ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Brief Report

Towards establishing extracellular vesicle-associated RNAs as biomarkers for HER2+ breast cancer

[version 1; peer review: 1 approved, 2 approved with reservations]
PUBLISHED 23 Nov 2020
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Cell & Molecular Biology gateway.

Abstract

Extracellular vesicles (EVs) are emerging as key players in breast cancer progression and hold immense promise as cancer biomarkers. However, difficulties in obtaining sufficient quantities of EVs for the identification of potential biomarkers hampers progress in this area. To circumvent this obstacle, we cultured BT-474 breast cancer cells in a two-chambered bioreactor with CDM-HD serum replacement to significantly improve the yield of cancer cell-associated EVs and eliminate bovine EV contamination. Cancer-relevant mRNAs BIRC5 (Survivin) and YBX1, as well as long-noncoding RNAs HOTAIR, ZFAS1, and AGAP2-AS1 were detected in BT-474 EVs by quantitative RT-PCR. Bioinformatics meta-analyses showed that BIRC5 and HOTAIR RNAs were substantially upregulated in breast tumours compared to non-tumour breast tissue, warranting further studies to explore their usefulness as biomarkers in patient EV samples. We envision this effective procedure for obtaining large amounts of cancer-specific EVs will accelerate discovery of EV-associated RNA biomarkers for cancers including HER2+ breast cancer.

Keywords

Extracellular vesicles, exosomes, survivin/BIRC5, long-noncoding RNA, CELLine bioreactor, HOTAIR

Introduction

Interactions between tumour and stromal cells sculpt the tumour microenvironment and contribute to cancer malignancy, metastasis and immune evasion. Extracellular vesicles (EVs)1 mediate one of the key intercellular interactions by shuttling biomolecules in micro and nanoscale lipid-enclosed packages. EVs have been associated in many studies with resistance of cancer to chemo or radio therapies2.

EVs contain cargo specific to their parental cell, are very stable, and circulate in blood and other bodily fluids. These properties make EVs prime candidates for cancer detection in liquid biopsies3, either alone or combined with the detection of circulating tumour DNA (ctDNA) or circulating tumour cells (CTCs)4. Upregulation of RNA transcripts including long-noncoding RNA (lncRNA) offers a means for distinguishing EVs originating from tumour and non-tumour cells. LncRNAs are greater than 200 nucleotide-long transcripts constituting two thirds of the transcriptome and they appear to play a critical role in carcinogenesis of many cancers including breast malignancies5. LncRNAs represent promising EV-associated biomarkers but difficulties in producing sufficient amounts of pure cancer associated EVs complicate validation of lncRNA presence in EVs.

Here, we present a simple solution for obtaining high quantities of cancer-associated EVs by culturing the HER2-positive breast cancer cell line BT-474 in a CELLine AD 1000 two-chamber bioreactor flask. The CELLine bioreactor system mimics physiological growth conditions by allowing 3D cell growth on a fibre-mimetic surface, resulting in increases in cell number and EV production6. This strategy allowed us to obtain sufficient EV yields to demonstrate that tumour cells release EVs associated with several potential breast cancer biomarkers.

Methods

Bioreactor culture

To prevent bovine EVs present in foetal calf serum (FCS) from contaminating the cancer-specific EVs, we cultured BT-474 cells from ATCC (ATCC® HTB-20™ ) (seeded at 4.5 × 108 cells/mL) in 15 mL Advanced DMEM/F-12 medium (Gibco, ThermoFisher Scientific, Waltham, USA) supplemented with 2% CDM-HD serum replacement (FiberCell Systems, New Market, USA) in the lower cell chamber of a CELLine AD 1000 bioreactor flask (Argos, Elgin, USA). The same media (150 mL) was used in the upper media chamber but supplemented with 2% FCS (Figure 1A). The dialysis membrane that separates the cell and media compartments allows FCS-specific nutrients <10 kDa but not EVs to pass through and nourish the cells. Every three to four days, the 15 mL of conditioned medium from the cell chamber was harvested for EV isolation, and the media from the upper chamber was replaced.

4109c79d-5b12-4547-b3ce-97cc05ae5951_figure1.gif

Figure 1. Purification and characterisation of BT-474 EVs.

(A) experimental procedure employed for extracellular vesicle (EV) production, isolation, and purification; (B) transmission electron microscopy image of a small EV; (C,D) hydrodynamic diameter distribution profiles of isolated large and small EVs measured by nanoparticle tracking analysis (NTA) with red vertical lines and blue numbers denote standard deviation and diameters at specific peaks, respectively; (E) EV concentration (empty squares) determined by NTA, and protein levels (filled squares) determined by BCA assay of fractions acquired during separation on a qEV Original size exclusion chromatography (SEC) column; and (F) immunoblot with antibodies specific for HER2, EpCAM and TSG101 proteins. Tetraspanin TSG101 is a loading control. MDA-MB-231 cell lysate serves as the negative control for HER2 and EpCAM proteins. Representative images/data from three independent experiments were shown in BF.

EV isolation and purification

EVs were isolated using differential centrifugation and size exclusion chromatography (SEC) as outlined in Figure 1. Conditioned medium (15 mL) was first centrifuged at 2,000 x g for 10 min to remove large debris, 10,000 x g for 30 min to isolate large EVs, and 100,000 x g for 70 min to isolate small EVs (Figure 1A). The resulting small EV suspension (in 500 µL PBS) was loaded onto a 35 nm qEV original size exclusion column (Izon, Christchurch, New Zealand), and fractions 7 through 24 were collected using an automated fraction collector (500 µL per fraction). BCA protein quantitation assay (Cat # 23225, Pierce, ThermoFisher Scientific, Waltham, USA) and Nanosight NS300 nanoparticle tracking analysis (NTA; Malvern Panalytical, Malvern, UK) were performed to quantitate protein and particle concentrations in each fraction, respectively. EV concentrations and size distributions were quantified on NTA by recording three 30 seconds videos under low flow conditions. EV-rich fractions (7–11) were pooled, quantified again using NTA and BCA, and concentrated by ultracentrifugation (Avanti, Beckman Coulter, Brea, USA) at 100,000 x g for 70 min.

EV visualisation by transmission electron microscopy (TEM)

Negative staining TEM of pooled EV fractions was conducted by adsorption onto Formvar-coated copper grids (Electron Microscopy Sciences, Hatfield, USA) for 2 min, then treated with 2% uranyl acetate for 2 min. Grids were then visualised on a Tecnai G2 Spirit TWIN (FEI, Hillsboro, OR, USA) transmission electron microscope at 120 kV accelerating voltage and images were captured using a Morada digital camera (SIS GmbH, Munster, Germany).

Protein analysis by western blotting

This procedure was carried out as described previously7. Breast cancer cell lines were grown to log-phase, washed twice with ice-cold PBS, and lysed in an sodium dodecyl sulphate (SDS) lysis buffer [60 mM Tris-HCl (pH 6.8 at 25°C), 2% (w/v) SDS, 10% glycerol]. Proteins (25 μg) were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to PVDF membranes. Membranes were subsequently immunoblotted with antibodies recognising human HER2 (mouse monoclonal, anti-Neu, Santa Cruz, Cat # sc-33684, RRID:AB_627996), human EpCAM (rabbit monoclonal, AbCAM, Cat # ab223582, RRID:AB_2762366), and human TSG101 (rabbit polyclonal, AbCAM, Cat # ab30871, RRID:AB_2208084) and corresponding secondary antibodies. Bound antibodies were visualized using Pierce™ ECL Western Blotting Substrate (ThermoFisher Scientific, Waltham, USA) and the chemiluminescence was measured using a BioRad ChemiDoc MP imaging system (Bio-Rad Laboratories, Inc., Hercules, USA).

RNA quantitation by qRT-PCR

Technical triplicates of Trizol-purified RNA from each experimental condition were reverse transcribed into cDNA using qScript Flex cDNA kit (Cat # 95049, Quantabio, Beverly, USA) primed with equal molar ratio of oligo-dT and random primers according to the manufacturer’s instructions. Quantitative RT-PCR was carried out using SYBR Green MasterMix (Life Technologies, Carlsbad, USA) and gene-specific primers previously validated in the literature (Table 1). These included protein-coding mRNAs EpCAM8, BIRC59, YBX110, GAPDH, and HPRT1, and lncRNAs ZFAS111, HOTAIR12, and AGAP2-AS113.

Table 1. Primers used for quantitative RT-PCR.

GeneForward primer (5’ → 3’)Reverse primer (5’ → 3’)
EpCAMAATCGTCAATGCCAGTGTACTTTCTCATCGCAGTCAGGATCATAA
BIRC5CTGCCTGGCAGCCCTTTCCTCCAAGAAGGGCCAGTTC
YBX1GGAGTTTGATGTTGTTGAAGGAAACTGGAACACCACCAGGAC
HPRT1TGAGGATTTGGAAAGGGTGTGCACACAGAGGGCTACAATG
GAPDHACGGGAAGCTTGTCATCAATTGGACTCCACGACGTACTCA
ZFASAAGCCACGTGCAGACATCTACTACTTCCAACACCCGCATT
HOTAIRGGTAGAAAAAGCAACCACGAAGCACATAAACCTCTGTCTGTGAGTGCC
AGAP2-AS1TACCTTGACCTTGCTGCTCTCTGTCCCTTAATGACCCCATCC

Bioinformatic meta-analyses

For this meta-analysis, the “RSEM expected count (DESeq2 standardized)” dataset was downloaded on 31st March 2020 from the TCGA_GTEx_TARGET cohort included in the UCSC Xena portal and was manually annotated. All data manipulations, plotting and statistical analyses were carried out in R computing environment (v 3.5.3) running in R Studio (v 1.1.414) on a Windows 10 x64 machine. The ggplot2 package (v 3.3.0) was used to render Figure 2B and 2C. Hedges g effect size was calculated using the function cohen.d in the effsize R package (v 0.8.0).

4109c79d-5b12-4547-b3ce-97cc05ae5951_figure2.gif

Figure 2. Bioinformatics meta-analysis of BT-474 extracellular vesicle (EV)-associated RNAs in tumour and non-tumour tissue.

(A) Relative mean mRNA abundance of five protein-coding genes (EpCAM, BIRC5, YBX1, GAPDH, HPRT1) and three long non-coding RNAs (ZFAS1, HOTAIR, AGAP2-AS1) in BT-474 cells and their EVs. Each data point represents the average of three independent experiments (error bars are SEM). (B) Comparison of RNA expression of the gene panel studied in (A) between human tumours and their respective non-tumour tissues deposited in TCGA and GTEx portals. Data were manually classified into 20 different organ categories (y-axis) including 8,867 samples across 28 different cancer types and 6,874 samples across 24 non-tumour tissue types. Colour and area of the circles represent median RNA abundance; darker and larger circles indicate higher RNA expression. (C) Distribution of RNA expression of studied genes in breast tumours and breast non-cancer tissues. Open diamonds denote means of each population. Hedges g effect sizes indicate a number of standard deviations that separates the tumour and non-tumour groups. Hedges g > 0.8 demonstrates large effect size, i.e., difference between the means clearly stands out from the “noise” within the groups.

An earlier version of this article can be found on bioRxiv (doi: https://doi.org/10.1101/2020.09.27.309252).

Results

EV production and isolation

The CELLine AD 1000 bioreactor increased the cell density and EV production due to the unique growth surfaces and fluid interactions6,14. In addition, the common issue of contaminating bovine EVs15,16 was avoided by using the serum replacement CDM-HD, which is chemically defined, protein free, and animal component free. From three independent experiments, we obtained an average of 1.9 ± 0.3 × 1011 large EVs of a mean diameter 150 ± 3 nm and 8.5 ± 0.7 × 1011 small EVs of a mean diameter 127 ± 5 nm. Negative-stained transmission electron microscope imaging showed the expected round EV morphology, and NTA size distributions resemble those seen from EVs produced in conventional culture flasks (Figure 1B–D). Low levels of contaminating proteins were observed in fractions 11–24 due to 2% CDM-HD serum replacement instead of the standard 5–10% FCS (Figure 1E). This allowed the accurate quantification of EV-associated protein markers without the concern of contaminating cellular proteins and demonstrated that the small EVs obtained using ultracentrifugation are suitable for RNA analysis.

EV molecular characterization

Both the BT-474 cell lysates and BT-474 EVs of all sizes and purities isolated contained TSG101, EpCAM, and HER2 proteins (Figure 1F). Consistent with the literature, the triple-negative MDA-MB-231 breast cancer cell line did not express detectable levels of HER2 and EpCAM17. TSG101 is a regulator of the endosomal sorting and trafficking process and is expected to be present in both cells and EVs18. EpCAM is a cell adhesion glycoprotein that has been used extensively as a liquid biopsy marker for several epithelial cancers19, whilst HER2 plays an important role in breast cancer subtyping. Interestingly, HER2-positive EVs appear to increase tumour proliferation and resistance to trastuzumab therapy20.

Quantification of the abundance of several EV-associated RNAs, including protein-coding mRNAs EpCAM, BIRC5, YBX1, GAPDH, and HPRT, as well as lncRNAs ZFAS1, HOTAIR, and AGAP2-AS1, was then performed using qRT-PCR. Despite well-documented differential expression in breast cancer, EpCAM mRNA was not found to be associated with the BT-474 EVs, while BT-474 small EVs were clearly associated with established breast cancer-specific RNAs, including mRNA BIRC5 and lncRNA HOTAIR (Figure 2A).

Differential expression of selected RNAs in cancer and normal tissues

We then explored the expression of the identical set of RNAs in 15,741 tumour and non-tumour tissue samples included in The Cancer Genome Atlas (TCGA) and Genotype Tissue Expression (GTEx) databases, respectively. Tumour and non-tumour tissues in all 20 tissues analysed expressed similar levels of YBX1, GAPDH, HPRT1, ZFAS1, and AGAP2-AS1 RNAs. The result indicates a limited use of these RNAs for differentiating tumour and non-tumour EVs. This result is consistent with the canonical “housekeeping” role of HPRT1 and GAPDH and suggests potential use of ZFAS1 and AGAP2-AS1 as housekeeping genes for analyses of lncRNAs in samples including tumour and non-tumour tissues, as well as cultured cells. Of the six candidate biomarkers investigated in this study, only BIRC59, EpCAM8 and lncRNA HOTAIR12 were found to be differentially expressed in a wide range of cancer types including breast cancer (Figure 2B and 2C).

Discussion

While EVs hold promise as liquid biopsy targets for breast cancer, efficient production of EVs for molecular characterisation of EV-associated RNA can be challenging using conventional culture systems. In this technical feasibility study, we circumvented this obstacle by culturing BT-474 cells, a commonly used HER2-positive cell line, in a CELLine AD 1000 two-chambered bioreactor, which increased the cell density and EV production due to the unique growth surface and fluid interactions14. In addition, the common issue of contaminating bovine EVs16 was avoided by using the serum replacement CDM-HD, which is chemically defined, protein free, and animal component free. This bioreactor system provided highly enriched EVs in 15 mL of conditioned media, avoiding the sample loss and extra time associated with pre-centrifugation concentrators.We verified that the EVs contained HER2, EpCAM, and TSG101 proteins. Transmission electron microscope imaging also allowed us to be confident that we had truly isolated small and large EVs in accordance with the MISEV guidelines21. We then demonstrated that the BT-474 small EVs were associated with lncRNAs ZFAS1, HOTAIR, and AGAP2-AS, as well as mRNAs BIRC5, YBX1, HPRT, and GAPDH using qRT-PCR.

Interestingly, the cancer-specific EpCAM mRNA was not detected in the small EVs although the EpCAM protein was detectable in the corresponding cell lysates, large EVs, and small EVs. Differential RNA expression in cancer, especially upregulation, has potential to infer a gene’s utility as a biomarker. Our finding indicates that RNAs BIRC5 and HOTAIR are promising EV-biomarkers, particularly in breast cancer, where they are substantially upregulated compared to non-tumour breast tissue. Of interest, EV associated lncRNA HOTAIR was reported to correlate with HER2-positive breast cancer22.

Currently, proteins dominate the EV biomarker field. However, novel EV-associated breast cancer biomarkers like lncRNAs and other RNAs are being explored more thoroughly to aid in detection and management. RNA biomarkers have higher sensitivity and specificity than proteins because PCR can amplify traces of RNA sequences with high specificity and sensitivity23. Further, it is more economical to detect RNA than protein biomarkers because each protein biomarker requires a specific antibody. These findings demonstrate the efficient production of enriched BT-474 EVs and highlight their unique cargo, especially BIRC5 mRNA and HOTAIR lncRNA. Further studies to determine their clinical significance are warranted.

Data availability

Underlying data

DRYAD: Towards establishing extracellular vesicle-associated RNAs as biomarkers for HER2+ breast cancer. https://doi.org/10.5061/dryad.jdfn2z39324.

This project contains the following underlying data:

  • - Figure_1B_image_hi_mag_25.tif (Raw data for TEM image, high magnification)

  • - Figure_1B_image_low_mag_24.tif (Raw data for TEM image, low magnification)

  • - Figure_1C_NTA_Capture_MEV_ExperimentReport.pdf (Raw data from hydrodynamic diameter distribution profiles of isolated large and small EVs measured by nanoparticle tracking analysis (NTA) with red vertical lines and blue numbers denote standard deviation and diameters at specific peaks, respectively)

  • - Figure_1D_NTA_Capture_SEV_ExperimentReport.pdf (Raw data from hydrodynamic diameter distribution profiles of isolated large and small EVs measured by nanoparticle tracking analysis (NTA) with red vertical lines and blue numbers denote standard deviation and diameters at specific peaks, respectively)

  • - Figure_1E_qEV_BCA_and_particle_data.xlsx (EV concentration determined by NTA, and protein levels determined by BCA assay of fractions acquired during separation on a qEV Original size exclusion chromatography (SEC) column)

  • - Figure_1F_raw_not_cropped.pptx (Raw western blot images)

  • - Figure 2A_RT_qPCR raw data.xlsx (Raw data for RT-qPCR to examine the mRNA expression level of five protein-coding genes (EpCAM, BIRC5, YBX1, GAPDH, HPRT1) and three long non-coding RNAs (ZFAS1, HOTAIR, AGAP2-AS1) in BT-474 cells and their EVs.)

  • - Figure 2B and C_meta_analysis_rawdata.xlsx (DeSeq2 normalised log2 (x+1) expression values of 10 genes in 8,867 tumours and 6,874 normal tissues downloaded on 31st March 2020 from the UCSC Xena portal)

Data are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

Comments on this article Comments (1)

Version 3
VERSION 3 PUBLISHED 04 May 2021
Revised
Version 1
VERSION 1 PUBLISHED 23 Nov 2020
Discussion is closed on this version, please comment on the latest version above.
  • Author Response 16 Feb 2021
    Eupehmia Leung, Auckland Cancer Society Research Centre, University of Auckland, Auckland, New Zealand
    16 Feb 2021
    Author Response
    We thank the reviewers for their valuable and constructive feedback.

    Reviewer 1 - Nagarajan Kannan:

    Extracellular vesicles (EV) are fast emerging as both therapeutic agents and biomarkers. Low ... Continue reading
  • Discussion is closed on this version, please comment on the latest version above.
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Hisey CL, Tomek P, Nursalim YNS et al. Towards establishing extracellular vesicle-associated RNAs as biomarkers for HER2+ breast cancer [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2020, 9:1362 (https://doi.org/10.12688/f1000research.27393.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 23 Nov 2020
Views
24
Cite
Reviewer Report 21 Dec 2020
Bruno M. Simoes, Manchester Breast Centre, Division of Cancer Sciences, University of Manchester, Manchester, UK 
Approved with Reservations
VIEWS 24
The authors report a novel culture model to isolate and increase the yield of extracellular vesicles (EVs) using a breast cancer cell line. They also claim that some RNA molecules present in EVs are predominantly expressed in tumour tissues compared ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Simoes BM. Reviewer Report For: Towards establishing extracellular vesicle-associated RNAs as biomarkers for HER2+ breast cancer [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2020, 9:1362 (https://doi.org/10.5256/f1000research.30272.r75232)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
21
Cite
Reviewer Report 07 Dec 2020
Tracy K. Hale, School of Fundamental Sciences, Massey University, Palmerston North, New Zealand 
Approved
VIEWS 21
The identification of extracellular vesicle (EV) biomakers is certainly of interest in breast cancer research. This paper presents methodology to grow and isolate sufficient EVs to enable the investigation of their cargo. This study describes the growth of the breast ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Hale TK. Reviewer Report For: Towards establishing extracellular vesicle-associated RNAs as biomarkers for HER2+ breast cancer [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2020, 9:1362 (https://doi.org/10.5256/f1000research.30272.r75229)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
32
Cite
Reviewer Report 07 Dec 2020
Nagarajan Kannan, Division of Experimental Pathology, Department of Laboratory Medicine and Pathology, Center for Regenerative Medicine, Mayo Clinic, Rochester, MN, USA 
Approved with Reservations
VIEWS 32
Extracellular vesicles (EV) are fast emerging as both therapeutic agents and biomarkers. Low yields of EVs in commonly used experimental models have somewhat diminished interest and their further scrutiny. Methodologies to improve EV yield in short term cultures are desirable ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Kannan N. Reviewer Report For: Towards establishing extracellular vesicle-associated RNAs as biomarkers for HER2+ breast cancer [version 1; peer review: 1 approved, 2 approved with reservations]. F1000Research 2020, 9:1362 (https://doi.org/10.5256/f1000research.30272.r75230)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (1)

Version 3
VERSION 3 PUBLISHED 04 May 2021
Revised
Version 1
VERSION 1 PUBLISHED 23 Nov 2020
Discussion is closed on this version, please comment on the latest version above.
  • Author Response 16 Feb 2021
    Eupehmia Leung, Auckland Cancer Society Research Centre, University of Auckland, Auckland, New Zealand
    16 Feb 2021
    Author Response
    We thank the reviewers for their valuable and constructive feedback.

    Reviewer 1 - Nagarajan Kannan:

    Extracellular vesicles (EV) are fast emerging as both therapeutic agents and biomarkers. Low ... Continue reading
  • Discussion is closed on this version, please comment on the latest version above.
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.