Transcriptional responses of <i>Anopheles gambiae s.s </i>mosquito larvae to chronic exposure of cadmium heavy metal

Catherine N. Muturi; Martin K.  Rono; Daniel K.  Masiga; Francis N.  Wachira; Richard  Ochieng; Paul O.  Mireji

doi:10.12688/f1000research.13062.2

Home Browse Transcriptional responses of Anopheles gambiae s.s mosquito larvae...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Revised

Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal

[version 2; peer review: 1 approved, 1 approved with reservations, 1 not approved]

Catherine N. Muturi ¹, Martin K. Rono^2,3, Daniel K. Masiga⁴, Francis N. Wachira⁵, Richard Ochieng⁶, Paul O. Mireji^2,7

Catherine N. Muturi ¹, Martin K. Rono^2,3, [...] Daniel K. Masiga⁴, Francis N. Wachira⁵, Richard Ochieng⁶, Paul O. Mireji^2,7

PUBLISHED 25 Jun 2018

Author details Author details

¹ Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya
² Centre for Geographic Medicine Research Coast, Kenya Medical Research Institute, Kilifi, Kenya
³ Pwani University Health and Research Institute, Kilifi, Kenya
⁴ Molecular Biology and Biotechnology Unit, International Centre of Insect Physiology and Ecology, Nairobi, Kenya
⁵ South Eastern Kenya University, Kitui, Kenya
⁶ School of Biological Sciences, University of Nairobi, Nairobi, Kenya
⁷ Biotechnology Research Institute, Kenya Agricultural and Livestock Research Organization, Kikuyu, Kenya

Catherine N. Muturi
Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing

Martin K. Rono
Roles: Conceptualization, Writing – Review & Editing

Daniel K. Masiga
Roles: Conceptualization, Resources, Supervision, Writing – Review & Editing

Francis N. Wachira
Roles: Supervision, Writing – Review & Editing

Richard Ochieng
Roles: Methodology, Resources

Paul O. Mireji
Roles: Conceptualization, Funding Acquisition, Project Administration, Supervision, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

Abstract

Background: Anopheles gambiae larvae traditionally thrive in non-polluted environments. We previously documented the presence of the larvae in heavy metal polluted urban aquatic environments and the associated biological cost. The goal of this study was to unravel the molecular dynamics involved in the adaptation of the mosquitoes to the heavy metals.
Methods: Total RNA was extracted from third instar larvae of both cadmium treated populations and untreated control populations. The RNA concentrations were normalized and complementary DNAs were prepared. Then annealing control primer (ACP) technology was applied to establish transcriptional responses in An. gambiae larvae following several generational (n=90) chronic exposures to cadmium. Differentially expressed genes were determined by their differential banding patterns on an agarose gel. Gel extraction and purification was then carried out on the DEGs and these were later cloned and sequenced to establish the specific transcripts.
Results: We identified 14 differentially expressed transcripts in response to the cadmium exposure in the larvae. Most (11) of the transcripts were up-regulated in response to the cadmium exposure and were putatively functionally associated with metabolism, transport and protein synthesis processes. The transcripts included ATP-binding cassette transporter, eupolytin, ribosomal RNA, translation initiation factor, THO complex, lysosomal alpha-mannosidase, sodium-independent sulfate anion transporter and myotubularin related protein 2. The down-regulated transcripts were functionally associated with signal transduction and proteolytic activity and included Protein G12, adenylate cyclase and endoplasmic reticulum metallopeptidase.
Conclusions: Our findings shed light on pathways functionally associated with the adaptation to heavy metals that can be targeted in integrated vector control programs, and potential An. gambiae larvae biomarkers for assessment of environmental stress or contamination.

Keywords

Anopheles gambiae larvae, differentially expressed genes, cadmium, heavy metal tolerance

Corresponding author: Catherine N. Muturi

Competing interests: No competing interests were disclosed.

Grant information: Funding for this study was provided by the Department of Research and Extension, Egerton University and the DAAD in-country Scholarship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2018 Muturi CN et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

How to cite: Muturi CN, Rono MK, Masiga DK et al. Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal [version 2; peer review: 1 approved, 1 approved with reservations, 1 not approved]. F1000Research 2018, 6:2173 (https://doi.org/10.12688/f1000research.13062.2) First published: 22 Dec 2017, 6:2173 (https://doi.org/10.12688/f1000research.13062.1) Latest published: 25 Jun 2018, 6:2173 (https://doi.org/10.12688/f1000research.13062.2)

Revised Amendments from Version 1

In the previous version (check in the materials and methods section-RNA isolation) we had only stated that total RNA that had been extracted was quantified using the micro-spectrophotometer Genequant pro because this was the main equipment that we used for quantification of RNA and we had not recorded the outcome of the quantification.

In the new version, we have included quantification that had also been done for a few samples using the NanoDrop^®(Thermo Scientific). The quantification outcome which demonstrates the RNA integrity, has now been recorded in Table 1 for RNA quantification using the micro-spectrophotometer Genequant pro, and in Table 2 for RNA quantification using the NanoDrop^® (Thermo Scientific).

RNA is susceptible to degradation due to the presence of RNases in the environment. High quality RNA is required for downstream applications and therefore RNA must be quantified to ensure its integrity. To estimate RNA purity, the ratio of the Absorbance contributed by the RNA to the Absorbance of the contaminants is calculated. The acceptable ratios for purity or typical requirements for A260/A280 ratios are 1.8-2.2.

The extracted RNAs that were considered for the downstream application in Gene fishing Technology were those that met this criterion of purity as stated above.

The added information was in response to the question raised by: Shüné V. Oliver. The other question that had previously been raised by David Essumang, about the generations, I responded to his comment and the information he had requested was already present in the manuscript.

See the authors' detailed response to the review by Shüné V. Oliver
See the authors' detailed response to the review by David Essumang

Introduction

Heavy metal pollution has become a global environmental problem and severely threatens biological diversity and human health. Our studies on adaptation to heavy metals have documented presence of the mosquitoes in polluted habitats (Mireji et al., 2008) with growing evidence that this adaptation comes at a biological cost to the mosquito (Mireji et al., 2010b). Similar biological costs to adaptations have also been observed elsewhere in Culex pipiens L responses to cadmium, copper, lead and mercury (El-Sheikh et al., 2010). To date, molecular dynamics underpinning heavy metal tolerance in insects have been tied to transcripts and genes associated functionally with immunity (Sorvari et al., 2007) and defense and repair mechanisms such as glutathione transferases and heat shock proteins (Liao & Freedman, 1998; Kim et al., 2000; Stohs et al., 2001). We have previously putatively implicated metallothioneins, alpha-tubulin and cytochrome p450 genes associated with defense, repair and pyrethroid metabolism mechanisms in insects with heavy metal tolerance, using single gene assessment approaches with Anopheles gambiae mosquito larvae (Mireji et al., 2010b; Mireji et al., 2006; Musasia et al., 2013). Here, we have emulated ab initio relatively higher throughput annealing control primer (ACP) transcriptional profiling, to identify:

1) Pathways functionally associated with heavy metal adaptation observed in the field and their associated biological costs (Mireji et al., 2008; Mireji et al., 2010b); and
2) Potential An. gambiae larvae biomarkers that can be applied for assessment of environmental stress or contamination.

Methods

Sample insects

Anopheles gambiae s.s mosquitoes that had been collected from the Mbita field station (00.025’S, 34.013’E), Homa Bay County in Kenya were used for the study. The colony was kept in the Animal Rearing and Quarantine Unit (ARQU) at the International Centre of Insect Physiology and Ecology (ICIPE), Nairobi, Kenya. Larval stages of Anopheles gambiae s.s. were selected for tolerance to cadmium heavy metal through chronic exposures of Maximun Acceptable Toxicant Concentration (MATC) that had been empirically determined (Mireji et al., 2010a). Cadmium metal tolerant strains and control (untreated) strains of the mosquito were raised separately and in triplicates. All subsequent generations of the mosquito were subjected to chronic exposures of cadmium metal as described in Mireji et al., (2010a). Standard Operating Procedure (SOP) for the rearing of Anopheles mosquitoes was followed for colony maintenance (Ford & Green, 1972). Cadmium used in our study was applied as Cadmium Chloride (CdCl₂) 99.99% pure (Fisher Scientific LLC, Fair Lawn, NJ, U.S.A).

RNA isolation

Total RNA was extracted from the third instar larvae of experimental and control An. gambiae populations using Trizol (Invitrogen). Quantification of the extracted RNA was done using the micro-spectrophotometer Genequant pro (Amersham Pharmacia Ltd., Bucks, UK) (Table 1) and a few samples were quantified using the NanoDrop^® (Therm Scientific) (Table 2). In addition, DNaseI digestion was carried out to remove any residual DNA that could present in the extracted RNA. Total RNA that was isolated was stored at -80°C.

Table 1. RNA Quantification of the Control samples (CT) and Cadmium treated samples (CD) that were extracted using the Trizol reagent (Invitrogen).

RNA Quantification was done using the Micro-Spectrometer GeneQuant pro (Amersham Pharmacia Ltd, Bucks, UK).

SAMPLE ID	A260/A280	RNA Concentration (µg/ml)
CT10	1.887	236.04
CT11	1.840	180.96
CT12	1.858	153.52
CT13	1.899	264.65
CT14	1.850	189.21
CT15	1.849	241.36
CT16	1.865	230.27
CT17	1.843	158.25
CT18	1.881	188.18
CT19	1.869	190.38
CD10	1.930	296.83
CD11	1.898	240.82
CD12	1.913	236.82
CD13	1.933	225.05
CD14	1.934	283.98
CD15	1.853	187.16
CD16	1.845	244.09
CD17	1.918	252.15
CD18	1.923	298.63
CD19	1.898	153.81

Table 2. RNA Quantification of a few Control samples (CT) and Cadmium treated RNA samples (CD) that were extracted using the Trizol reagent (Invitrogen).

Quantification was done using the NanoDrop^® (Thermo Scientific).

SAMPLE ID	RNA Concentration	UNIT	A260/A280
CT1	2115.2	ng/µl	1.96
CT2	3189.2	ng/µl	2.0
CD1	1824.2	ng/µl	2.0
CD2	3061.2	ng/µl	2.0

GeneFishing^™ Reverse Transcription

The total RNA extracted from experimental and control An. gambiae populations were normalized to same concentrations and directly used for the synthesis of first strand complementary DNA (cDNA) using reverse transcriptase (Hwang et al., 2003). Reverse transcription was carried out in a final reaction volume of 20µl containing 2µg of the purified mRNA at 42°C for 1.5 hours. The components of the reaction were: 4µl of 5X reaction buffer (Promega, Madison, WI, U.S.A), 2µl of 10µmol cDNA synthesis dT-ACP 1 primer (5’- CGTGAATGCTGCGACTACGATIIIII(T)₁₈-3’), 5µl dNTPS- 2mM each, 0.5µl RNase inhibitor(40U/µl, Promega) and 1µl Moloney murine leukemia virus reverse transcriptase (200U/µl, Promega). The synthesized first strand cDNA was diluted by adding 80µl ultra-purified water. Storage was at -20°C awaiting PCR procedure.

ACP based- GeneFishing^™ PCR

Annealing control primer based PCR using the GeneFishing^™ DEG kit from Seegene, Seoul, South Korea (Kim et al., 2004), was used to determine differentially expressed genes in the heavy metal treated group and the control population.

Synthesis of the second strand cDNA and PCR was carried out in a single tube. The second strand was synthesized in one cycle of first stage PCR at 50°C, in a final reaction volume of 20µl. The components in the reaction tubes included 3–5µl of diluted first strand cDNA, 1µl 10Mm dT-ACP2 reverse primer (5’-CTGTGAATGCTGCGACTACGATIIIII(T)₁₅-3’), 10µl 2x master mix (Seegene, Seoul, South Korea) and 1µl 10µM arbitrary ACP (forward primer).

PCR procedures for the synthesis of the second strand were completed in one cycle, at 94°C for 1 min then 50°C for 3min and 72°C for 1 min.

The second stage of the PCR protocol consisted of 40 cycles at 94°C for 40s, 65°C for 40s, 72°C for 40s and the final extension for 10 min at 72°C. 2% agarose gel electrophoresis with ethidium bromide staining was used for separation of the PCR products.

Gel extraction

Differentially expressed bands in the control and cadmium exposed population subjected to the same primer set were excised from the agarose gel using a scapel under Ultra Violet illumination. The gel slices were then purified using the QIAquick^® gel extraction kit (QIAGEN, Inc., Valencia, CA), following the instructions from the manufacturer.

Cloning

Gel-purified PCR products were directly cloned into a pGEMT Easy vector (Invitrogen, Carlsbad, CA, USA), using JM109 competent cells. Colonies were grown at 37°C for 18 hours on Luria broth agar plates, containing ampicillin, X-gal and IPTG for blue/white colony screening. Cloned plasmids were then purified using the GeneJET^™ Miniprep kit (Fermentus, Thermo Fisher Scientific Inc.), as per the instructions from the manufacturer.

Sequencing

Sequencing was done with ABI PRISM^® 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using M13 primers. The sequences were edited using VecScreen and BioEdit software. Edited sequences were analyzed by searching for similarities in VectorBase against the Anopheles gambiae PEST strain transcripts sequences, AgamP4.6 geneset using the BLASTn search program (Altschul et al., 1990)

Results

We successfully implemented the ACP system to identify differentially expressed genes (DEGs) in larvae chronically exposed to cadmium, as previously demonstrated in blastocyst experiments (Cui et al., 2005; Hwang et al., 2004; Hwang et al., 2005). Our differential banding patterns of the cDNA representation of DEGs is summarized in Figure 1. Fourteen DEGs were identified after chronic exposure of An. gambiae larvae to cadmium heavy metal (Table 3). Most (11) of the differentially expressed genes were induced in cadmium exposed relative to the cadmium un-exposed controls. Our BLAST (REF) results revealed that the cadmium induced transcripts were clustered into metabolism (AGAP008584-RA, AGAP001249-RA and AGAP009563-RA), transport (AGAP012302-RA and AGAP002638-RA) and protein synthesis (AGAP028915-RA, AGAP004750-RA, AGAP028391-RA, AGAP003870-RA, AGAP028907-RA, AGAP028818-RA and AGAP028899-RA) processes.

Figure 1. Differential cDNA banding patterns in cadmium treated and control population of mosquito larvae.

The arrows indicate the DEGs observed using ACP 75, ACP 76 and ACP 78 primer set. Number 1 represents Cadmium population while 2 represents control population. M= 50bp molecular marker. High intensity of a band represents an up-regulation of a particular gene in cadmium or control population.

Table 3. Blastn results from VectorBase.

Sequence data obtained was blasted against Anopheles gambiae PEST strain transcript sequences, AgamP4.6 geneset in May 2017.

Gene	Gene name	Description of gene product	E-Value	% ID	Expression pattern
AGAP002638-RA	ABCH1	ATP-binding cassette transporter (ABC transporter) family H member 1	3	77.5	Up
AGAP001249-RA		Eupolytin	3e-31	98.7	Up
AGAP028915-RA	SSU_rRNA_eukaryotic	Eukaryotic small subunit ribosomal RNA	8e-79	98.2	Up
AGAP004750-RA		Translation initiation factor 4G	6.4	87	Up
AGAP028915-RA	SSU_rRNA_eukaryotic	Eukaryotic small subunit ribosomal RNA	8e-78	99.4	Up
AGAP006187-RA		Protein G12	6.8	100	Down
AGAP003078-RA		Endoplasmic reticulum metallopeptidase 1	1.5	80.6	Down
AGAP028391-RA	lsu rRNA		3e-103	100	Up
AGAP028915-RA	SSU_rRNA_eukaryotic	Eukaryotic small subunit ribosomal RNA	4e-49	96.6	Up
AGAP028915-RA	SSU_rRNA_eukaryotic	Eukaryotic small subunit ribosomal RNA	5e-81	98.8	Up
AGAP003870-RA	Thoc7	THO complex subunit 7	6.4	87	Up
AGAP008584-RA		Lysosomal alpha-mannosidase	3.4	90.5	Up
AGAP010252-RA	RpL23	60S ribosomal protein L23	4e-12	100	Up
AGAP028907-RA	SSU_rRNA_eukaryotic	Eukaryotic small subunit ribosomal RNA	3e-06	91.2	Up
AGAP028818-RA	5_8S_rRNA	5.8S ribosomal RNA	3e-37	98.9	Up
AGAP028899-RA	SSU_rRNA_eukaryotic	Eukaryotic small subunit ribosomal RNA	2e-08	100	Up
AGAP009563-RA		Myotubularin related protein 2	0.74	91.3	Up
AGAP002262-RA		Adenylate cyclase 8	9.6	100	Down
AGAP012302-RA		Sodium-independent sulfate anion transporter	0.36	88.9	Up

Three of the DEGs identified were suppressed in the cadmium exposed larvae and these included AGAP006187-RA, AGAP002262-RA and AGAP003078-RA.

Dataset 1.Sequence data obtained after sequence analysis using the BioEdit software.

The sequences were subsequently taken through a BLAST search. The results of the sequence analysis are shown on the manuscript.

Dataset 2.Sample of the colony PCR experiment.

The gel photo of a colony PCR of 20 samples that was carried out after blue/white colony screening using M13 primers.

Discussion

We identified ATP-binding cassette transporters belonging to the superfamily of membrane proteins that are present in all living organisms (Dean & Annilo, 2005). They are normally associated with movement of substrates such as amino acids, peptides, sugars, metals, inorganic ions, lipids, lipopolysaccharides and xenobiotics across biological membranes (Dawson & Locher, 2006; Hollenstein et al., 2007a). The ABC transporters have been shown to affect development, metabolism and insecticide resistance in insects (Borycz et al., 2008; Dow & Davies, 2006; Ricardo & Lehmann, 2009; Vache et al., 2007). The silencing of the ABCH1 gene has been shown to result in the death of larvae and pupae (Guo et al., 2015). Therefore, induction of the ABC transporters may suggest that they are involved in cadmium transport through membranes to reduce toxicity of cadmium metal to the larvae in their environment.

The induction of the eupolytin gene may have a role in the activation of defense molecules. In a study involving the ground beetle Eupolyphaga sinensis, eupolytin-1 gene encoding a protease was shown to be involved in the activation of plasminogen and hydrolysis of fibrinogen (Yang et al., 2011).

Ribosomal genes are involved in protein synthesis and upregulation of the various arrays of ribosomal RNAs in this study, which suggests their role in enhancing the survival of An. gambiae in the heavy metal polluted environment by the transcription and translation of genes which are important in the adaptation of the larvae to xenobiotics.

The nuclear structure referred to as THO complex is usually conserved in all kingdoms, and it has an important role in the packing of pre-mRNA molecules into RNA-protein assemblies which are termed mRNPs (Köhler & Hurt, 2007). A study carried out recently has shown that the THO complex is required for efficient expression of some genes, ensuring genetic stability thereby preventing transcription-associated recombination (Gewartowski et al., 2012). The expression of the THO complex is suggestive of its role in expressing defense genes that enhance survival of larvae in a Cadmium polluted environment.

Suppression of AGAP006187-RA, AGAP002262-RA and AGAP003078-RA transcripts that included G- Proteins couple receptors to adenylyl cyclase stimulation indicated increasing levels of cAMP and a cascade of events that constitute the signal transduction pathway that drive cellular responses. Metallopeptidases are a ubiquitous and diverse group of enzymes containing both endopeptidases and exopeptidases. Although they vary widely at the sequence, structural, and functional levels, they all require a metal ion for catalytic activity (Rawlings & Salvesen, 2013). The suppression of these important genes involved in signal transduction and proteolytic activity would account for the larval mortality rates that are usually observed in larvae raised in the cadmium heavy metal environment.

Our findings shed light on the adaptation of the An. gambiae mosquito to heavy metals by differentially expressing particular genes in response to a toxicant impact. A study to determine differentially expressed genes in cadmium-exposed sebastes schlegeli unraveled genes related to pathogenesis, extrinsic stresses, and catalytic metabolites (Woo & Yum, 2014). Previous studies have indicated that metallothionein and α-tubulin genes that are present in insects can be used as potential biomarkers (Hare, 1992; Klerks & Weis, 1987; Mattingly et al., 2001; Roesijadi, 1994). Metallothionein was assessed through C. quinquefasciatus mosquito larvae for Copper, Cadmium and Zinc aquatic environmental levels (Sarkar et al., 2004). Therefore, the genes identified might be useful in the development of potential biomarkers that can be used to assess the level of environmental pollution of heavy metal origin in An. gambiae mosquitoes.

Conclusions

We were able to identify genes that are differentially expressed due to chronic exposure of An. gambiae larvae to cadmium metal using the ACP-based PCR method. However, application of more sensitive techniques like those used in proteomics would generate more data.

Data availability

Dataset 1: Sequence data obtained after sequence analysis using the BioEdit software. The sequences were subsequently taken through a BLAST search. The results of the sequence analysis are shown on the manuscript. DOI, 10.5256/f1000research.13062.d187045 (Muturi et al., 2017a).

Dataset 2: Sample of the colony PCR experiment. The gel photo of a colony PCR of 20 samples that was carried out after blue/white colony screening using M13 primers. DOI, 10.5256/f1000research.13062.d187046 (Muturi et al., 2017b).

Competing interests

No competing interests were disclosed.

Grant information

Funding for this study was provided by the Department of Research and Extension, Egerton University and the DAAD in-country Scholarship.

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Acknowledgements

We hereby wish to acknowledge the following individuals for their contribution to this work:

The Head of the Capacity Building Department at ICIPE, for granting us permission to carry out this work in their Molecular and Biotechnology unit.

The Director of the Research and Extension Department at Egerton University.

The DAAD team for the financial support, which enabled this work to be completed.

Faculty Opinions recommended

References

Altschul SF, Gish W, Miller W, et al.: Basic local alignment search tool. J Mol Biol. 1990; 215(3): 403–410. PubMed Abstract | Publisher Full Text
Borycz J, Borycz JA, Kubow A, et al.: Drosophila ABC transporter mutants white, brown and scarlet have altered contents and distribution of biogenic amines in the brain. J Exp Biol. 2008; 211(Pt 21): 3454–3466. PubMed Abstract | Publisher Full Text
Cui XS, Shin MR, Lee KA, et al.: Identification of differentially expressed genes in murine embryos at the blastocyst stage using annealing control primer system. Mol Reprod Dev. 2005; 70(3): 278–287. PubMed Abstract | Publisher Full Text
Dawson RJ, Locher KP: Structure of a bacterial multidrug ABC transporter. Nature. 2006; 443(7108): 180–185. PubMed Abstract | Publisher Full Text
Dean M, Annilo T: Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates. Annu Rev Genomics Hum Genet. 2005; 6: 123–142. PubMed Abstract | Publisher Full Text
Dow JA, Davies SA: The Malpighian tubule: rapid insights from post-genomic biology. J Insect Physiol. 2006; 52(4): 365–378. PubMed Abstract | Publisher Full Text
El-Sheikh TMY, Fouda MA, Hassan MI, et al.: Toxicological Effects of Some Heavy Metal Ions on Culex pipiens L. (Diptera: Culicidae). Acad J Biolog Sci. 2010; 2(1): 63–76. Reference Source
Ford HR, Green E: Laboratory rearing of Anopheles albimanus. Mosq News. 1972; 32: 509–513. Reference Source
Gewartowski K, Cuéllar J, Dziembowski A, et al.: The yeast THO complex forms a 5-subunit assembly that directly interacts with active chromatin. Bioarchitecture. 2012; 2(4): 134–137. PubMed Abstract | Publisher Full Text | Free Full Text
Guo Z, Kang S, Zhu X, et al.: The novel ABC transporter ABCH1 is a potential target for RNAi-based insect pest control and resistance management. Sci Rep. 2015; 5: 13728. PubMed Abstract | Publisher Full Text | Free Full Text
Hare L: Aquatic insects and trace metals: bioavailability, bioaccumulation, and toxicity. Crit Rev Toxicol. 1992; 22(5–6): 327–369. PubMed Abstract | Publisher Full Text
Hollenstein K, Frei DC, Locher KP: Structure of an ABC transporter in complex with its binding protein. Nature. 2007a; 446(7132): 213–216. PubMed Abstract | Publisher Full Text
Hwang KC, Cui XS, Park SP, et al.: Identification of differentially regulated genes in bovine blastocysts using an annealing control primer system. Mol Reprod Dev. 2004; 69(1): 43–51. PubMed Abstract | Publisher Full Text
Hwang IT, Kim YJ, Kim SH, et al.: Annealing control primer system for improving specificity of PCR amplification. Biotechniques. 2003; 35(6): 1180–1184. PubMed Abstract
Hwang KC, Lee HY, Cui XS, et al.: Identification of maternal mRNAs in porcine parthenotes at the 2-cell stage: a comparison with the blastocyst stage. Mol Reprod Dev. 2005; 70(3): 314–323. PubMed Abstract | Publisher Full Text
Kim KA, Chakraborti T, Goldstein GW, et al.: Immediate early gene expression in PC12 cells exposed to lead: Requirement for protein kinase C. J Neurochem. 2000; 74(3): 1140–1146. PubMed Abstract | Publisher Full Text
Kim YJ, Kwak CI, Gu YY, et al.: Annealing control primer system for identification of differentially expressed genes on agarose gels. Biotechniques. 2004; 36(3): 424–6, 428, 430 passim. PubMed Abstract | Publisher Full Text
Klerks PL, Weis JS: Genetic adaptation to heavy metals in aquatic organisms: a review. Environ Pollut. 1987; 45(3): 173–205. PubMed Abstract | Publisher Full Text
Köhler A, Hurt E: Exporting RNA from the nucleus to the cytoplasm. Nat Rev Mol Cell Biol. 2007; 8(10): 761–73. PubMed Abstract | Publisher Full Text
Liao VH, Freedman JH: Cadmium-regulated genes from the nematode Caenorhabditis elegans. Identification and cloning of new cadmium-responsive genes by differential display. J Biol Chem. 1998; 273(48): 31962–31970. PubMed Abstract | Publisher Full Text
Mattingly KS, Beaty BJ, Mackie RS, et al.: Molecular cloning and characterization of a metal responsive Chironomus tentans alpha-tubulin cDNA. Aquat Toxicol. 2001; 54(3–4): 249–260. PubMed Abstract | Publisher Full Text
Mireji PO, Keating J, Hassanali A, et al.: Biological cost of tolerance to heavy metals in the mosquito Anopheles gambiae. Med Vet Entomol. 2010b; 24(2): 101–107. PubMed Abstract | Publisher Full Text | Free Full Text
Mireji PO, Keating J, Hassanali A, et al.: Expression of metallothionein and alpha-tubulin in heavy metal-tolerant Anopheles gambiae sensu stricto (Diptera: Culicidae). Ecotoxicol Environ Saf. 2010a; 73(1): 46–50. PubMed Abstract | Publisher Full Text | Free Full Text
Mireji PO, Keating J, Hassanali A, et al.: Heavy metals in mosquito larval habitats in urban Kisumu and Malindi, Kenya, and their impact. Ecotoxicol Environ Saf. 2008; 70(1): 147–153. PubMed Abstract | Publisher Full Text | Free Full Text
Mireji PO, Keating J, Kenya E, et al.: Differential Induction of Proteins in Anopheles gambiae sensu stricto (Diptera: Cullicidae) Larvae in Response to Heavy Metal Selection. Int J Trop Insect Sci. 2006; 26(4): 214–226. PubMed Abstract | Publisher Full Text | Free Full Text
Musasia FK, Isaac AO, Masiga DK, et al.: Sex-specific induction of CYP6 cytochrome P450 genes in cadmium and lead tolerant Anopheles gambiae. Malar J. 2013; 12: 97. PubMed Abstract | Publisher Full Text | Free Full Text
Muturi CN, Rono MK, Masiga DK, et al.: Dataset 1 in: Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal. F1000Research. 2017a. Data Source
Muturi CN, Rono MK, Masiga DK, et al.: Dataset 2 in: Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal. F1000Research. 2017b. Data Source
Rawlings ND, Salvesen GS: Handbook of Proteolytic Enzymes. Elsevier, San Diego, Calif, USA. 2013. Reference Source
Ricardo S, Lehmann R: An ABC transporter controls export of a Drosophila germ cell attractant. Science. 2009; 323(5916): 943–946. PubMed Abstract | Publisher Full Text | Free Full Text
Roesijadi G: Metallothionein induction as a measure of response to metal exposure in aquatic animals. Environ Health Perspect. 1994; 102(Suppl 12): 91–95. PubMed Abstract | Free Full Text
Sarkar S, Duttagupta AK, Mal TK: Effects of heavy metals on population growth and metallothionein gene expression in the mosquito Culex quinquefasciatus, from Calcutta, India. Environ Pollut. 2004; 127(2): 183–193. PubMed Abstract | Publisher Full Text
Sorvari J, Rantala LM, Rantala MJ, et al.: Heavy metal pollution disturbs immune response in wild ant populations. Environ Pollut. 2007; 145(1): 324–328. PubMed Abstract | Publisher Full Text
Stohs SJ, Bagchi D, Hassoun E, et al.: Oxidative mechanisms in the toxicity of chromium and cadmium ions. J Environ Pathol Toxicol Oncol. 2001; 20(2): 77–88. PubMed Abstract | Publisher Full Text
Vache C, Camares O, Cardoso-Ferreira MC, et al.: A potential genomic biomarker for the detection of polycyclic aromatic hydrocarbon pollutants: multidrug resistance gene 49 in Drosophila melanogaster. Environ Toxicol Chem. 2007; 26(7): 1418–1424. PubMed Abstract | Publisher Full Text
Woo S, Yum S: Differentially Expressed Genes in Cadmium-Exposed Sebastes Schlegeli Using Dd-Pcr. App Sci Report. 2014; 6(2): 62–66. Reference Source
Yang H, Wang Y, Xiao Y, et al.: A bi-functional anti-thrombosis protein containing both direct-acting fibrin(ogen)olytic and plasminogen-activating activities. PLoS One. 2011; 6(3): e17519. PubMed Abstract | Publisher Full Text | Free Full Text

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 22 Dec 2017

Author details Author details

Martin K. Rono
Roles: Conceptualization, Writing – Review & Editing

Daniel K. Masiga
Roles: Conceptualization, Resources, Supervision, Writing – Review & Editing

Francis N. Wachira
Roles: Supervision, Writing – Review & Editing

Richard Ochieng
Roles: Methodology, Resources

Paul O. Mireji
Roles: Conceptualization, Funding Acquisition, Project Administration, Supervision, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

Funding for this study was provided by the Department of Research and Extension, Egerton University and the DAAD in-country Scholarship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (2)

version 2

Revised

Published: 25 Jun 2018, 6:2173

https://doi.org/10.12688/f1000research.13062.2

version 1

Published: 22 Dec 2017, 6:2173

https://doi.org/10.12688/f1000research.13062.1

© 2018 Muturi CN et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Muturi CN, Rono MK, Masiga DK et al. Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal [version 2; peer review: 1 approved, 1 approved with reservations, 1 not approved]. F1000Research 2018, 6:2173 (https://doi.org/10.12688/f1000research.13062.2)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?

Key to Reviewer Statuses VIEW HIDE

ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions

Version 2

VERSION 2

PUBLISHED 25 Jun 2018

Revised

Views

Reviewer Report 04 Feb 2019

Dick Roelofs, Department of Ecological Science, Faculty of Science, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands

Not Approved

https://doi.org/10.5256/f1000research.16709.r43256

The authors apply a differential PCR method to discover and identify differentially expresses genes between control A. gambiae populations and populations adapted to cadmium. 14 differentially expressed transcripts were identified and annotated upon sequencing.

While the RNA extraction and initial cDNA synthesis were executed properly, I'm worried about the follow up steps and the verification of up- or down regulation.

Major Issues:

Second stage PCR of 40 cycles may introduce tremendous bias in fragments that differ in PCR efficiency. After so many cycles only shorter fragments will be preferentially amplified. This may inpart explain why so few DEGs have been identified in this study. All other competing DEGs with lower efficiency will be lost.
The GeneFishing technique is outdated. I would rather recommend SSH, microarray analysis or RNAseq. All of these techniques would give a much more complete picture of gentic differentces in the Cd adapted populations.
It is essential to verify DEGs using for instance QPCR. I used to work with differential PCR screening, and quite a number of the initial leads were false positives. So, an independent second method should be used to validate the DEGs
Most of the identified DEGS are associated with rRNA indicating that the dT-ACP 1 primer was not specific enough to target mRNA. This is very worrying and confirms my 1st issue raised.

In conclusion, these are very preliminary data generated with an out dated system.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

No
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Ecological genomics, transcriptomics, comparative genomics. Molecular ecology of stress adaptation

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

CITE

Report a concern

Respond or Comment

Views

Reviewer Report 25 Jun 2018

Shüné V. Oliver, Centre for Emerging, Zoonotic and Parasitic Diseases Centre for Emerging, Zoonotic and Parasitic Diseases, National Institute for Communicable Diseases, Johannesburg, South Africa

Approved

https://doi.org/10.5256/f1000research.16709.r35426

I am satisfied with ... Continue reading

CITE

Report a concern

Respond or Comment

Version 1

VERSION 1

PUBLISHED 22 Dec 2017

Views

Reviewer Report 29 May 2018

Shüné V. Oliver, Centre for Emerging, Zoonotic and Parasitic Diseases Centre for Emerging, Zoonotic and Parasitic Diseases, National Institute for Communicable Diseases, Johannesburg, South Africa

Approved with Reservations

https://doi.org/10.5256/f1000research.14161.r34199

This manuscript is technically sound, and presents a worthwhile body of research. I would recommend accepting. However, there is one major correction that must be made before accepting. Please give details about the assessment of RNA integrity. Without this, the ... Continue reading

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 11 Jun 2018

Catherine Ngambi, Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya

11 Jun 2018

Author Response

Thanks so much for your positive review of the manuscript.

I am sorry, I had not given the data about the RNA integrity but had only stated that I ... Continue reading Thanks so much for your positive review of the manuscript.

I am sorry, I had not given the data about the RNA integrity but had only stated that I had

quantified the extracted RNA using the microspectrophotometer genequant pro.

I have revised the manuscript and have indicated the quantification results and the equipments used.
To estimate RNA purity, the ratio of the Absorbance contributed by the RNA to the Absorbance of the contaminants is calculated. The acceptable ratios for purity or typical requirements for A260/A280 ratios are 1.8-2.2.

The samples that were use for the downstream application were those that met the purity criteria of 1.8-2.2, that is the ratios for A260/A280.
Therefore, the revised document now contains these details.

Kindest Regards,
Catherine.
Thanks so much for your positive review of the manuscript.

I am sorry, I had not given the data about the RNA integrity but had only stated that I had

quantified the extracted RNA using the microspectrophotometer genequant pro.

I have revised the manuscript and have indicated the quantification results and the equipments used.
To estimate RNA purity, the ratio of the Absorbance contributed by the RNA to the Absorbance of the contaminants is calculated. The acceptable ratios for purity or typical requirements for A260/A280 ratios are 1.8-2.2.

The samples that were use for the downstream application were those that met the purity criteria of 1.8-2.2, that is the ratios for A260/A280.
Therefore, the revised document now contains these details.

Kindest Regards,
Catherine.
Competing Interests: No competing interests. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 11 Jun 2018

Catherine Ngambi, Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya

11 Jun 2018

Author Response

Thanks so much for your positive review of the manuscript.

I am sorry, I had not given the data about the RNA integrity but had only stated that I ... Continue reading Thanks so much for your positive review of the manuscript.

I am sorry, I had not given the data about the RNA integrity but had only stated that I had

quantified the extracted RNA using the microspectrophotometer genequant pro.

I have revised the manuscript and have indicated the quantification results and the equipments used.
To estimate RNA purity, the ratio of the Absorbance contributed by the RNA to the Absorbance of the contaminants is calculated. The acceptable ratios for purity or typical requirements for A260/A280 ratios are 1.8-2.2.

The samples that were use for the downstream application were those that met the purity criteria of 1.8-2.2, that is the ratios for A260/A280.
Therefore, the revised document now contains these details.

Kindest Regards,
Catherine.
Thanks so much for your positive review of the manuscript.

I am sorry, I had not given the data about the RNA integrity but had only stated that I had

quantified the extracted RNA using the microspectrophotometer genequant pro.

I have revised the manuscript and have indicated the quantification results and the equipments used.
To estimate RNA purity, the ratio of the Absorbance contributed by the RNA to the Absorbance of the contaminants is calculated. The acceptable ratios for purity or typical requirements for A260/A280 ratios are 1.8-2.2.

The samples that were use for the downstream application were those that met the purity criteria of 1.8-2.2, that is the ratios for A260/A280.
Therefore, the revised document now contains these details.

Kindest Regards,
Catherine.
Competing Interests: No competing interests. Close
Report a concern

Views

Reviewer Report 29 Jan 2018

David Essumang, Department of Chemistry, University of Cape Coast, Cape Coast, Ghana

Approved with Reservations

https://doi.org/10.5256/f1000research.14161.r29393

The main work is outside my expertise and I was struggling to make some meaningful contribution. The bulk of the work is in molecular experimentation and I have limited knowledge in their methods. However, my major concern with the entomological aspect is that the authors did not show how long (the number of generations) the mosquitoes were exposed to the heavy metal during the selection. This would be helpful if someone wants to repeat the work.

Furthermore, the study did not show the impact of the biomarkers identified in the development, enzyme activities and insecticide resistance of the mosquitoes used for the study.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Environmental Scientist

CITE

Report a concern

Author Response 02 Feb 2018

Catherine Ngambi, Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya

02 Feb 2018

Author Response

Thanks so much for you review on my article. I appreciate.
I wanted to respond to the question raised about the number of generations that mosquitoes were exposed to cadmium ... Continue reading Thanks so much for you review on my article. I appreciate.
I wanted to respond to the question raised about the number of generations that mosquitoes were exposed to cadmium heavy metal. As stated in the Abstract its for 90 generations.
Kindest regards,
Catherine.
Thanks so much for you review on my article. I appreciate.
I wanted to respond to the question raised about the number of generations that mosquitoes were exposed to cadmium heavy metal. As stated in the Abstract its for 90 generations.
Kindest regards,
Catherine.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 02 Feb 2018

Catherine Ngambi, Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya

02 Feb 2018

Author Response

Thanks so much for you review on my article. I appreciate.
I wanted to respond to the question raised about the number of generations that mosquitoes were exposed to cadmium ... Continue reading Thanks so much for you review on my article. I appreciate.
I wanted to respond to the question raised about the number of generations that mosquitoes were exposed to cadmium heavy metal. As stated in the Abstract its for 90 generations.
Kindest regards,
Catherine.
Thanks so much for you review on my article. I appreciate.
I wanted to respond to the question raised about the number of generations that mosquitoes were exposed to cadmium heavy metal. As stated in the Abstract its for 90 generations.
Kindest regards,
Catherine.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 22 Dec 2017

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2	3
Version 2 (revision) 25 Jun 18		read	read
Version 1 22 Dec 17	read	read

David Essumang, University of Cape Coast, Cape Coast, Ghana
Shüné V. Oliver, National Institute for Communicable Diseases, Johannesburg, South Africa
Dick Roelofs, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

12 Views

04 Feb 2019 | for Version 2

Dick Roelofs, Department of Ecological Science, Faculty of Science, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands

12 Views Cite this report Responses(0)

Not Approved

Second stage PCR of 40 cycles may introduce tremendous bias in fragments that differ in PCR efficiency. After so many cycles only shorter fragments will be preferentially amplified. This may inpart explain why so few DEGs have been identified in this study. All other competing DEGs with lower efficiency will be lost.
The GeneFishing technique is outdated. I would rather recommend SSH, microarray analysis or RNAseq. All of these techniques would give a much more complete picture of gentic differentces in the Cd adapted populations.
It is essential to verify DEGs using for instance QPCR. I used to work with differential PCR screening, and quite a number of the initial leads were false positives. So, an independent second method should be used to validate the DEGs
Most of the identified DEGS are associated with rRNA indicating that the dT-ACP 1 primer was not specific enough to target mRNA. This is very worrying and confirms my 1st issue raised.

In conclusion, these are very preliminary data generated with an out dated system.

Is the work clearly and accurately presented and does it cite the current literature?

No
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

No
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Ecological genomics, transcriptomics, comparative genomics. Molecular ecology of stress adaptation

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

15 Views

25 Jun 2018 | for Version 2

Shüné V. Oliver, Centre for Emerging, Zoonotic and Parasitic Diseases Centre for Emerging, Zoonotic and Parasitic Diseases, National Institute for Communicable Diseases, Johannesburg, South Africa

15 Views Cite this report Responses(0)

Approved

I am satisfied with the requisite methodological changes.

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

15 Views

29 May 2018 | for Version 1

Shüné V. Oliver, Centre for Emerging, Zoonotic and Parasitic Diseases Centre for Emerging, Zoonotic and Parasitic Diseases, National Institute for Communicable Diseases, Johannesburg, South Africa

15 Views Cite this report Responses(1)

Approved With Reservations

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Not applicable
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Respond to this report

Responses (1)

Author Response

11 Jun 2018

Catherine Ngambi, Department of Biochemistry and Molecular Biology, Egerton University, Egerton, Kenya

Thanks so much for your positive review of the manuscript.

I am sorry, I had not given the data about the RNA integrity but had only stated that I had

quantified the extracted RNA using the microspectrophotometer genequant pro.

I have revised the manuscript and have indicated the quantification results and the equipments used.
To estimate RNA purity, the ratio of the Absorbance contributed by the RNA to the Absorbance of the contaminants is calculated. The acceptable ratios for purity or typical requirements for A260/A280 ratios are 1.8-2.2.

The samples that were use for the downstream application were those that met the purity criteria of 1.8-2.2, that is the ratios for A260/A280.
Therefore, the revised document now contains these details.

Kindest Regards,
Catherine.

View more View less

Competing Interests

No competing interests.

Back to all reports

Reviewer Report

20 Views

29 Jan 2018 | for Version 1

David Essumang, Department of Chemistry, University of Cape Coast, Cape Coast, Ghana

20 Views Cite this report Responses(1)

Approved With Reservations

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Environmental Scientist

Respond to this report

Responses (1)

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

Click here to access the data.

Downloaded data do not display as expected? Download the data

Click here to access the data.

Downloaded data do not display as expected? Download the data

[1] Altschul SF, Gish W, Miller W, et al.: Basic local alignment search tool. J Mol Biol. 1990; 215(3): 403–410. PubMed Abstract | Publisher Full Text

[2] Borycz J, Borycz JA, Kubow A, et al.: Drosophila ABC transporter mutants white, brown and scarlet have altered contents and distribution of biogenic amines in the brain. J Exp Biol. 2008; 211(Pt 21): 3454–3466. PubMed Abstract | Publisher Full Text

[3] Cui XS, Shin MR, Lee KA, et al.: Identification of differentially expressed genes in murine embryos at the blastocyst stage using annealing control primer system. Mol Reprod Dev. 2005; 70(3): 278–287. PubMed Abstract | Publisher Full Text

[4] Dawson RJ, Locher KP: Structure of a bacterial multidrug ABC transporter. Nature. 2006; 443(7108): 180–185. PubMed Abstract | Publisher Full Text

[5] Dean M, Annilo T: Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates. Annu Rev Genomics Hum Genet. 2005; 6: 123–142. PubMed Abstract | Publisher Full Text

[6] Dow JA, Davies SA: The Malpighian tubule: rapid insights from post-genomic biology. J Insect Physiol. 2006; 52(4): 365–378. PubMed Abstract | Publisher Full Text

[7] El-Sheikh TMY, Fouda MA, Hassan MI, et al.: Toxicological Effects of Some Heavy Metal Ions on Culex pipiens L. (Diptera: Culicidae). Acad J Biolog Sci. 2010; 2(1): 63–76. Reference Source

[8] Ford HR, Green E: Laboratory rearing of Anopheles albimanus. Mosq News. 1972; 32: 509–513. Reference Source

[9] Gewartowski K, Cuéllar J, Dziembowski A, et al.: The yeast THO complex forms a 5-subunit assembly that directly interacts with active chromatin. Bioarchitecture. 2012; 2(4): 134–137. PubMed Abstract | Publisher Full Text | Free Full Text

[10] Guo Z, Kang S, Zhu X, et al.: The novel ABC transporter ABCH1 is a potential target for RNAi-based insect pest control and resistance management. Sci Rep. 2015; 5: 13728. PubMed Abstract | Publisher Full Text | Free Full Text

[11] Hare L: Aquatic insects and trace metals: bioavailability, bioaccumulation, and toxicity. Crit Rev Toxicol. 1992; 22(5–6): 327–369. PubMed Abstract | Publisher Full Text

[12] Hollenstein K, Frei DC, Locher KP: Structure of an ABC transporter in complex with its binding protein. Nature. 2007a; 446(7132): 213–216. PubMed Abstract | Publisher Full Text

[13] Hwang KC, Cui XS, Park SP, et al.: Identification of differentially regulated genes in bovine blastocysts using an annealing control primer system. Mol Reprod Dev. 2004; 69(1): 43–51. PubMed Abstract | Publisher Full Text

[14] Hwang IT, Kim YJ, Kim SH, et al.: Annealing control primer system for improving specificity of PCR amplification. Biotechniques. 2003; 35(6): 1180–1184. PubMed Abstract

[15] Hwang KC, Lee HY, Cui XS, et al.: Identification of maternal mRNAs in porcine parthenotes at the 2-cell stage: a comparison with the blastocyst stage. Mol Reprod Dev. 2005; 70(3): 314–323. PubMed Abstract | Publisher Full Text

[16] Kim KA, Chakraborti T, Goldstein GW, et al.: Immediate early gene expression in PC12 cells exposed to lead: Requirement for protein kinase C. J Neurochem. 2000; 74(3): 1140–1146. PubMed Abstract | Publisher Full Text

[17] Kim YJ, Kwak CI, Gu YY, et al.: Annealing control primer system for identification of differentially expressed genes on agarose gels. Biotechniques. 2004; 36(3): 424–6, 428, 430 passim. PubMed Abstract | Publisher Full Text

[18] Klerks PL, Weis JS: Genetic adaptation to heavy metals in aquatic organisms: a review. Environ Pollut. 1987; 45(3): 173–205. PubMed Abstract | Publisher Full Text

[19] Köhler A, Hurt E: Exporting RNA from the nucleus to the cytoplasm. Nat Rev Mol Cell Biol. 2007; 8(10): 761–73. PubMed Abstract | Publisher Full Text

[20] Liao VH, Freedman JH: Cadmium-regulated genes from the nematode Caenorhabditis elegans. Identification and cloning of new cadmium-responsive genes by differential display. J Biol Chem. 1998; 273(48): 31962–31970. PubMed Abstract | Publisher Full Text

[21] Mattingly KS, Beaty BJ, Mackie RS, et al.: Molecular cloning and characterization of a metal responsive Chironomus tentans alpha-tubulin cDNA. Aquat Toxicol. 2001; 54(3–4): 249–260. PubMed Abstract | Publisher Full Text

[22] Mireji PO, Keating J, Hassanali A, et al.: Biological cost of tolerance to heavy metals in the mosquito Anopheles gambiae. Med Vet Entomol. 2010b; 24(2): 101–107. PubMed Abstract | Publisher Full Text | Free Full Text

[23] Mireji PO, Keating J, Hassanali A, et al.: Expression of metallothionein and alpha-tubulin in heavy metal-tolerant Anopheles gambiae sensu stricto (Diptera: Culicidae). Ecotoxicol Environ Saf. 2010a; 73(1): 46–50. PubMed Abstract | Publisher Full Text | Free Full Text

[24] Mireji PO, Keating J, Hassanali A, et al.: Heavy metals in mosquito larval habitats in urban Kisumu and Malindi, Kenya, and their impact. Ecotoxicol Environ Saf. 2008; 70(1): 147–153. PubMed Abstract | Publisher Full Text | Free Full Text

[25] Mireji PO, Keating J, Kenya E, et al.: Differential Induction of Proteins in Anopheles gambiae sensu stricto (Diptera: Cullicidae) Larvae in Response to Heavy Metal Selection. Int J Trop Insect Sci. 2006; 26(4): 214–226. PubMed Abstract | Publisher Full Text | Free Full Text

[26] Musasia FK, Isaac AO, Masiga DK, et al.: Sex-specific induction of CYP6 cytochrome P450 genes in cadmium and lead tolerant Anopheles gambiae. Malar J. 2013; 12: 97. PubMed Abstract | Publisher Full Text | Free Full Text

[27] Muturi CN, Rono MK, Masiga DK, et al.: Dataset 1 in: Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal. F1000Research. 2017a. Data Source

[28] Muturi CN, Rono MK, Masiga DK, et al.: Dataset 2 in: Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal. F1000Research. 2017b. Data Source

[29] Rawlings ND, Salvesen GS: Handbook of Proteolytic Enzymes. Elsevier, San Diego, Calif, USA. 2013. Reference Source

[30] Ricardo S, Lehmann R: An ABC transporter controls export of a Drosophila germ cell attractant. Science. 2009; 323(5916): 943–946. PubMed Abstract | Publisher Full Text | Free Full Text

[31] Roesijadi G: Metallothionein induction as a measure of response to metal exposure in aquatic animals. Environ Health Perspect. 1994; 102(Suppl 12): 91–95. PubMed Abstract | Free Full Text

[32] Sarkar S, Duttagupta AK, Mal TK: Effects of heavy metals on population growth and metallothionein gene expression in the mosquito Culex quinquefasciatus, from Calcutta, India. Environ Pollut. 2004; 127(2): 183–193. PubMed Abstract | Publisher Full Text

[33] Sorvari J, Rantala LM, Rantala MJ, et al.: Heavy metal pollution disturbs immune response in wild ant populations. Environ Pollut. 2007; 145(1): 324–328. PubMed Abstract | Publisher Full Text

[34] Stohs SJ, Bagchi D, Hassoun E, et al.: Oxidative mechanisms in the toxicity of chromium and cadmium ions. J Environ Pathol Toxicol Oncol. 2001; 20(2): 77–88. PubMed Abstract | Publisher Full Text

[35] Vache C, Camares O, Cardoso-Ferreira MC, et al.: A potential genomic biomarker for the detection of polycyclic aromatic hydrocarbon pollutants: multidrug resistance gene 49 in Drosophila melanogaster. Environ Toxicol Chem. 2007; 26(7): 1418–1424. PubMed Abstract | Publisher Full Text

[36] Woo S, Yum S: Differentially Expressed Genes in Cadmium-Exposed Sebastes Schlegeli Using Dd-Pcr. App Sci Report. 2014; 6(2): 62–66. Reference Source

[37] Yang H, Wang Y, Xiao Y, et al.: A bi-functional anti-thrombosis protein containing both direct-acting fibrin(ogen)olytic and plasminogen-activating activities. PLoS One. 2011; 6(3): e17519. PubMed Abstract | Publisher Full Text | Free Full Text

Transcriptional responses of Anopheles gambiae s.s mosquito larvae to chronic exposure of cadmium heavy metal

Abstract

Keywords

Revised Amendments from Version 1

Introduction

Methods

Sample insects

RNA isolation

Table 1. RNA Quantification of the Control samples (CT) and Cadmium treated samples (CD) that were extracted using the Trizol reagent (Invitrogen).

Table 2. RNA Quantification of a few Control samples (CT) and Cadmium treated RNA samples (CD) that were extracted using the Trizol reagent (Invitrogen).

GeneFishing™ Reverse Transcription

ACP based- GeneFishing™ PCR

Gel extraction

Cloning

Sequencing

Results

Figure 1. Differential cDNA banding patterns in cadmium treated and control population of mosquito larvae.

Table 3. Blastn results from VectorBase.

Discussion

Conclusions

Data availability

Competing interests

Grant information

Acknowledgements

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

The problem

How to fix it

The problem

How to fix it

Competing Interests Policy

Stay Updated

GeneFishing^™ Reverse Transcription

ACP based- GeneFishing^™ PCR