylactic and treatment approaches [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:74 (https://doi.org/10.12688/f1000research.3718.2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 26 Aug 2014
Revised
Views
26
Cite
Reviewer Report 05 Jan 2015
Mikael Skurnik, Department of Bacteriology and Immunology, University of Helsinki, Helsinki, Finland 
Approved with Reservations
VIEWS 26
First of all I am sorry for the long delay in my getting back to this evaluation. While the authors have replied adequately to some of my comments there are some that are not. I will deal them below.

Major points:

Point ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Skurnik M. Reviewer Report For: Role of bacteriophages in STEC infections: new implications for the design of prophylactic and treatment approaches [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:74 (https://doi.org/10.5256/f1000research.5299.r5927)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
15
Cite
Reviewer Report 29 Dec 2014
Cristina Ibarra, Laboratory of Physiopathology, University of Buenos Aires, Buenos Aires, Argentina 
Approved
VIEWS 15
This is an interesting paper where the authors have examined the hypothesis that  the stx-carrying prophage upon induction in vivo are required for the development of HUS in the murine model. Eukaryotic host cells would transduce these phages, leading to ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Ibarra C. Reviewer Report For: Role of bacteriophages in STEC infections: new implications for the design of prophylactic and treatment approaches [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:74 (https://doi.org/10.5256/f1000research.5299.r6885)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
23
Cite
Reviewer Report 09 Sep 2014
Raúl Raya, Genetics and Molecular Biology, Centro de Referencia Para Lactobacilos (CERELA), San Miguel de Tucumán, Argentina 
Approved
VIEWS 23
I consider the authors have satisfactorily answered all my comments and that the manuscript is acceptable.
 
Should the phrase:  “The fact that only partial protection was observed in mice infected with the E. coli C600ΔTOX:GFP strain and subsequently treated with chitosan may be due ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Raya R. Reviewer Report For: Role of bacteriophages in STEC infections: new implications for the design of prophylactic and treatment approaches [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:74 (https://doi.org/10.5256/f1000research.5299.r6090)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 18 Mar 2014
Views
39
Cite
Reviewer Report 17 Apr 2014
Raúl Raya, Genetics and Molecular Biology, Centro de Referencia Para Lactobacilos (CERELA), San Miguel de Tucumán, Argentina 
Approved with Reservations
VIEWS 39
The article written by Amorim et al. describes the anti-phage activity of chitosan on two variants (wild type and a derivative where the stx gene was replaced by the gfp gene) of the temperate Shiga-toxin producing phage EDL933W. The anti-phage ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Raya R. Reviewer Report For: Role of bacteriophages in STEC infections: new implications for the design of prophylactic and treatment approaches [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:74 (https://doi.org/10.5256/f1000research.3984.r4510)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 01 Aug 2014
    Leticia Bentancor, Laboratorio de Ingeniería Genética y Biología Celular y Molecular, Universidad Nacional de Quilmes, Buenos Aires, 1876, Argentina
    01 Aug 2014
    Author Response
    Phage Induction/anti-phage effects of chitosan/Figure 1:

    The higher final OD values determined on the cells treated with chitosan 2 hours post-induction, versus the OD value determined on un-induced cells, is not ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 01 Aug 2014
    Leticia Bentancor, Laboratorio de Ingeniería Genética y Biología Celular y Molecular, Universidad Nacional de Quilmes, Buenos Aires, 1876, Argentina
    01 Aug 2014
    Author Response
    Phage Induction/anti-phage effects of chitosan/Figure 1:

    The higher final OD values determined on the cells treated with chitosan 2 hours post-induction, versus the OD value determined on un-induced cells, is not ... Continue reading
Views
45
Cite
Reviewer Report 31 Mar 2014
Mikael Skurnik, Department of Bacteriology and Immunology, University of Helsinki, Helsinki, Finland 
Approved with Reservations
VIEWS 45
The paper by Amorim et al. deals with the role of bacteriophages in STEC-infections. The authors have earlier demonstrated that the stx genes can be expressed within eukaryotic cells, provided the prophage-carried stx-DNA is introduced there in naked form, i.e., in ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Skurnik M. Reviewer Report For: Role of bacteriophages in STEC infections: new implications for the design of prophylactic and treatment approaches [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2014, 3:74 (https://doi.org/10.5256/f1000research.3984.r4170)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 01 Aug 2014
    Leticia Bentancor, Laboratorio de Ingeniería Genética y Biología Celular y Molecular, Universidad Nacional de Quilmes, Buenos Aires, 1876, Argentina
    01 Aug 2014
    Author Response
    Major:
    1. A dose-response curve of chitosan was done. We used 5mg/ml, 2.5mg/ml and 1mg/ml of chitosan on purified bacteriophage. To evaluate it, the bacteriophage solution was incubated for 10 minutes at
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 01 Aug 2014
    Leticia Bentancor, Laboratorio de Ingeniería Genética y Biología Celular y Molecular, Universidad Nacional de Quilmes, Buenos Aires, 1876, Argentina
    01 Aug 2014
    Author Response
    Major:
    1. A dose-response curve of chitosan was done. We used 5mg/ml, 2.5mg/ml and 1mg/ml of chitosan on purified bacteriophage. To evaluate it, the bacteriophage solution was incubated for 10 minutes at
    ... Continue reading

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 18 Mar 2014
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.